![]() |
|
|
3 Department of Pharmacology, University of Melbourne, Parkville, 3010, Australia; 4 Department of Biochemistry and Molecular Biology, Monash University, Clayton, 3800, Victoria, Australia; 5 Department of Medicine, University of Melbourne, Heidelberg Repatriation Hospital, Heidelberg Heights, 3081, Victoria, Australia; and 6 Department of Pharmacology, School of Medical Sciences, University of New South Wales, 2052, New South Wales, Australia
* To whom correspondence should be addressed. E-mail: m.morris{at}unsw.edu.au.
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The importance of early nutrition was initially demonstrated by manipulating litter sizes in rats such that rats from large litters received less milk during suckling over the first 3 wk of life (2). Studies have also shown that early postnatal overfeeding induced by reducing litter size results in increased body weight, hyperleptinemia, and hyperinsulinemia at weaning, whereas the converse occurs in underfed pups (3,4).
It has been postulated that any changes in nutrition at an early age could affect the normal development of the neuronal network regulating appetite. The development of the hypothalamic projections implicated in appetite regulation in rodents occurs predominantly after birth (1,5). Both leptin (6) and insulin (5) are critical for proper development of hypothalamic feeding circuits. In an adult rat, both leptin and insulin can signal the hypothalamus to regulate a number of peptides, including neuropeptide Y [NPY;7 reviewed in (7)]. NPY is produced in the arcuate nucleus (ARC) and released in several hypothalamic regions, including the paraventricular nucleus (PVN), where it has potent stimulatory effects on appetite (8). Central injection of NPY in rodents can cause marked hyperphagia and obesity (9) and can also reduce energy expenditure by inhibiting brown adipose tissue (BAT) thermogenesis (10) and suppressing nerve activity (11). The main modulator of NPY is leptin. Leptin is an adipocyte-derived hormone found predominantly in white adipose tissue (WAT) as well as in BAT. Leptin acts to inhibit NPY production by acting on Ob-Rb receptors that are coexpressed in NPY containing neurons, thereby decreasing NPY-induced feeding (12). Leptin administration can reduce food intake and increase energy expenditure, resulting in loss of fat mass and body weight (13). In chronic human obesity, it is thought that resistance to the actions of leptin develops despite markedly increased fat mass and leptin concentrations.
Adipose tissue plays an important role in the appetite-regulating system. Manipulation of litter size has been shown to affect adipocyte number but not size in adulthood (14), possibly affecting production of adipose-derived mediators such as leptin and uncoupling protein 1 (UCP-1) from BAT. UCP-1 expression is regulated by a number of physiological situations, with chronic cold exposure and high-fat feeding both increasing its expression. Leptin can also increase thermogenesis via UCP-1 activation, whereas glucocorticoids downregulate UCP-1 expression (15).
Increased body weight is consistently associated with hypertension, as well as cardiac hypertrophy, particularly in genetic models of obesity (16). Positive correlations exist between body weight, weight gain, obesity, and blood pressure in both adults and children (17). These associations are particularly evident during early life when phases of rapid growth are accompanied by an increase in blood pressure (18). Clinical studies have shown that a higher BMI during childhood is associated with an increased risk of chronic heart disease in adulthood (19). Although a recent study has shown that undernutrition in utero can result in increased blood pressure and cardiac fibrosis in adulthood in rats (20), it is not yet clear how changes in postnatal nutrition will affect the cardiovascular system.
