Journal of Nutrition

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amasheh, M.
Right arrow Articles by Schulzke, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amasheh, M.
Right arrow Articles by Schulzke, J. D.
© 2008 American Society for Nutrition J. Nutr. 138:1067-1073, June 2008

Nutrition and Disease

Quercetin Enhances Epithelial Barrier Function and Increases Claudin-4 Expression in Caco-2 Cells1–3,

Maren Amasheh4, Susanne Schlichter4, Salah Amasheh5, Joachim Mankertz4, Martin Zeitz4, Michael Fromm5 and Jörg D. Schulzke4,*

4 Department of Gastroenterology and 5 Institute of Clinical Physiology, Charité Campus Benjamin Franklin, 12200 Berlin, Germany

* To whom correspondence should be addressed. E-mail: joerg.schulzke{at}charite.de.


   ABSTRACT
TOP
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Quercetin is the most abundant flavonoid and is assumed to have positive effects on the gastrointestinal mucosa after dietary intake. The aim of the study was to analyze the influence of quercetin on intestinal barrier function using the human colonic epithelial cell line Caco-2. Transepithelial resistance (Rt), tracer fluxes of [3H]-mannitol, 22Na+, and 36Cl– as well as electrogenic ion transport were determined in Ussing chambers. Expression of tight junction (TJ) proteins and mRNA was analyzed in Western blots and quantitative RT-PCR, respectively. Regulation of transcription was analyzed by reporter gene assay. Cellular distribution of TJ proteins was examined by confocal laser scanning microscopy (LSM). Apoptotic rate was determined by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining. Quercetin induced a dose-dependent increase of Rt persisting for >2 d. Daily addition of quercetin was able to perpetuate the effect, which was seen whether quercetin was added apically or to the basolateral compartment. Parallel to the Rt increase, quercetin induced a strong increase of the TJ protein claudin-4 but not of other claudins. Confocal LSM showed a localization of claudin-4 in TJ. Apoptotic rate was not affected by quercetin. Consistent with these changes, fluxes of Na+ and Cl–, but not of mannitol, were reduced. Reporter gene assays revealed a stimulatory effect of quercetin on claudin-4 transcription. The flavonoid quercetin enhances barrier function via transcriptional expression regulation of the TJ protein claudin-4, which represents an important protective effect of this food component against barrier disturbance in intestinal inflammation.


   Introduction
TOP
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Flavonoids comprise a large group of ~4000 polyphenolic compounds that are ubiquitously present in plants. Quercetin belongs to the subgroup of flavonols and is the most common flavonoid in nature. High amounts of quercetin are found in onions, kale, and apples (1). Human dietary intake of this flavonol can include hundreds of mg/d depending on food pattern (2–4). Flavonoids and especially quercetin exhibit beneficial effects in different human pathologies, including hypertension, cancer, and inflammatory conditions (5). So far, there is no information available concerning their effects on epithelial barrier function.

An important structural correlate of intestinal barrier function is represented by epithelial tight junctions (TJ).6 TJ are arranged in strands that are located in the apicolateral membrane of neighboring epithelial cells, linking cells together and thus determining paracellular permeability. Several transmembrane proteins located in TJ strands have been described so far, including occludin (6), tricellulin (7), junctional adhesion molecule (8), and the claudin protein family (9,10). Many members of the claudin protein family have been identified as primarily contributing to barrier characteristics in multiple organs (11,12). Mice lacking claudin-1 die within hours after birth because of dehydration (13), whereas claudin-5 is essential for the blood-brain barrier (14). Moreover, a few members of the claudin family have been reported to act as paracellular channels as reported for claudin-2 for small cations and for claudin-16 for magnesium and calcium (15,16). Mutations of claudin-16 are associated with familial hypomagnesemia, hypercalciuria, and nephrocalcinosis due to a disturbed Mg2+ absorption in the thick ascending limb of Henle's loop (17,18). Intestinal inflammation in patients with inflammatory bowel disease, on the other hand, results in a dysregulation of TJ (19–21). Thus, it is of major importance to know how TJ are regulated and whether or not natural food compounds may counteract pathological influences. In consideration of these facts, we wondered if quercetin can affect epithelial barrier function of the human colonic cell line Caco-2, a widely employed model for functional and molecular analysis of intestinal epithelia.


   Materials and Methods
TOP
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 LITERATURE CITED
 
    Cells and solutions. Confluent monolayers of the human colon carcinoma cell line Caco-2 were grown in 25-cm2 culture flasks containing modified Eagle's medium (Gibco/Invitrogen) supplemented with 15% (v:v) fetal bovine serum (Biochrom), 100 mg/L streptomycin, and 100 kU/L penicillin (PAA Laboratories). Cells were cultured at 37°C in a humidified 5% CO2 atmosphere. Cells were split every 2nd wk and either 4 x 105 cells in cell filter supports or 8 x 105 cells in wells of 6-well plates were seeded for the experiments and grown for 14 d to ensure full confluency of monolayers.

For inhibitor studies, staurosporin (ST), 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7), bisindolyl-maleimide I (GF109203x), 1-(5-iodonaphthalene-1-sulphonyl)-1H-hexahydro-1,4-diazepine hydro-chloride (ML-7), and 1, 2-bis (2-aminophenoxy) ethane-N, N, N', N'-tetraacetic acid-acetoxymethyl ester (BAPTA-AM) were used. Stock solutions of all inhibitors were dissolved in dimethylsulfoxide, except for ML-7, which was dissolved in ethanol. All inhibitors were diluted 1000-fold prior to premix with culture medium. Cells were incubated with blocking compounds 0.5 or 1 h prior to quercetin addition (ST, H7, GF109203x, or BAPTA-AM, respectively). Medium containing BAPTA-AM was exchanged completely before quercetin application. Unless otherwise noted, experiments were performed with medium with a high serum concentration (15% fetal bovine serum). Apoptosis was tested by means of terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay (Roche), as reported previously (20).

