![]() |
|
|
3 Department of Food Science and Human Nutrition, Iowa State University, Ames, IA 50011 and 4 Department of Biological Sciences, University of Notre Dame, Notre Dame, IN 46556
* To whom correspondence should be addressed. E-mail; mrowling{at}iastate.edu.
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although it has been shown that a number of extra renal tissues express megalin, cubilin, and/or Dab2 (9–15), little is known about uptake of vitamin complexes in these tissues or whether their uptake requires megalin, cubilin, and/or Dab2-mediated endocytosis. However, recent studies have shown that this megalin-mediated endocytosis occurs in numerous absorptive epithelial cell types, such as thyroid and reproductive tract, and megalin is expressed in both breast and prostate, tissues that have functional CYP27B1 (16,17) and sensitivity to 1,25D3 (18–22). Moreover, evidence suggests that differentiation plays a role in the expression and endocytic function of megalin, cubilin, and Dab2. In support of this concept, when F9 mouse embryocarcinoma cells are differentiated by all-trans-retinoic acid (RA), megalin and Dab2 expression are markedly elevated (23,24).
Despite identification of a functional CYP27B1 in a number of extra-renal sites, the mechanism by which 25D3 trafficking occurs and the regulation of these processes remain unclear in these tissues. We recently reported that mammary epithelial cells readily internalized DBP via receptor-mediated endocytosis and that this process was inhibited by a known inhibitor of megalin- and cubilin-mediated endocytosis (25). Thus, the presence of megalin, cubilin, and Dab2 may identify tissues that have the ability to transport 25D3 and locally produce antitumorigenic 1,25D3. In the present study, our first objectives were to assess megalin, cubilin, and Dab2 expression in mammary epithelial cells and determine whether levels of expression could be modulated by compounds known to induce these proteins in other cell types. Furthermore, we tested our hypothesis that stimulation of megalin, cubilin, and/or Dab2 expression in breast cancer cells would be associated with enhanced uptake of DBP.
| Materials and Methods |
|---|
|
|
|---|
Assessment of differentiation. To assess the ability of known differentiating agents to induce differentiation of T-47D cells, 5 x 103 cells were plated in 6-well plates, then treated with various combinations of 1 µmol/L RA, 100 nmol/L 1,25D3, and 10 µmol/L forskolin for 7 d. Lipid accumulation (i.e. terminal differentiation) was assessed as described by Ramirez-Zacarías et al. (26). Accumulation of lipid droplets was quantitated by measuring the absorbance of solubilized Oil Red O at 510 nm following the addition of 1 mL isopropyl alcohol.
Real-time PCR. T-47D cells (2 x 105) were plated in 6-well plates and treated with various combinations of RA (0–100 µmol/L), 100 nmol/L 1,25 D3, and forskolin (0–100 µmol/L) for 2–7 d. mRNA from cells was then either immediately isolated using a commercial kit (RNeasy Mini kit, Qiagen) or cells were incubated an additional 48 h in control media prior to mRNA isolation. Total mRNA was then used for first-strand cDNA synthesis using TaqMan Reverse Transcription Reagents (N808–0234, Applied Biosystems). For each sample, reactions were performed in triplicate, generating 3 2.0-µg cDNA stocks/sample. For T-47D cells, each of the cDNA stocks were independently analyzed in duplicate (200 ng per well) for megalin, cubilin, and Dab2 mRNA expression via real-time PCR using SYBR Green Detection reagents (4309155, Applied Biosystems) with primer sets specific for human megalin (forward primer, AAATTGAGCACAGCACCTTTGA, reverse primer, TCTGCTTTCCTGACTCGAATAATG), human cubilin (forward primer, GGTTCCCTGCCAATTATCCAA, reverse primer, CCGCCATCCAAAATTTCTACA) or human Dab2 (forward primer, GGTGTAACTGTCACACTCCCTCAG, reverse primer, TGACCACCCATCATGGCTC) and were normalized against glyceraldehyde 3-phosphate dehydrogenase mRNA (forward primer, CCACCCATGGCAAATTCC, reverse primer, TGATGGGATTTCCATTGATGAC).