The purpose of this study was to examine the early (24 d of age) and late (16 wk of age) impact of postnatal over- and underfeeding on physiological systems that control energy balance, food intake, and thermoregulation. Thus, we examined several components that regulate these systems, including plasma leptin, insulin, hypothalamic NPY, and UCP-1. To date, cardiovascular changes have not been studied in this model and this was examined by measuring blood pressure and cardiac fibrosis. We hypothesized that these mediators would be altered at an early age as a result of early onset over- and underfeeding and these effects would continue to be evident in adulthood.
| Methods |
|---|
|
|
|---|
Another cohort of rats was used to examine the long-term effects of litter size manipulation. Pups were weaned at 24 d of age and housed 3 per cage. Rats consumed ad libitum water and standard nonpurified diet and were followed up to 16 wk of age, during which time body weight and 24-h food intake of each cage were monitored weekly (study 2: LL, n = 23; NL, n = 19; SL, n = 21). Mean energy intake is shown as kJ/(rat·d). A subset of these rats was used to examine mRNA and NPY levels.
Effect of litter size on blood pressure. To determine the effect of early dietary intervention on blood pressure, tail-cuff measurements were taken at 7, 10, and 13 wk of age in conscious rats. Rats were prewarmed at 37°C for 8–10 min to facilitate tail blood flow before blood pressure was measured. The mean of 5 readings of systolic blood pressure was used for each rat.
Longitudinal characterization of plasma biochemistry. At both end points (24 d and 16 wk of age), rats were deeply anesthetized (pentobarbitone sodium; 100 mg/kg, intraperitoneal) and blood was collected via cardiac puncture. To characterize the progressive effect of litter size adjustment, at 8 wk of age, blood was obtained from the tail vein of previously warmed rats. The blood was collected using heparin as an anticoagulant, centrifuged (6000 x g; 25°C, 10 min), and the separated plasma was stored at –20°C for subsequent determination of plasma leptin, insulin, and corticosterone.
Tissue collection at 24 d and 16 wk of age. Following cardiac puncture, rats were decapitated to allow the rapid removal of the brain. Three coronal sections were made on ice starting at the rostral border of the hypothalamus and were then dissected into areas containing the PVN, anterior (AH) and posterior (PH) hypothalamus, ARC, and preoptic area (PO), as previously described (21). Brain regions were weighed and stored at –80°C for subsequent determination of NPY content. Left retroperitoneal WAT (RpWAT), gonadal WAT, mesenteric WAT, interscapular BAT (iBAT; with WAT layer removed), heart, liver, and kidney were removed and weighed. Animals were randomized and killed between 0900 and 1300 to control for the nutritional state of the rats.
Northern blot analysis. RpWAT and iBAT were snap-frozen and kept for subsequent preparation of mRNA. Northern blot analysis was used to measure leptin in RpWAT and iBAT and UCP-1 (probes: forward, CGCTACACGGGGACCTACAATG; reverse, ACCCGAGTCGCAGAAAAGAAGC) in iBAT. The 441-nucleotide mouse leptin cDNA probe used, which corresponded to nucleotides 64–504 (ATG start codon designated +1) of the published mouse leptin cDNA and contained almost the entire coding sequence. Both leptin and UCP-1 were standardized against the housekeeping gene, 18S. Total RNA was extracted from RpWAT and iBAT by homogenization in TRIzol reagent (Life Technologies). Homogenates were extracted with chloroform and total RNA was precipitated with isopropanol. For northern blot analysis, total RNA (3–5 µg) was separated in 1% agarose gel containing formaldehyde and transferred to GeneScreen Plus membranes (NEN Life Science Products) by capillary blotting. The filters were then prehybridized for 1 h in ULTRAhyb buffer (Ambion, RNA Company) at 68°C before the addition of various antisense 32P-UTP labeled RNA probes and left to hybridize overnight at 68°C. The filters were then washed as previously described (22). All filters were rehybridized with a riboprobe to a cDNA for mouse 18S to control for loading of the RNA. All washed filters were exposed for 1–3 h on a phosphorimager screen (Fuji Photo Film) and scanned for analysis of mRNA levels (Typhoon 8600 Scanner, Molecular Dynamics).