    Electrophysiology. Monolayers were grown on porous polycarbonate culture plate inserts (effective area: 0.6 cm2; Millicell HA or PCF, Millipore). Transepithelial resistance (Rt) ({Omega}·cm2) was determined with an ohmmeter (D. Sorgenfrei, Institute of Clinical Physiology, Berlin, Germany) as well as in a 4-electrode Ussing chamber (22). Manual measurements of Rt were performed on cell filter supports placed in culture dishes. The temperature was maintained at 37°C by a temperature-controlled warming plate. Resistance values were corrected for the resistance of the empty filter and of the bathing solution. Specialized Ussing chambers were designed for the insertion of Millicell filter supports (22). Water-jacketed gas lifts were filled with 0.01 L circulating fluid on each side. Bathing Ringer's solution contained 113.6 mmol/L NaCl, 2.4 mmol/L Na2HPO4, 0.6 mmol/L NaH2PO4, 21 mmol/L NaHCO3, 5.4 mmol/L KCl, 1.2 mmol/L CaCl2, 1.2 mmol/L MgCl2, 10 mmol/L D(+)-glucose, 10 mmol/L D(+)-mannose, 2.5 mmol/L L-glutamine, and 0.5 mmol/L β-hydroxybutyric acid. Ringer solution was gassed with 95% O2 and 5% CO2 to ensure a pH value of 7.4 at 37°C. Prior to each single experiment, the resistance of the bathing solution and the filter support was measured.

Unidirectional tracer flux measurements were performed with 25 MBq/L [3H]-mannitol (American Radiolabeled Chemicals) from the mucosal to the serosal side in Ussing chambers as reported previously (15). The medium also contained nonlabeled mannitol (10 mmol/L). Four flux periods of 15 min were analyzed and samples were taken at 0, 15, 30, 45, and 60 min. A 100-µL sample was taken from the mucosal side upon initiation. Samples (1 mL) from the serosal side were replaced with fresh Ringer's. Ultima Gold high flash-point liquid scintillation cocktail (Packard Bioscience) was used for analysis in a Tri-Carb 2100TR liquid scintillation counter (Packard).

Ion flux measurements were performed under short-circuited conditions with 2400 kBq/L 22Na+ and 9200kBq/L 36Cl– (NEN Life Science Products) after apical or basolateral application. Six 30-min flux periods were analyzed in analogy to the [3H]-mannitol flux measurements. Radioactivity of 22Na+ was counted in a gamma-counter 1480WizardTM3 (Wallac). Subsequently, samples were mixed with liquid scintillation cocktail and 36Cl– was determined in the β-counter Tri-Carb 2100TR. For calculating net fluxes, tissues were matched for conductance.

    Western blot and immunofluorescence. Western blotting was performed as reported previously (15). In brief, after preparation of membrane fractions, aliquots of 10 µg protein were mixed with SDS buffer (Laemmli), loaded onto 8.5 or 12.5% SDS polyacrylamide gels, electrophoretically separated, and blotted onto polyvinylidene difluoride membranes. Proteins were detected by immunoblotting with antibodies raised against human occludin, claudin-1, -3, -4, and -7. Chemiluminescence was induced with a Lumi-LightPLUS Western blotting kit (Roche), detected with an imaging system (LAS-1000, Fuji), and analyzed by quantification software (AIDA, Raytest).

Immunofluorescence studies were performed as reported recently (23). Briefly, cells were grown on cover slips (10-mm diameter; Menzel) placed in 24-well plates. Confluent monolayers were rinsed with PBS, fixed with methanol, and permeabilized with PBS containing 0.5% Triton X-100. Concentration of primary antibodies was 20 mg/L. Fluorescence images were obtained with a confocal laser scanning microscope (LSM) (Zeiss LSM 510 META) at excitation wavelengths of 543 and 488 nm, respectively.

    RT-PCR and reporter gene assays. Total RNA was obtained from Caco-2 cells by using RNAzol B reagent (WAK Chemie). First-strand cDNA was synthesized by the RT reaction (Moloney murine leukemia virus; Gibco) with oligo(dT) primer. Taqman PCR was performed according to the manufacturer's instructions (Applied Biosystems). Claudin-4- and glyceraldehyde 3-phosphate dehydrogenase-cDNA was quantified via VIC and FAM reporter dyes covalently attached to the 5' terminal base of the 2 probes.

For reporter gene assays, a 1627-bp DNA fragment including the transcription start point of claudin-4 was amplified from human genomic DNA (Genome walking kit, Clontech) with human claudin-4-specific primers (forward, GACCCTCCACCCTCCCTCTAT; reverse, AGCGCGATGCCCATTACCTGT) by PCR. The DNA fragment was cloned into the pGL4.10 reporter gene vector (Promega). Plasmids were screened by ampicillin selection, plasmid isolation, and agarose gel electrophoresis. Insert sequence and orientation were confirmed by DNA sequencing. Caco-2 cells were seeded into 6-well plates (1 x 106 cells per well) 24 h before transfection. Transient transfection of reporter gene constructs along with pGL4.70 coreporter-plasmid (Promega) was analyzed in the absence or presence of different quercetin concentrations. Measurement of luciferase activity was performed with the dual-luciferase reporter assay system (Promega) as previously described (24). Promoter activities were expressed as relative light units normalized for the activity of renilla luciferase in each setup. The data were calculated as the means of 3 identical setups. Action of quercetin on the claudin-4 promoter was corrected by the effect of the test compound on the pGL4.10 vector without an insert and was expressed as percentage of the control values.