Western blotting. T-47D cells were plated in 100-mm dishes (5.0 x 105 cells/dish) and treated with various combinations of 1,25D3 (100 nmol/L), RA (0–100 µmol/L), and forskolin (0–100 µmol/L). After 2 d, cell monolayers were scraped into 200 µL 2x Laemmli buffer containing protease inhibitors (10 mmol/L benzamidine, 10 mmol/L sodium fluoride, 100 mmol/L sodium vanadate, 25 µg/µL aprotinin, 25 µg/µL pepstatin, 25 µg/µL leupeptin, and 1 mmol/L phenylmethylsulfonyl fluoride). Total protein was analyzed by the Micro BCA assay (Bio-Rad). For analysis of megalin and cubilin protein abundance, 60 µg protein was separated by SDS-PAGE under nonreducing conditions using 6% polyacrylamide gels. For analysis of Dab2 protein abundance, 60 µg protein was separated by SDS-PAGE under reducing conditions using 7.5% polyacrylamide gels. Proteins were transferred to nitrocellulose and Ponceau stained to confirm equal loading. Membranes were blocked at room temperature (RT) for 1 h in 5% skim milk in PBS/1% Tween 20. For detection of megalin, the membrane was incubated for 2 h at RT with a 1:500 dilution of polyclonal rabbit anti-megalin antibody (kindly provided by Scott Argraves, University of South Carolina, Columbia, SC) in 5% bovine serum albumin followed by 1 h incubation with goat anti-rabbit IgG horseradish peroxidase (1:5000). For detection of cubilin, membranes were incubated for 3 h at RT with a 1:100 dilution of a polyclonal goat anti-cubilin antibody (Santa Cruz Biotechnology). Donkey anti-goat IgG horseradish peroxidase-conjugated secondary antibody (1:10,000) was applied for 1 h at RT. For detection of Dab2, membranes were incubated with a 1:500 dilution of a monoclonal mouse anti-Dab2 antibody (BD Biosciences Pharmingen) for 3 h at RT, followed by a 1-h incubation with a sheep anti-mouse IgG horseradish peroxidase-conjugated secondary antibody (1:7500). For all proteins, specific binding was detected by chemiluminescence and exposure to autoradiography film (Kodak Biomax).
Fluorescein conjugation and endocytosis of DBP. DBP (Calbiochem) was conjugated to Alexa-488 using a commercial kit (A10235, Molecular Probes). For DBP uptake studies, subconfluent T-47D and F9 cells were grown in 0.1 µmol/L RA for 7 d, then plated on 4-well Lab-Tek II CC2 chamber slides (Nalge Nunc International) for 48 h in RA-free media. Cells were then switched to serum-free media for 1 h, then incubated with 0.02 g/L Alexa-DBP at 37°C (the optimal temperature for endocytosis) for 30 min. Cells were rapidly fixed in ice-cold methanol, incubated with Hoechst (1 mg/L) in PBS for visualization of nuclei, and were then mounted in anti-fade on cover slips. Because we have observed uptake of Alexa-DBP by T-47D cells under control conditions (25), we viewed untreated and RA-treated T-47D cells 72 h after mounting to allow for fading of Alexa-DBP and a more accurate comparison of uptake efficiency. Because untreated F9 cells internalize virtually no appreciable DBP (M. J. Rowling and J. Welsh, unpublished data), F9 cells were viewed 2 h following mounting. Cells were viewed on an Olympus AX70 microscope equipped with a Spot RT digital camera. Fluorescent and UV images were acquired with a constant exposure time.
Statistical analysis. Data were analyzed by 1- or 2-way ANOVA as appropriate using InStat software (version 3.0 for Windows, GraphPad Software) or XLSTAT (Addinsoft). Differences between means were considered significant at P <0.05. We used Dunnett's post-test to identify which means were significantly different from control values after ANOVA.