Cardiac fibrosis. Hearts were collected and the left ventricle was separated and fixed in 4% paraformaldehyde. Histological analysis was then used to determine development of cardiac fibrosis by staining of paraffin sections for total collagen with picrosirius red. This was quantified using computerized image analysis (AIS Imaging), which was manually set to a detection level threshold for positive stained areas. Ten fields were randomly chosen from each section of left ventricle, analyzed, and the mean intensity was then calculated. The percentage area was determined by calculating the positive stained area as a percentage of the total area of the image.
Measurement of plasma hormones and hypothalamic NPY. Commercially available radioimmunoassay (RIA) kits were used to measure plasma leptin and insulin (rat leptin RIA, catalog no. RL-83K, and insulin RIA, catalog no. RI-13K Linco) and plasma corticosterone (rat and mouse, catalog no. 07.120102 ICN Biomedicals).
NPY was extracted from PVN, ARC, AH, PH, and PO regions using an extraction method previously described (4). NPY-like immunoreactivity was measured using synthetic NPY as a standard (10–1280 pg/tube, Auspep) and Bolton Hunter labeled 125I-NPY (2000 Ci/mmol, Amersham Pharmacia Biotech UK) (23).
Statistical analysis. Results are expressed as means ± SEM. Body weight and blood pressure were analyzed using 2-way ANOVA with repeated measures followed by a post hoc Bonferroni test (GraphPad Prism 4.0 Intuitive Software for Science). Organ weights, fat mass, plasma leptin, insulin and corticosterone, cardiac collagen, and brain NPY concentrations were analyzed with 1-way ANOVA followed by a post hoc Bonferroni test. When analyzing food intake, n was equivalent to the number of cages for each treatment and equal food intake by all rats in the cage was assumed. Significant differences were defined as P < 0.05.
| Results |
|---|
|
|
|---|
Study 1: Short-term effect (24 d of age). At 24 d of age, SL pups were 10% heavier than the NL pups (P < 0.05; Fig. 1A), whereas LL pups were 17% lighter (P < 0.05). Furthermore, overfeeding during the first 3 wk of life led to increased weight of liver, kidney, and fat depots (Table 1), which were reduced in LL pups compared with NL. The changes in fat mass remained significant even when expressed as percent body weight (data not shown).
|
|
Effect of litter size on adipose markers. Leptin mRNA levels in RpWAT and iBAT did not differ between litter groups at either 24 d or 16 wk (data not shown). At 24 d of age, UCP-1 mRNA in iBAT of SL pups (2.26 ± 0.49 UCP-1/18S mRNA) was greater than in NL pups (1.16 ± 0.11 UCP-1/18S mRNA) (P < 0.05) but was not affected in the LL group (1.08 ± 0.10 UCP-1/18S mRNA). In adulthood (16 wk), SL rats tended to have a lower expression of UCP-1 (0.98 ± 0.11 UCP-1/18S mRNA) in iBAT than NL rats (2.66 ± 0.61 UCP-1/18S mRNA) (P = 0.14). Small amounts of iBAT can be found in adult rats. UCP-1 was not measured in RpWAT.
Effect of litter size on plasma biochemistry. At 24 d of age (3.5 wk), SL pups had a significantly higher plasma leptin concentration than NL pups, which remained elevated throughout the study, but no change in plasma insulin concentration (Fig. 2A and B, respectively). Circulating leptin levels of LL rats were significantly lower than in NL rats at only 8 wk of age (P < 0.05; Fig. 2A). The plasma corticosterone concentration was elevated in SL rats compared with NL rats at 24 d of age (P < 0.001; Fig. 2C); however, the groups did not differ at 16 wk.
|
Adjustment of litter size resulted in significant changes in heart size. Overfed rats raised in SL had heavier hearts compared with NL rats, whereas hearts were lighter in underfed rats from LL (P < 0.01; Table 1) at 24 d of age. The cardiac effects of underfeeding were still apparent in adulthood, whereas heart mass in the SL rats did not differ from that of NL rats. Collagen deposition was used to assess cardiac fibrosis in the left ventricle and although the groups did not differ at 24 d of age, SL rats had a significant elevation of total collagen in adulthood (16 wk) relative to NL rats, indicating fibrotic change (Table 1).