    Chemicals. All chemicals, unless otherwise noted, were purchased from Sigma Aldrich. GF109203x was purchased from Calbiochem and H7 was obtained from Research Biochemicals International. Antibodies against claudin-1, -2, -3, -4, -7, and occludin were purchased from Zymed Laboratories (Zymed/Invitrogen). Secondary antibodies Alexa Fluor 488 goat anti-mouse and Alexa Fluor 594 goat anti-rabbit (both used in concentrations of 2 mg/L) were purchased from Molecular Probes (MoBiTec).

    Statistical analysis. Data are expressed as means ± SEM. Statistical analysis was performed by using Student's t test. Multiple groups were compared using ANOVA with post hoc Bonferroni tests. Differences of P < 0.05 were considered significant.


   Results
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 LITERATURE CITED
 
    Effects of quercetin on Rt. Confluent monolayers of Caco-2 cells had Rt between 200 and 350 {Omega}·cm2. Quercetin (Q) dose dependently increased Rt after 24 h (Fig. 1A): 50 µmol/L of the flavonol was without an effect, whereas 100 µmol/L resulted in increased Rt (121 ± 2% of initial resistance). Maximum Rt values were achieved with 200 µmol/L concentration (140 ± 2% of initial resistance). An increase of Rt after addition of 200 µmol/L Q became evident after 4 h of incubation (Q 132 ± 3% vs. 95 ± 2% of initial resistance), reached a maximum after 48 h (Q 163 ± 9% vs. C 104 ± 4% of initial resistance), and declined at the end of the experiment (72 h) (Fig. 1B). To examine the possibility that the free (active) quercetin concentration is influenced by the serum concentration in the incubation medium, quercetin (50 µmol/L) was also tested in medium without fetal bovine serum. This resulted in comparable results to those obtained in the presence of fetal bovine serum with a quercetin concentration of 200 µmol/L (24 h: C 105 ± 4% vs. Q 155 ± 3% of initial resistance, n = 5–6; P < 0.001).


Figure 1
View larger version (8K):
[in this window]
[in a new window]

  		FIGURE 1  Dose (A) and time (B) effects of quercetin on Rt of Caco-2 cells. In A, concentrations of 50, 100, 150, and 200 µmol/L quercetin in serum-containing medium were used for incubation of Caco-2 cell monolayers (24 h). In B, cells were cultured for 7–14 d. Rt was measured for 72 h and compared with respective controls. Values are means ± SEM, n = 11–12. Asterisks indicate different from control: *P < 0.05, ***P < 0.001.

 
All following experiments were performed at a concentration of 200 µmol/L in serum-containing medium. Addition of quercetin either to the mucosal, serosal, or both sides of the monolayer elicited similar results. A decline in the effect of Q became apparent after 72 h. However, the effect persisted when quercetin was added daily at 0, 24, and 48 h. The effect of a single addition of quercetin was 123 ± 3% of initial resistance, whereas when quercetin was added daily, it was 150 ± 4% of initial resistance after 72 h (P < 0.05).

    Effects of quercetin on the expression of TJ proteins. Subsequent to electrophysiological experiments, expression of TJ proteins was analyzed by immunoblotting (original blots, Fig. 2) and immunostaining. Densitometric analysis of Western blots revealed an increase in claudin-4 after incubation with 200 µmol/L quercetin for 24 h (226 ± 30%) relative to control incubations (100 ± 13%; n = 4; P < 0.01), whereas occludin, and claudin-1, -3, and -7 were unaltered.


Figure 2
View larger version (97K):
[in this window]
[in a new window]

  		FIGURE 2  Effects of quercetin on the expression of TJ proteins in Caco-2 cell monolayers. Western blots revealed an increase of claudin-4, whereas occludin and claudin-1, -3, and -7 were unaffected.

 
To test whether a change in Rt could have been caused by an altered cellular localization of TJ proteins, immunostainings were performed. Double stainings showed a colocalization of claudins (green staining) with occludin (red staining), resulting in a yellow staining of merged confocal images within the TJ complex (Supplemental Figs. 1 and 2). After 24 h of 200 µmol/L quercetin the immunofluorescence signals of claudin-4 were more intense and were localized in both, within the TJ as well as intracellularly below the apical membrane and in the subjunctional plasma membrane (Supplemental Fig. 1). In contrast, there was no effect on occludin or claudin-1, -3, and -7 (Supplemental Fig. 2).

    Transcriptional regulation of claudin-4. To determine the effect of quercetin (24 h, 200 µmol/L) on claudin-4 mRNA expression, TaqMan real-time PCR was performed with specific primers and normalized with GAPDH signals. Quantification of nucleic acids revealed an almost 2-fold increase of claudin-4 mRNA by quercetin (284 ± 50%; P < 0.05, n = 6) relative to control.

    Effect of quercetin on claudin-4 promoter activity. Luciferase reporter gene assays were performed to study effects of quercetin on the promoter of claudin-4. The claudin-4 promoter was cloned into a pGL4.10 vector bearing a luciferase gene for quantitative measurement of promoter activity. A quercetin concentration of 25 µmol/L increased the promoter activity to 153 ± 16% (P < 0.05; n = 6–9) expressed as percentage of controls. A concentration of 10 µmol/L quercetin was ineffective. Thus, quercetin is able to activate the claudin-4 promoter, which can explain the increase in mRNA level and subsequently in protein.