| Results |
|---|
|
|
|---|
2-fold in T-47D cells. In contrast, 1,25D3 and forskolin did not affect lipid accumulation, but these observations do not preclude effects of 1,25D3 and forskolin on markers of earlier stages of differentiation (Fig. 1).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Despite the recognition that 25D3 is delivered to sites of metabolism and storage in complex with DBP, the mechanisms for cellular uptake of 25D3–DBP have not been clearly defined in tissues other than the kidney. Previously, we demonstrated that coexpression of megalin and cubilin in mammary cells correlated with the rapid internalization of DBP via receptor-mediated endocytosis (25). Furthermore, we found that receptor-associated protein, a known inhibitor of megalin-mediated endocytosis (30), drastically reduced the ability of T-47D cells to internalize DBP. In the present study, we extended our previous work by demonstrating that treatment of T-47D cells with RA, a compound that induces terminal differentiation of T-47D cells, markedly increased expression of megalin, cubilin, and/or Dab2 and enhanced DBP uptake. These findings are consistent with our previous assessment of megalin and cubilin expression in murine mammary gland and human mammary cell lines (25) and a marked increase in mammary-specific megalin and Dab2 expression we have found in pregnant, lactating, and estrogen-/progesterone-supplemented mice (M.J. Rowling and J. Welsh, unpublished data). Moreover, these data are supported by reports of modulated megalin, cubilin, and Dab2 expression in epithelial cells from nonmammary sources (31–33). Characterizing the mechanisms of vitamin D transport in the mammary gland may therefore not only provide important information relevant to breast cancer but may identify possible targets for the prevention of other types of cancer. Additionally, future assessment of the effects of tumorigenesis on megalin, cubilin, and Dab2 expression may dramatically affect nutritional strategies for the prevention/treatment of cancer. For example, if in future studies researchers discover that mechanisms for vitamin uptake are deregulated as cells lose their differentiated phenotype, then attention to optimal supplies of vitamin D would be most critical in preventing cancer development. Conversely, if mechanisms of vitamin D transport remain functional even in transformed cells, then optimal nutritional status of vitamin D may prove important in both prevention and treatment strategies.
Although administration of 1,25D3 has been proven to be effective at inhibiting tumorigenesis, 1,25D3 produces a toxic calcemic response when administered at pharmacological doses (34). In addition, strict regulation of renal 1,25D3 synthesis ensures that under physiological conditions, serum 1,25D3 concentrations will not reach levels that can inhibit tumor growth regardless of the amount of vitamin D acquired from the diet (35). Therefore, evaluating the ability of mammary cells to locally produce 1,25D3 may be more predictive of breast cancer risk and may lead to a more feasible strategy for the use of dietary vitamin D in the context of cancer prevention. In support of this concept, epidemiological studies report that both sunlight exposure and dietary vitamin D are inversely correlated with breast cancer risk or disease progression (36–40). Rats fed diets low in vitamin D develop significantly more mammary tumors when treated with chemical carcinogens than rats with adequate vitamin D status (41). Furthermore, women with suboptimal vitamin D status exhibited increased mammographic breast density (42). Taken together, this evidence suggests that determination of uptake mechanisms and tissue stores of vitamin D in the mammary gland is a critical step toward understanding the role of dietary or sunlight-derived vitamin D in breast cancer prevention.
| FOOTNOTES |
|---|
2 Author disclosures: T. M. Chlon, D. A. Taffany, J. Welsh, and M. J. Rowling, no conflicts of interest. ![]()
5 Contributed equally to this work. ![]()
6 Abbreviations used: CYP, cytochrome p450; Dab2, disabled-2; DBP, vitamin D-binding protein; 1,25D3, 1,25-dihydroxycholecalciferol; DMSO, dimethylsulfoxide; 25D3, 25-hydroxycholecalciferol; RA, all-trans-retinoic acid; RT, room temperature. ![]()
Manuscript received 23 January 2008. Initial review completed 13 March 2008. Revision accepted 30 April 2008.
| LITERATURE CITED |
|---|
|
|
|---|
1. Colston KW, Hansen CM. Mechanisms implicated in the growth regulatory effects of vitamin D in breast cancer. Endocr Relat Cancer. 2002;9:45–59.[Abstract]
2. Colston KW, Welsh JE. Vitamin D and breast cancer. 2nd ed. Oxford: Elsevier Press; 2005.
3. Deeb KK, Trump DL, Johnson CS. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat Rev Cancer. 2007;7:684–700.[Medline]
4. Nykjaer A, Dragun D, Walther D, Vorum H, Jacobsen C, Herz J, Melsen F, Christensen E, Willnow T. An endocytic pathway essential for renal uptake and activation of the steroid 25(OH)hydroxyvitamin D3. Cell. 1999;96:507–15.[Medline]
5. Nykjaer A, Fyfe J, Kozyraki R, Leheste J-R, Jacobsen C, Nielsen MS, Verroust PJ, Aminoff M, de la Chapelle A, et al. Cubilin dysfunction causes abnormal metabolism of the steroid hormone 25(OH) vitamin D3. Proc Natl Acad Sci USA. 2001;98:13895–900.