Effect of litter size on hypothalamic NPY. The NPY concentrations in the subregions of the hypothalamus did not differ among the groups at 24 d of age (Table 2) nor did the total hypothalamic content (LL, 123.6 ± 5.6; NL, 123.7 ± 3.7; SL, 130.3 ± 3.4 ng). At 16 wk, the NPY concentration in the ARC region of rats raised in LL tended to be greater than in those raised in NL (P = 0.06; Table 2), as is observed in situations of energy deprivation (7). The total hypothalamic NPY content did not differ among the 3 groups at 16 wk of age (LL, 268.4 ± 9.4; NL, 260.7 ± 12.8; SL, 243.0 ± 10.1 ng; P = 0.24). At 16 wk, an age effect was evident with increased total hypothalamic NPY content at 16 wk of age compared with 24 d of age in all the groups (P < 0.001).
|
| Discussion |
|---|
|
|
|---|
In this study, the difference in body weight observed between litter sizes is reflected in significant differences in fat mass. We investigated the expression of UCP-1 in BAT, which is important in thermoregulation and modulation of metabolic rate (25). UCP-1 expression increased only at 24 d of age, suggesting an attempt to increase energy expenditure to balance the excess energy intake (5). This is in line with reports that total energy expenditure is increased only in postnatally overfed rats at 5 wk but not in adult rats (26). More recent data have further demonstrated that postnatal overnutrition is associated with reduced BAT thermogenesis through decreased UCP-1 expression and impairment of sympathetic activity in BAT, suggesting that this may play a key role in the development of obesity (27).
Overfeeding induced by reduced litter size led to elevated circulating leptin at an early age, which remained high in adulthood, as shown previously (4,24), independent of body weight. Conversely, circulating leptin levels were conserved in underfed rats despite their reduced adipose mass. Previous studies have shown that leptin deficiency can cause profound and permanent disruptions in the development of projections from the ARC to the PVN, positioning leptin as an essential factor in forming the pathways that regulate energy balance (6). This may suggest that a certain leptin level needs to be maintained even during a state of underfeeding and previous studies have demonstrated that leptin levels are protected even in the state of acute deprivation (28).
High levels of a satiety hormone during a period of growth and development may seem counterintuitive; however, it is thought that leptin does not regulate food intake during early development, despite having the ability to regulate orexigenic and anorexigenic neuropeptides, including NPY (29). In the adult, leptin regulates feeding by direct inhibition of NPY neurons in the ARC (7); the critical projections between the ARC and PVN that regulate feeding do not fully develop in the rodent until postnatal wk 2 to 3 (30). In this study, NPY content in the hypothalamus did not change as a result of litter size adjustment, despite significantly increased leptin at 24 d in overfed pups raised in SL. Previous studies, however, have shown increased NPY content at 21 d of age in pups raised in LL but no change in SL rats (3). A more recent study also demonstrated an increase in NPY expression in the ARC in pups from both SL and LL (24), which seems difficult to reconcile. This discrepancy with previous data may be related to the different genetic background of the rats used in one of the studies [Wistar vs. Sprague Dawley (3)] or the difference in the number of pups per litter [SL, 5 vs. 3, and LL, 25 vs. 18 (24)]. The difficulty of the dissection of different subregions in the hypothalamus may also contribute to the conflicting results. NPY levels remained unchanged in adulthood, although there does appear to be some effect on NPY in regions such as the ARC, with higher levels in rats raised in LL and lower levels in the heavier rats, in line with previous work from our group (9).
The NPY system can also be regulated by the glucocorticoid, corticosterone, which has been shown to have a stimulatory effect on NPY expression and production in adult rats (31). The response of hypothalamic NPY and circulating corticosterone in low weight weanling rats suggests that these mediators function predominantly to promote weight gain (32). In this study, we also observed a slight increase in circulating corticosterone levels in young LL rats. Our findings also show an elevation of corticosterone levels of overfed pups, supported by previously published data (14).