This part of the study was performed on subconfluent Caco-2 cells, because an experimental design that includes transfection of Caco-2 cells is only efficient on single (still dividing) cells. To exclude cytotoxicity of quercetin on subconfluent cells, a lactate dehydrogenase release assay was performed and subsequently only noncytotoxic concentrations of 10 and 25 µmol/L (data not shown) were used for experiments on subconfluent cells.

    Effect of quercetin on apoptotic rate. Because increased apoptotic rate may have affected barrier function, apoptoses were assayed by TUNEL staining. However, quercetin did not alter the apoptotic rate of Caco-2 cells and therefore upregulated apoptosis could be excluded as a cause for changes of Rt.

    Flux measurements. The epithelial barrier was characterized by flux measurements of [3H]-mannitol, 22Na+, and 36Cl– (Table 1). Mannitol flux was not changed by 200 µmol/L quercetin after 24 h. Na+ JNa as well as Cl– flux JCl was reduced to a similar extent in either direction (serosal-to-mucosal JNasm 63%; mucosal-to-serosal JNams 75%; JClsm 64%; JClms 71 vs. control 100%). Resulting net fluxes as well as ISC, a measure of active ion transport, were not significantly altered, thus excluding an effect of quercetin on transcellular ion transport. This result also speaks against a contribution of transcellular pathways to the quercetin-induced Rt increase.


View this table:
[in this window]
[in a new window]

  		TABLE 1 Effect of quercetin on mannitol, Na+, and Cl– fluxes of Caco-2 cell monolayers12

 
    Cellular signal mechanisms involved in the quercetin effect. Effects of inhibitors on the quercetin-induced increase in Rt were tested by coincubation of confluent monolayers with 200 µmol/L quercetin. ST and H7 blocked the effect, whereas the protein kinase C (PKC) inhibitor GF109203x, the myosin light chain kinase (MLCK) blocker ML-7, and the intracellular Ca2+ chelator BAPTA-AM were ineffective (Fig. 3).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

  		FIGURE 3  Effects of blocking compounds on Rt in Caco-2 cell monolayers incubated with 200 µmol/L quercetin on both sides of Caco-2 monolayers. Values are means ± SEM, n = 3–11. Asterisks indicate different from incubations without inhibitor: *P < 0.05, **P < 0.01.

 
The specific PKC inhibitor GF109203x induced a quercetin-like effect; GF increased Rt after 24 h (117 ± 3%) compared with untreated controls (101 ± 2%); GF increased even more after 48 h of incubation (142 ± 6%) relative to control (110 ± 3%).

    Quercitrin effect on Rt. Food-born flavonoids predominate as glycosides. In this study, we used quercitrin [quercetin-3-rhamoside (Qr)] as a model glycoside to compare its Rt effect on Caco-2 monolayers. After 24 h, 200 µmol/L quercitrin increased Rt in serum-free medium (130 ± 5% of initial resistance) relative to control (113 ± 1% of initial resistance). This increase in Qr reached a maximum after 48 h (137 ± 6%) relative to control (107 ± 3% of initial resistance) and persisted up to the end of the experiment (72 h).


   Discussion
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
LITERATURE CITED
 
As the central result of this study, quercetin enhanced barrier properties in a widely used intestinal model system for the study of epithelial functions, namely in Caco-2 colonic cell monolayers. This effect ranks among a large number of beneficial effects reported for dietary flavonoids, which include suppression of carcinogenesis and prevention of cardiovascular disease (25,26). The direct induction of expression of a "sealing" TJ protein by quercetin is novel.

The TJ constitutes the main paracellular barrier in epi- and endothelia. Several intestinal diseases have been associated with a disorder of the TJ (27,28). Several TJ proteins have been demonstrated to alter the paracellular barrier, either by sealing or by permeabilizing it. Overexpression of claudin-4 or -5 increases the paracellular barrier (29,30), whereas claudin-2 and -16 decreases the paracellular barrier by induction of paracellular channels (15,16,31).

In our study, quercetin induced claudin-4 expression, whereas claudin-1, -3, -7 and occludin remained unchanged. Confocal LSM revealed that this effect was not limited to the TJ domain of the enterocytes but was also visible in subjunctional membrane areas and within the enterocytes. Thus, upregulation of claudin-4 expression leads to higher amounts of claudin-4 in endoplasmic reticulum/Golgi and plasma membrane with the result of more claudin-4 being assembled in TJ strands.

Endocytosis of TJ transmembrane proteins via vacuolar apical compartments, a selective vacuolarization of the apical plasma membrane, was reported after interferon-{gamma} incubation (32). This mechanism or its inhibition, however, appears not to be responsible for the TJ effects seen after quercetin incubation. Vacuolar apical compartments have been described as large vacuoles (1–6 µm) containing microvilli, which we could not detect in our cells either before or after flavonoid treatment in confocal microscopy.

Overexpression of claudin-4 in epithelial cells by means of stable cDNA transfection has been shown to increase Rt and decrease Na+ permeability, whereas mannitol permeability was not affected (29). This pattern of alterations is identical to the changes seen here. The interpretation of a paracellular permeability change through a claudin-4-dependent change in TJ strand composition is supported by the sodium and chloride flux measurements that showed flux reductions in either direction without changes in net flux. That quercetin also reduced Cl– permeability could be due to a change of the phosphorylation status of claudin-4 (33) or may reflect compensatory changes in the expression of other TJ proteins.