6. Gallagher H, Oleinikov AV, Fenske C, Newman DJ. The adaptor disabled-2 binds to the third psi xNPxY sequence on the cytoplasmic tail of megalin. Biochimie. 2004;86:179–82.[Medline]
7. Oleinikov AV, Zhao J, Makker SP. Cytosolic adaptor protein Dab2 is an intracellular ligand of endocytic receptor gp600/megalin. Biochem J. 2000;347:613–21.[Medline]
8. Morris SM, Tallquist MD, Rock CO, Cooper JA. Dual roles for the Dab2 adaptor protein in embryonic development and kidney transport. EMBO J. 2002;21:1555–64.[Medline]
9. Maurer ME, Cooper JA. Endocytosis of megalin by visceral endoderm cells requires the Dab2 adaptor protein. J Cell Sci. 2005;118:5345–55.
10. Marino M, Zheng G, McCluskey RT. Megalin (gp330) is an endocytic receptor for thyroglobulin on cultured fisher rat thyroid cells. J Biol Chem. 1999;274:12898–904.
11. Schwahn DJ, Medina D. p96, a MAPK-related protein, is consistently downregulated during mouse mammary carcinogenesis. Oncogene. 1998;17:1173–8.[Medline]
12. Van Praet O, Argraves WS, Morales CR. Co-expression and interaction of cubilin and megalin in the adult male rat reproductive system. Mol Reprod Dev. 2003;64:129–35.[Medline]
13. Argraves WS, Morales CR. Immunolocalization of cubilin, megalin, apolipoprotein J, and apolipoprotein A-I in the uterus and oviduct. Mol Reprod Dev. 2004;69:419–27.[Medline]
14. Lundgren S, Carling T, Hjalm G, Juhlin C, Rastad J, Pihlgren U, Rask L, Akerstrom G, Hellman P. Tissue distribution of human gp330/megalin, a putative calcium sensing protein. J Histochem Cytochem. 1997;45:383–92.
15. Barth JL, Argraves WS. Cubilin and megalin: partners in lipoprotein and vitamin metabolism. Trends Cardiovasc Med. 2001;11:26–31.[Medline]
16. Kemmis CM, Salvador SM, Smith KM, Welsh J. Human mammary epithelial cells express CYP27B1 and are growth inhibited by 25-hydroxyvitamin D-3, the major circulating form of vitamin D-3. J Nutr. 2006;136:887–92.
17. Hsu JY, Feldman D, McNeal JE, Peehl DM. Reduced 1alpha-hydroxylase activity in human prostate cancer cells correlates with decreased susceptibility to 25-hydroxyvitamin D3-induced growth inhibition. Cancer Res. 2001;61:2852–6.
18. Welsh J. Induction of apoptosis in breast cancer cells in response to vitamin D and antiestrogens. Biochem Cell Biol. 1994;72:537–45.[Medline]
19. Welsh J, Simboli-Campbell M, Narvaez CJ, Tenniswood M. Role of apoptosis in the growth inhibitory effects of vitamin D in MCF-7 cells. Adv Exp Med Biol. 1995;375:45–52.[Medline]
20. Rashid SF, Moore JS, Walker E, Driver PM, Engel J, Edwards CE, Brown G, Uskokovic MR, Campbell MJ. Synergistic growth inhibition of prostate cancer cells by 1 alpha,25 dihydroxyvitamin D(3) and its 19-nor-hexafluoride analogs in combination with either sodium butyrate or trichostatin A. Oncogene. 2001;20:1860–72.[Medline]
21. Sung V, Feldman D. 1,25-Dihydroxyvitamin D3 decreases human prostate cancer cell adhesion and migration. Mol Cell Endocrinol. 2000;164:133–43.[Medline]
22. Zhao XY, Peehl DM, Navone NM, Feldman D. 1alpha,25-Dihydroxyvitamin D3 inhibits prostate cancer cell growth by androgen-dependent and androgen-independent mechanisms. Endocrinology. 2000;141:2548–56.
23. Czekay RP, Orlando RA, Woodward L, Adamson ED, Farquhar MG. The expression of megalin (gp330) and LRP diverges during F9 cell differentiation. J Cell Sci. 1995;108:1433–41.[Abstract]
24. Cho SY, Lee SH, Park SS. Differential expression of mouse Disabled 2 gene in retinoic acid-treated F9 embryonal carcinoma cells and early mouse embryos. Mol Cells. 1999;9:179–84.[Medline]
25. Rowling MJ, Kemmis CM, Taffany DA, Welsh J. Megalin-mediated endocytosis of vitamin D binding protein correlates with 25-hydroxycholecalciferol actions in human mammary cells. J Nutr. 2006;136:2754–9.