Previous studies have shown that early postnatal nutritional modification induced by changes in litter size was able to modify cardiac protein composition and contractile performance (33). Although the same study reported increased concentration of collagenous protein in the ventricles of rats raised in SL, histological analysis yielded no litter size-related changes in total collagen, a marker of cardiac fibrosis, in our rats at 24 d of age. Again, the discrepancy may be due to different rat strains, the time point, or the analysis used. It may be possible that the intervention is too short and mild to cause cardiac fibrosis in weanling pups. Conditions that slow or accelerate heart growth during the early postnatal period could alter cellular composition, heart mass, and possibly heart function. Nutritional state during the postnatal period can affect cardiomyocyte proliferation and myocardial protein (34,35). A novel observation in this study was the increased total collagen in the left ventricle in adult rats that had been overfed only in the early postnatal period, indicative of cardiac fibrosis, independent of blood pressure. Our data are consistent with recent human evidence that relative "overnutrition" in infancy has adverse effects on long-term cardiovascular disease risk (36).
Basic developmental research allows the investigation of the underlying mechanisms of cardiovascular, endocrine, and metabolic abnormalities induced by altered nutrition in early development. The present study of early nutritional intervention has shown marked effects at weaning on body weight, adiposity, UCP-1, and leptin. Overnourished rats raised in SL continued to overeat after weaning, suggesting the level of nutrition in early postnatal life may affect long-term appetite regulation. It is noteworthy that several key systems involved in the regulation of feeding are immature at birth and develop during the postnatal period, at least in the rodent. Some early changes persisted in the long term, with undernourished rats remaining lighter as adults. In the overnourished group, the increase in adult body weight was modest (5% over control) and further work is required to confirm this finding. In humans, modest increases in BMI within the normal range are associated with increased risk of hypertension and other cardiovascular complications (37). This study complements epidemiological investigations by highlighting the importance of optimal nutrition early in life for long-term health outcomes.
| FOOTNOTES |
|---|
2 Author disclosures: E. Velkoska, T. J. Cole, R. G. Dean, L. M. Burrell, and M. J. Morris, no conflicts of interest. ![]()
7 Abbreviations used: AH, anterior hypothalamus; ARC, arcuate nucleus; BAT, brown adipose tissue; iBAT, interscapular brown adipose tissue; LL, large litter; NL, normal litter; NPY, neuropeptide Y; PH, posterior hypothalamus; PO, preoptic; PVN, paraventricular nucleus; RIA, radioimmunoassay; RpWAT, retroperitoneal white adipose tissue; SL, small litter; UCP-1, uncoupling protein 1; WAT, white adipose tissue. ![]()
Manuscript received 25 January 2008. Initial review completed 27 February 2008. Revision accepted 13 June 2008.
| LITERATURE CITED |
|---|
|
|
|---|
1. McMillen IC, Adam CL, Muhlhausler BS. Early origins of obesity: programming the appetite regulatory system. J Physiol. 2005;565:9–17.
2. McCance RA. Food, growth and time. Lancet. 1962;280:621–6.
3. Plagemann A, Harder T, Rake A, Waas T, Melchior K, Ziska T, Rohde W, Dorner G. Observations on the orexigenic hypothalamic neuropeptide Y-system in neonatally overfed weanling rats. J Neuroendocrinol. 1999;11:541–6.[CrossRef][Medline]
4. Velkoska E, Cole TJ, Morris MJ. Early dietary intervention: long-term effects on blood pressure, brain neuropeptide Y, and adiposity markers. Am J Physiol Endocrinol Metab. 2005;288:E1236–43.