Clinical interest is growing in therapies based on supplementing trace elements and vitamins. For example, glutamine has been demonstrated to improve intestinal barrier function in highly stressed patients (34) and to prevent parenteral nutrition-induced increases in intestinal permeability (35). SCFA have been investigated for their effects on paracellular permeability. In vitro, butyrate, acetate, and propionate all exert a concentration-dependent reduction in paracellular permeability in the Caco-2 model of colonic epithelium, causing mechanical distension, promoting differentiation, and improving barrier function (36). Zinc supplementation has been shown to be beneficial when the small intestinal barrier is altered by inflammation, because it improves the capacity of the small intestine to absorb water and electrolytes. Zinc is known to stimulate tissue healing and repair in experimental ulcers directly through promoting cell proliferation, protein synthesis, growth factor production, and scavenging free radicals (37). Within this number of protective agents, quercetin has recently been found to act as a direct intestinal protective agent by improving the intestinal barrier function.

The increase of Rt after quercetin incubation was blocked by the protein kinase inhibitors ST and H7. ST has a broad specificity inhibiting various protein kinases, including protein kinase A (half maximal inhibitory concentration = 15 nmol/L), PKG (18 nmol/L), CaMKII (20 nmol/L), S6K (5 nmol/L), MLCK (21 nmol/L), SRC (6 nmol/L), FGR (2 nmol/L), LYN (20 nmol/L), and SYK (16 nmol/L) and H7 also inhibits PKA, PKG, and MLCK besides PKC. Hence, the effectiveness of these inhibitors is not a final piece of evidence for the PKC pathway to be involved in the quercetin effect; their inhibitory effect may suggest the participation of PKC. The blocking compounds ML-7 (a MLCK inhibitor) and BAPTA-AM (a Ca2+ chelator) had no effect, pointing against the MLCK or intracellular Ca2+ as signaling pathways. The specific PKC inhibitor GF109203x was also not able to block the quercetin effect, although it affected baseline Rt in our Caco-2 cells. However, this was not surprising, because PKC-dependent TJ regulation was already described before (38). As quercetin has been reported to act as a potential PKC blocker (39), TJ modulation via PKC would have been possible.

Other information on the underlying mechanisms for the quercetin effect on the claudin-4 promoter could be obtained from the direct interaction of quercetin with the DNA. A weak interaction between quercetin and DNA in solution occurred (40), Further structural analysis showed quercetin binding to adenine, guanine, and thymine bases, as well as to the backbone phosphate group (41). Furthermore, it has been described that quercetin could affect the interaction state of the ubiquitous transcription factor Sp1 and the androgen receptor (42).

TJ protein expression and TJ permeability are influenced by a variety of developmental, physiological, and pathological mechanisms. There is evidence that TJ expression and conductance is affected by cytokines (43). Tumor necrosis factor {alpha} increases the TJ permeability of Caco-2 cells, requiring upregulation of MLCK protein expression, which was mediated by increased MLCK mRNA transcription (44). Other stimuli, including bacterial toxins, activate PKC either by Zonula occludens toxin or by phorbol esters increasing epithelial paracellular permeability. Conductance can also be changed by altering second messenger systems and signaling pathways (45).

Quercetin is a lipophilic molecule that can traverse epithelia by diffusion. Nevertheless, more molecules seem to pass in the serosal to mucosal direction than vice versa in Caco-2 cells (46). Efflux effects have been proposed to be abolished by adding plasma to the serosal side, which results in covalent binding of quercetin to serum proteins (47–49). In our study, however, no difference between apical and basal application was observed. In our experiments using a rather high serum concentration, a quercetin concentration of 200 µmol/L caused maximum effects. When the serum concentration was reduced, the quercetin concentration could be decreased to 50 µmol/L. Currently, bioavailability and physiological concentrations of quercetin are intensively discussed. Usually it is assumed that its glycosides reach the intestine, where they are hydrolyzed by the enzyme lactate phlorizin hydrolase or by β-glycosidases. The aglycon is then conjugated intracellularly and released into the blood (50). Also in Caco-2 cells, quercetin was almost completely conjugated within 2 h (51). Thus, quercetin metabolites are assumed to be the active compounds. Thus, it is possible that in our experimental system, quercetin metabolites like glucuronides and/or sulfates, not aglycons, are the active compounds.

Information of intestinal intraluminal concentrations of quercetin in the gastrointestinal tract are still lacking as well as information about concentration achieved in human tissues. Ma et al. (52) suggested that >50 µmol/L of quercetin might be obtainable in rat circulation when quercetin was given orally at 150 mg/kg body weight. Because of the rather slow elimination of quercetin with a half-life time of ~25 h, an additional accumulation must be expected (53). Other studies indicated even higher concentrations of up to 100 µmol/L in the intestinal epithelium (52,54). Taken together, we suppose that a daily oral uptake of 500 mg quercetin in humans could result in mucosal concentrations of up to 200 µmol/L quercetin.

Also important, our study demonstrated that the quercetin effect exhibited no tachyphylaxia but persisted under repeated quercetin addition.

To determine whether quercetin glycosides can also increase Rt, Qr was used. Qr is found, e.g., in apples (55) and is not hydrolyzed by lactate phlorizin hydrolase or β-glucosidases (56–60). In contrast to other glycosides, epithelial Qr transport is only scarcely present (51,61). Nevertheless, 200 µmol/L Qr also increased Rt, but with a significant time delay that might have been caused by its poor absorption.