26. Ramirez-Zacarias JL, Castro-Munozledo F, Kuri-Harcuch W. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with Oil red O. Histochemistry. 1992;97:493–7.[Medline]
27. Holick MF. Vitamin D: its role in cancer prevention and treatment. Prog Biophys Mol Biol. 2006;92:49–59.[Medline]
28. Fu GK, Lin D, Zhang MY, Bikle DD, Shackleton CH, Miller WL, Portale AA. Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations causing vitamin D-dependent rickets type 1. Mol Endocrinol. 1997;11:1961–70.
29. Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM, Hewison M. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-hydroxylase. J Clin Endocrinol Metab. 2001;86:888–94.
30. Sousa MM, Saraiva MJ. Internalization of transthyretin. Evidence of a novel yet unidentified receptor-associated protein (RAP)-sensitive receptor. J Biol Chem. 2001;276:14420–5.
31. Liu W, Yu WR, Carling T, Juhlin C, Rastad J, Ridefelt P, Akerstrom G, Hellman P. Regulation of gp330/megalin expression by vitamins A and D. Eur J Clin Invest. 1998;28:100–7.[Medline]
32. Erranz B, Miquel JF, Argraves WS, Barth JL, Pimentel F, Marzolo MP. Megalin and cubilin expression in gallbladder epithelium and regulation by bile acids. J Lipid Res. 2004;45:2185–98.
33. Smith ER, Capo-chichi CD, He J, Smedberg JL, Yang DH, Prowse AH, Godwin AK, Hamilton TC, Xu XX. Disabled-2 mediates c-Fos suppression and the cell growth regulatory activity of retinoic acid in embryonic carcinoma cells. J Biol Chem. 2001;276:47303–10.
34. Gross C, Stamey T, Hancock S, Feldman D. Treatment of early recurrent prostate cancer with 1,25-dihydroxyvitamin D3 (calcitriol). J Urol. 1998;159:2035–9.[Medline]
35. Breslau NA. Normal and abnormal regulation of 1,25-(OH)2D synthesis. Am J Med Sci. 1988;296:417–25.[Medline]
36. Knekt P, Jarvinen R, Seppanen R, Pukkala E, Aromaa A. Intake of dairy products and risk of breast cancer. Br J Cancer. 1996;73:687–91.[Medline]
37. John EM, Schwartz GG, Dreon DM, Koo J. Vitamin D and breast cancer risk: the NHANES I epidemiologic follow up study, 1971–1975 to 1992. Cancer Epidemiol Biomark Prev. 1999;8:399–406.
38. Shin MH, Holmes MD, Hankinson SE, Wu K, Colditz GA, Willett WC. Intake of dairy products, calcium and vitamin D and risk of breast cancer. J Natl Cancer Inst. 2002;94:1301–10.
39. Grant WB. Ecologic studies of solar UV-B radiation and cancer mortality rates. Recent Results Cancer Res. 2003;164:371–7.[Medline]
40. Mawer EB, Walls J, Howell A, Davies M, Ratcliffe WA, Bundred NJ. Serum 1,25-dihydroxyvitamin D may be related inversely to disease activity in breast cancer patients with bone metastases. J Clin Endocrinol Metab. 1997;82:118–22.
41. Jacobson E, James K, Newmark HL, Carroll K. Effects of dietary fat, calcium, and vitamin D on growth and mammary tumorigenesis induced by 7,12-dimethylbenz(a)anthracene in female Sprague-Dawley rats. Cancer Res. 1989;49:6300–3.
42. Berube S, Diorio C, Verhoek-Oftedahl W, Brisson J. Vitamin D, calcium and mammographic breast densities. Cancer Epidemiol Biomark Prev. 2004;13:1466–72.
This article has been cited by other articles:
![]() |
M. T. Mizwicki and A. W. Norman The Vitamin D Sterol-Vitamin D Receptor Ensemble Model Offers Unique Insights into Both Genomic and Rapid-Response Signaling Sci. Signal., June 16, 2009; 2(75): re4 - re4. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||