5. Grove KL, Smith MS. Ontogeny of the hypothalamic neuropeptide Y system. Physiol Behav. 2003;79:47–63.[CrossRef][Medline]
6. Bouret SG, Draper SJ, Simerly RB. Trophic action of leptin on hypothalamic neurons that regulate feeding. Science. 2004;304:108–10.
7. Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature. 2000;404:661–71.[Medline]
8. Clark JT, Kalra PS, Crowley WR, Kalra SP. Neuropeptide Y and human pancreatic polypeptide stimulate feeding behavior in rats. Endocrinology. 1984;115:427–9.
9. Hansen MJ, Jovanovska V, Morris MJ. Adaptive responses in hypothalamic neuropeptide Y in the face of prolonged high-fat feeding in the rat. J Neurochem. 2004;88:909–16.[Medline]
10. Billington CJ, Briggs JE, Grace M, Levine AS. Effects of intracerebroventricular injection of neuropeptide Y on energy metabolism. Am J Physiol Regul Integr Comp Physiol. 1991;260:R321–7.
11. Egawa M, Yoshimatsu H, Bray GA. Neuropeptide Y suppresses sympathetic activity to interscapular brown adipose tissue in rats. Am J Physiol. 1991;260:R328–34.[Medline]
12. Baskin DG, Figlewicz Lattemann D, Seeley RJ, Woods SC, Porte D Jr, Schwartz MW. Insulin and leptin: dual adiposity signals to the brain for the regulation of food intake and body weight. Brain Res. 1999;848:114–23.[CrossRef][Medline]
13. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM. Weight-reducing effects of the plasma protein encoded by the obese gene. Science. 1995;269:543–6.
14. Boullu-Ciocca S, Dutour A, Guillaume V, Achard V, Oliver C, Grino M. Postnatal diet-induced obesity in rats upregulates systemic and adipose tissue glucocorticoid metabolism during development and in adulthood: its relationship with the metabolic syndrome. Diabetes. 2005;54:197–203.
15. Arvaniti K, Ricquier D, Champigny O, Richard D. Leptin and corticosterone have opposite effects on food intake and the expression of UCP1 mRNA in brown adipose tissue of lepob/lepob mice. Endocrinology. 1998;139:4000–3.
16. Alpert MA. Obesity cardiomyopathy: pathophysiology and evolution of the clinical syndrome. Am J Med Sci. 2001;321:225–36.[CrossRef][Medline]
17. Sorof J, Daniels S. Obesity hypertension in children: a problem of epidemic proportions. Hypertension. 2002;40:441–7.
18. Lever AF, Harrap SB. Essential hypertension: a disorder of growth with origins in childhood? J Hypertens. 1992;10:101–20.[Medline]
19. Baker JL, Olsen LW, Sorensen TI. Childhood body-mass index and the risk of coronary heart disease in adulthood. N Engl J Med. 2007;357:2329–37.
20. Kawamura M, Itoh H, Yura S, Mogami H, Suga S, Makino H, Miyamoto Y, Yoshimasa Y, Sagawa N, et al. Undernutrition in utero augments systolic blood pressure and cardiac remodeling in adult mouse offspring: possible involvement of local cardiac angiotensin system in developmental origins of cardiovascular disease. Endocrinology. 2007;148:1218–25.