In this study, we analyzed the effect of quercetin on epithelial barrier function. This not only advances our understanding of the regulation of paracellular intestinal barrier but may also facilitate the future design and refinement of therapeutic barrier-enhancing strategies during intestinal inflammation, e.g. in inflammatory bowel disease or in postinfectious irritable bowel syndrome.


   ACKNOWLEDGMENTS
 
We thank A. Fromm, S. Dullat, S. Schön, and D. Sorgenfrei for their excellent technical assistance.


   FOOTNOTES
 
1 Supported by grants from the Sonnenfeld Stiftung Berlin. Back

2 Author disclosures: M. Amasheh, S. Schlichter, S. Amasheh, J. Mankertz, M. Zeitz, M. Fromm, and J. D. Schulzke, no conflicts of interest. Back

3 Supplemental Figures 1 and 2 are available with the online posting of this paper at jn.nutrition.org. Back

6 Abbreviations used: BAPTA-AM, 1, 2-bis (2-aminophenoxy) ethane-N, N, N', N'-tetraacetic acid-acetoxymethyl ester; GF109203x, bisindolyl-maleimide I; H7, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine; JNa, sodium flux; LSM, laser scanning microscopy; ML-7, 1-(5-iodonaphthalene-1-sulphonyl)-1H-hexahydro-1,4-diazepine hydro-chloride; MLCK, myosin light chain kinase; ms, mucosal-to-serosal; PKC, protein kinase C; Qr, quercitrin; Rt, transepithelial resistance; sm, serosal-to-mucosal; ST, staurosporin; TJ, tight junction; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. Back

Manuscript received 26 October 2007. Initial review completed 18 December 2007. Revision accepted 20 March 2008.


   LITERATURE CITED
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Hertog MGL, Hollman PCH, Katan MB. Content of potentially anticarcinogenic flavonoids of 28 vegetables and 9 fruits commonly consumed in the Netherlands. J Agric Food Chem. 1992;40:2379–83.[CrossRef]

2. Hertog MGL, Hollman PCH, van de Putte B. Content of potentially anticarcinogenic flavonoids of tea infusions, wine, and fruit juices. J Agric Food Chem. 1993;41:1242–6.[CrossRef]

3. Hollman PCA, Arts ICW. Flavonols, flavones and flavanols: nature, occurrence and dietary burden. J Sci Food Agric. 2000;80:1081–93.[CrossRef]

4. Jones E, Hughes RE. Quercetin, flavonoids and the life-span of mice. Exp Gerontol. 1982;17:213–7.[CrossRef][Medline]

5. Middleton E Jr, Kandaswami C, Theoharides TC. The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer. Pharmacol Rev. 2000;52:673–751.[Abstract/Free Full Text]

6. Furuse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, Tsukita S. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol. 1993;123:1777–88.[Abstract/Free Full Text]

7. Ikenouchi J, Furuse M, Furuse K, Sasaki H, Tsukita S. Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. J Cell Biol. 2005;171:939–45.[Abstract/Free Full Text]

8. Bazzoni G. The JAM family of junctional adhesion molecules. Curr Opin Cell Biol. 2003;15:525–30.[CrossRef][Medline]

9. Furuse M, Sasaki H, Fujimoto K, Tsukita S. A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts. J Cell Biol. 1998;143:391–401.[Abstract/Free Full Text]

10. Morita K, Furuse M, Fujimoto K, Tsukita S. Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. Proc Natl Acad Sci USA. 1999;96:511–6.[Abstract/Free Full Text]

11. Tsukita S, Furuse M, Itoh M. Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2001;2:285–93.[CrossRef][Medline]

12. Van Itallie CM, Anderson JM. Claudins and epithelial paracellular transport. Annu Rev Physiol. 2006;68:403–29.[CrossRef][Medline]

13. Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, Noda T, Kubo A, Tsukita S. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol. 2002;156:1099–111.[Abstract/Free Full Text]

14. Nitta T, Hata M, Gotoh S, Seo Y, Sasaki H, Hashimoto N, Furuse M, Tsukita S. Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice. J Cell Biol. 2003;161:653–60.[Abstract/Free Full Text]

15. Amasheh S, Meiri N, Gitter AH, Schöneberg T, Mankertz J, Schulzke JD, Fromm M. Claudin-2 expression induces cation-selective channels in tight junctions of epithelial cells. J Cell Sci. 2002;115:4969–76.[CrossRef][Medline]

16. Kausalya PJ, Amasheh S, Günzel D, Wurps H, Müller D, Fromm M, Hunziker W. Disease-associated mutations affect intracellular traffic and paracellular Mg2+ transport function of Claudin-16. J Clin Invest. 2006;116:878–91.[CrossRef][Medline]

17. Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M, Casari G, Bettinelli A, Colussi G, et al. Paracellin-1, a renal tight junction protein required for paracellular Mg2+ resorption. Science. 1999;285:103–6.[Abstract/Free Full Text]

18. Weber S, Hoffmann K, Jeck N, Saar K, Boeswald M, Kuwertz-Broeking E, Meij II, Knoers NV, Cochat P, et al. Familial hypomagnesaemia with hypercalciuria and nephrocalcinosis maps to chromosome 3q27 and is associated with mutations in the PCLN-1 gene. Eur J Hum Genet. 2000;8:414–22.[CrossRef][Medline]

19. Prasad S, Mingrino R, Kaukinen K, Hayes KL, Powell RM, MacDonald TT, Collins JE. Inflammatory processes have differential effects on claudins 2, 3 and 4 in colonic epithelial cells. Lab Invest. 2005;85:1139–62.[CrossRef][Medline]

20. Bürgel N, Bojarski C, Mankertz J, Zeitz M, Fromm M, Schulzke JD. Mechanisms of diarrhea in collagenous colitis. Gastroenterology. 2002;123:433–43.[CrossRef][Medline]

21. Zeissig S, Bürgel N, Günzel D, Richter J, Mankertz J, Wahnschaffe U, Kroesen AJ, Zeitz M, Fromm M, et al. Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn's disease. Gut. 2007;56:61–72.[Abstract/Free Full Text]

22. Kreusel KM, Fromm M, Schulzke JD, Hegel U. Cl– secretion in epithelial monolayers of mucus-forming human colon cells (HT-29/B6). Am J Physiol. 1991;261:C574–82.[Medline]

23. Florian P, Amasheh S, Lessidrensky M, Todt I, Bloedow A, Ernst A, Fromm M, Gitter AH. Claudins in the tight junctions of stria vascularis marginal cells. Biochem Biophys Res Commun. 2003;304:5–10.[CrossRef][Medline]

24. Mankertz J, Tavalali S, Schmitz H, Mankertz A, Riecken EO, Fromm M, Schulzke JD. Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma. J Cell Sci. 2000;113:2085–90.[Abstract]

25. Gee JM, Johnson IT. Polyphenolic compounds: interactions with the gut and implications for human health. Curr Med Chem. 2001;8:1245–55.[Medline]

26. Perez-Vizcaino F, Duarte J, Andriantsitohaina R. Endothelial function and cardiovascular disease: effects of quercetin and wine polyphenols. Free Radic Res. 2006;40:1054–65.[CrossRef][Medline]

27. Mullin JM, Agostino N, Rendon-Huerta E, Thornton JJ. Keynote review: epithelial and endothelial barriers in human disease. Drug Discov Today. 2005;10:395–408.[CrossRef][Medline]

28. Sawada N, Murata M, Kikuchi K, Osanai M, Tobioka H, Kojima T, Chiba H. Tight junctions and human diseases. Med Electron Microsc. 2003;36:147–56.[CrossRef][Medline]

29. Van Itallie C, Rahner C, Anderson JM. Regulated expression of claudin-4 decreases paracellular conductance through a selective decrease in sodium permeability. J Clin Invest. 2001;107:1319–27.[Medline]

30. Amasheh S, Schmidt T, Mahn M, Florian P, Mankertz J, Tavalali S, Gitter AH, Schulzke JD, Fromm M. Contribution of claudin-5 to barrier properties in tight junctions of epithelial cells. Cell Tissue Res. 2005;321:89–96.[CrossRef][Medline]

31. Furuse M, Furuse K, Sasaki H, Tsukita S. Conversion of zonulae occludentes from tight to leaky strand type by introducing claudin-2 into Madin-Darby canine kidney I cells. J Cell Biol. 2001;153:263–72.[Abstract/Free Full Text]

32. Utech M, Ivanov AI, Samarin SN, Bruewer M, Turner JR, Mrsny RJ, Parkos CA, Nusrat A. Mechanism of IFN-gamma-induced endocytosis of tight junction proteins: myosin II-dependent vacuolarization of the apical plasma membrane. Mol Biol Cell. 2005;16:5040–52.[Abstract/Free Full Text]

33. Le Moellic C, Boulkroun S, González-Nunez D, Dublineau I, Cluzeaud F, Fay M, Blot-Chabaud M, Farman N. Aldosterone and tight junctions: modulation of claudin-4 phosphorylation in renal collecting duct cells. Am J Physiol Cell Physiol. 2005;289:C1513–21.[Abstract/Free Full Text]

34. Neu J, DeMarco V, Li N. Glutamine: clinical applications and mechanisms of action. Curr Opin Clin Nutr Metab Care. 2002;5:69–75.[Medline]

35. Li J, Langkamp-Henken B, Suzuki K, Stahlgren LH. Glutamine prevents parenteral nutrition-induced increases in intestinal permeability. JPEN J Parenter Enteral Nutr. 1994;18:303–7.[Abstract/Free Full Text]

36. Mariadason JM, Barkla DH, Gibson PR. Effect of short-chain fatty acids on paracellular permeability in Caco-2 intestinal epithelium model. Am J Physiol. 1997;272:G705–12.[Medline]

37. Sturniolo GC, Di Leo V, Barollo M, Fries W, Mazzon E, Ferronato A, D'Incà R. The many functions of zinc in inflammatory conditions of the gastrointestinal tract. J Trace Elem Exp Med. 2000;13:33–9.

38. Stenson WF, Easom RA, Riehl TE, Turk J. Regulation of paracellular permeability in Caco-2 cell monolayers by protein kinase C. Am J Physiol. 1993;265:G955–62.[Medline]

39. Ferriola PC, Cody V, Middleton E Jr. Protein kinase C inhibition by plant flavonoids. Kinetic mechanisms and structure-activity relationships. Biochem Pharmacol. 1989;38:1617–24.[CrossRef][Medline]

40. Oliveira-Brett AM, Diculescu VC. Electrochemical study of quercetin-DNA interactions. Part I. Analysis in incubated solutions. Bioelectrochemistry. 2004;64:133–41.[Medline]

41. Kanakis CD, Tarantilis PA, Polissiou MG, Diamantoglou S, Tajmir-Riahi HA. DNA interaction with naturally occurring antioxidant flavonoids quercetin, kaempferol, and delphinidin. J Biomol Struct Dyn. 2005;22:719–24.[Medline]

42. Yuan H, Gong A, Young CY. Involvement of transcription factor Sp1 in quercetin-mediated inhibitory effect on the androgen receptor in human prostate cancer cells. Carcinogenesis. 2005;26:793–801.[Abstract/Free Full Text]