21. Hansen MJ, Ball MJ, Morris MJ. Enhanced inhibitory feeding response to alpha-melanocyte stimulating hormone in the diet-induced obese rat. Brain Res. 2001;892:130–7.[CrossRef][Medline]
22. Cole TJ, Harris HJ, Hoong I, Solomon N, Smith R, Krozowski Z, Fullerton MJ. The glucocorticoid receptor is essential for maintaining basal and dexamethasone-induced repression of the murine corticosteroid-binding globulin gene. Mol Cell Endocrinol. 1999;154:29–36.[CrossRef][Medline]
23. Morris MJ, Russell AE, Kapoor V, Cain MD, Elliott JM, West MJ, Wing LM, Chalmers JP. Increases in plasma neuropeptide Y concentrations during sympathetic activation in man. J Auton Nerv Syst. 1986;17:143–9.[Medline]
24. Lopez M, Seoane LM, Tovar S, Garcia MC, Nogueiras R, Dieguez C, Senaris RM. A possible role of neuropeptide Y, agouti-related protein and leptin receptor isoforms in hypothalamic programming by perinatal feeding in the rat. Diabetologia. 2005;48:140–8.[CrossRef][Medline]
25. Boss O, Muzzin P, Giacobino J. The uncoupling proteins, a review. Eur J Endocrinol. 1998;139:1–9.[CrossRef][Medline]
26. Wiedmer P, Klaus S, Ortmann S. Energy metabolism of young rats after early postnatal overnutrition. Br J Nutr. 2002;88:301–6.[CrossRef][Medline]
27. Xiao XQ, Williams SM, Grayson BE, Glavas MM, Cowley MA, Smith MS, Grove KL. Excess weight gain during the early postnatal period is associated with permanent reprogramming of brown adipose tissue adaptive thermogenesis. Endocrinology. 2007;148:4150–9.
28. Ahima RS, Prabakaran D, Flier JS. Postnatal leptin surge and regulation of circadian rhythm of leptin by feeding. Implications for energy homeostasis and neuroendocrine function. J Clin Invest. 1998;101:1020–7.[Medline]
29. Proulx K, Richard D, Walker CD. Leptin regulates appetite-related neuropeptides in the hypothalamus of developing rats without affecting food intake. Endocrinology. 2002;143:4683–92.
30. Grove KL, Allen S, Grayson BE, Smith MS. Postnatal development of the hypothalamic neuropeptide Y system. Neuroscience. 2003;116:393–406.[CrossRef][Medline]
31. Akabayashi A, Watanabe Y, Wahlestedt C, McEwen BS, Paez X, Leibowitz SF. Hypothalamic neuropeptide Y, its gene expression and receptor activity: relation to circulating corticosterone in adrenalectomized rats. Brain Res. 1994;665:201–12.[CrossRef][Medline]
32. Leibowitz SF, Sepiashvili K, Akabayashi A, Karatayev O, Davydova Z, Alexander JT, Wang J, Chang GQ. Function of neuropeptide Y and agouti-related protein at weaning: relation to corticosterone, dietary carbohydrate and body weight. Brain Res. 2005;1036:180–91.[CrossRef][Medline]
33. Pelouch V, Kolar F, Milerova M, Ostadal B. Effect of the preweaning nutritional state on the cardiac protein profile and functional performance of the rat heart. Mol Cell Biochem. 1997;177:221–8.[CrossRef][Medline]
34. Rakusan K, Raman S, Layberry R, Korecky B. The influence of aging and growth on the postnatal development of cardiac muscle in rats. Circ Res. 1978;42:212–8.
35. Dowell RT. Nutritional modification of rat heart postnatal development. Am J Physiol Heart Circ Physiol. 1984;246:H332–8.
36. Singhal A, Cole TJ, Fewtrell M, Kennedy K, Stephenson T, Elias-Jones A, Lucas A. Promotion of faster weight gain in infants born small for gestational age: is there an adverse effect on later blood pressure? Circulation. 2007;115:213–20.
37. Zhu H, Yan W, Ge D, Treiber FA, Harshfield GA, Kapuku G, Snieder H, Dong Y. Relationships of cardiovascular phenotypes with healthy weight, at risk of overweight, and overweight in US youths. Pediatrics. 2008;121:115–22.
This article has been cited by other articles:
![]() |
L. Sun, A. A. Sadighi Akha, R. A. Miller, and J. M. Harper Life-Span Extension in Mice by Preweaning Food Restriction and by Methionine Restriction in Middle Age J Gerontol A Biol Sci Med Sci, July 1, 2009; 64A(7): 711 - 722. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||