43. Nusrat A, Turner JR, Madara JL. Molecular physiology and pathophysiology of tight junctions. IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune cells. Am J Physiol Gastrointest Liver Physiol. 2000;279:G851–7.[Abstract/Free Full Text]

44. Ma TY, Boivin MA, Ye D, Pedram A, Said HM. Mechanism of TNF-{alpha} modulation of Caco-2 intestinal epithelial tight junction barrier: role of myosin light-chain kinase protein expression. Am J Physiol Gastrointest Liver Physiol. 2005;288:G422–30.[Abstract/Free Full Text]

45. Balda MS, Gonzalez-Mariscal L, Matter K, Cereijido M, Anderson JM. Assembly of the tight junction: the role of diacylglycerol. J Cell Biol. 1993;123:293–302.[Abstract/Free Full Text]

46. Walgren RA, Walle UK, Walle T. Transport of quercetin and its glucosides across human intestinal epithelial Caco-2 cells. Biochem Pharmacol. 1998;55:1721–7.[CrossRef][Medline]

47. Walgren RA, Walle T. The influence of plasma binding on absorption/exsorption in the Caco-2 model of human intestinal absorption. J Pharm Pharmacol. 1999;51:1037–40.[Medline]

48. Walle T, Vincent TS, Walle UK. Evidence of covalent binding of the dietary flavonoid quercetin to DNA and protein in human intestinal and hepatic cells. Biochem Pharmacol. 2003;65:1603–10.[CrossRef][Medline]

49. Kaldas MI, Walle UK, van der Woude H, McMillan JM, Walle T. Covalent binding of the flavonoid quercetin to human serum albumin. J Agric Food Chem. 2005;53:4194–7.[Medline]

50. Murota K, Terao J. Antioxidative flavonoid quercetin: implication of its intestinal absorption and metabolism. Arch Biochem Biophys. 2003;417:12–7.[CrossRef][Medline]

51. Murota K, Shimizu S, Chujo H, Moon JH, Terao J. Efficiency of absorption and metabolic conversion of quercetin and its glucosides in human intestinal cell line Caco-2. Arch Biochem Biophys. 2000;384:391–7.[CrossRef][Medline]

52. Ma ZS, Nguyen TH, Huynh TH, Do PT, Huynh H. Reduction of rat prostate weight by combined quercetin-finasteride treatment is associated with cell cycle deregulation. J Endocrinol. 2004;181:493–507.[Abstract]

53. Moon JH, Nakata R, Oshima S, Inakuma T, Terao J. Accumulation of quercetin conjugates in blood plasma after the short-term ingestion of onion by women. Am J Physiol Regul Integr Comp Physiol. 2000;279:R461–7.[Abstract/Free Full Text]

54. van der Woude H, Gliszczynska-Swiglo A, Struijs K, Smeets A, Alink GM, Rietjens IM. Biphasic modulation of cell proliferation by quercetin at concentrations physiologically relevant in humans. Cancer Lett. 2003;200:41–7.[CrossRef][Medline]

55. Németh K, Plumb GW, Berrin JG, Juge N, Jacob R, Naim HY, Williamson G, Swallow DM, Kroon PA. Deglycosylation by small intestinal epithelial cell beta-glucosidases is a critical step in the absorption and metabolism of dietary flavonoid glycosides in humans. Eur J Nutr. 2003;42:29–42.[CrossRef][Medline]

56. Arts IC, Sesink AL, Faassen-Peters M, Hollman PC. The type of sugar moiety is a major determinant of the small intestinal uptake and subsequent biliary excretion of dietary quercetin glycosides. Br J Nutr. 2004;91:841–7.[Medline]

57. Bokkenheuser VD, Shackleton CH, Winter J. Hydrolysis of dietary flavonoid glycosides by strains of intestinal bacteroides from humans. Biochem J. 1987;248:953–6.[Medline]

58. Day AJ, DuPont MS, Ridley S, Rhodes M, Rhodes MJ, Morgan MR, Williamson G. Deglycosylation of flavonoid and isoflavonoid glycosides by human small intestine and liver beta-glucosidase activity. FEBS Lett. 1998;436:71–5.[CrossRef][Medline]

59. Ioku K, Pongpiriyadacha Y, Konishi Y, Takei Y, Nakatani N, Terao J. beta-Glucosidase activity in the rat small intestine toward quercetin monoglucosides. Biosci Biotechnol Biochem. 1998;62:1428–31.[CrossRef][Medline]

60. Morand C, Manach C, Crespy V, Remesy C. Respective bioavailability of quercetin aglycone and its glycosides in a rat model. Biofactors. 2000;12:169–74.[Medline]

61. Juergenliemk G, Boje K, Huewel S, Lohmann C, Galla HJ, Nahrstedt A. In vitro studies indicate that miquelianin (quercetin 3-O-beta-D-glucuronopyranoside) is able to reach the CNS from the small intestine. Planta Med. 2003;69:1013–7.[Medline]




This article has been cited by other articles:


Home page
 J. Nutr.Home page
T. Suzuki and H. Hara
Quercetin Enhances Intestinal Barrier Function through the Assembly of Zonnula Occludens-2, Occludin, and Claudin-1 and the Expression of Claudin-4 in Caco-2 Cells
J. Nutr., May 1, 2009; 139(5): 965 - 974.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amasheh, M.
Right arrow Articles by Schulzke, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amasheh, M.
Right arrow Articles by Schulzke, J. D.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2008 by American Society for Nutrition