Journal of Nutrition

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seiliez, I.
Right arrow Articles by Tesseraud, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seiliez, I.
Right arrow Articles by Tesseraud, S.
© 2008 American Society for Nutrition J. Nutr. 138:487-491, March 2008


Nutrient Physiology, Metabolism, and Nutrient-Nutrient Interactions

Feeding Status Regulates the Polyubiquitination Step of the Ubiquitin-Proteasome-Dependent Proteolysis in Rainbow Trout (Oncorhynchus mykiss) Muscle1

Iban Seiliez2,*, Stéphane Panserat2, Sandrine Skiba-Cassy2, Aurélie Fricot2, Christiane Vachot2, Sadasivam Kaushik2 and Sophie Tesseraud3

2 INRA, UMR1067 Nutrition Aquaculture et Génomique, F-64310 Saint-Pée-sur-Nivelle, France and 3 INRA, UR83 Recherches Avicoles, F-37380 Nouzilly, France

* To whom correspondence should be addressed. E-mail: seiliez{at}st-pee.inra.fr.


    ABSTRACT
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
In mammals, the ubiquitin-proteasome proteolytic pathway is a major route of protein degradation and has been shown to be regulated by the feeding status via the protein kinase B (PKB)-Forkehead box-O transcription factor signaling pathway-mediated transcription regulation of atrophy-related ubiquitin ligases, atrogin1 and muscle RING finger 1. In contrast, in rainbow trout (Oncorhynchus mykiss), the activity of the proteasome in muscle was not affected during starvation-induced muscle degradation. The aim of this study was therefore to explore the molecular basis for this lack of induction of this proteolytic route during starvation. In this study, rainbow trout were food deprived for 7 and 14 d, refed ad libitum, and the effect of the nutritional status was assessed on the different steps involved in the regulation of the ubiquitin-proteasome system in muscle. We observed that starvation reduced the phosphorylation of PKB and enhanced the expression of atrogin1 in muscle, whereas refeeding led to the opposite effects. The level of polyubiquitinated proteins in muscle increased to over 2 times the initial value on d 0 after 14 d of starvation and decreased significantly at 12 h after refeeding, but there were no major changes in the activity of the main proteasomal peptidases (chymotrypsin-like and trypsin-like). Altogether, these results indicate that in rainbow trout muscle, the polyubiquitination step of the ubiquitin-proteasome route is regulated by the feeding status similarly to what is observed in mammals.



    Introduction
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Protein degradation is a highly controlled, selective, and regulated process that depends on activities of proteolytic enzymes (1). Three major proteolytic systems are involved in vertebrate muscle proteolysis: 1) the membrane-bound lysosomal enzymes; 2) calpain proteinases; and 3) the ubiquitin-proteasome pathway enzymes. The possible contributions of these proteolytic systems have been debated, with strong evidence that the bulk of protein degradation during muscle atrophy in mammals occurs via the ATP-dependent ubiquitin-proteasome pathway (26). In contrast, in rainbow trout (Oncorhynchus mykiss), the activity of the proteasome in muscle was not changed during starvation-induced muscle degradation (7). Furthermore, microarray gene expression analysis in atrophying rainbow trout shows that mRNA levels for the subunits of the proteasome were not affected or downregulated (8), supporting the idea that the degradation of muscle proteins occurs in this species by a route distinct from the one observed in mammals (9).

The ubiquitin-proteasome route of protein degradation involves 2 discrete steps. First, multiple ubiquitin molecules covalently attach to the protein substrate (10,11) and then these tagged proteins are degraded by the proteasome (12), resulting in peptides of 7–9 amino acid residues (13). Polyubiquitination is a complex and multiple-step process that requires ATP, the ubiquitin-activating enzyme (E1), and one of the ubiquitin-conjugating enzymes (E2), which functions either alone or in the presence of a ubiquitin-protein ligase (E3) responsible for substrate recognition (14,15). Following polyubiquitination, the targeted proteins are then recognized and degraded by the 26S proteasome.

Regulation of the ubiquitin-proteasome system has been intensively investigated in recent years (16). Recent results suggest that 2 E3 ubiquitin ligases, muscle atrophy F-box (also called atrogin-1)3 and muscle RING finger 1 (MuRF1) are key elements of the regulation of ubiquitin–proteasome-mediated muscle protein degradation (6,1719). In both in vitro and in vivo mammal and chicken models, the expression of the corresponding genes was also shown to be strongly regulated by growth factors (insulin or insulin-like growth factor-I) and nutrients (amino acids) via mechanisms involving the protein kinase B (PKB or Akt)-Forkehead box-O transcription factors and the PKB-target of rapamycin signaling axis (2023).

Recent in vitro studies have shown the existence and the hormonal (insulin and/or insulin-like growth factor-I) regulation of PKB activation in rainbow trout and zebrafish (24,25), suggesting the existence of the above-mentioned mechanism in these species. The aim of this study was therefore to clarify the molecular basis of rainbow trout muscle atrophy by exploring the effect of food starvation and refeeding on several major steps involved in the regulation of the ubiquitin-proteasome system.


    Materials and Methods
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Fish and experimental procedures. Juvenile immature rainbow trout (weights ranging from 35 to 40 g) were grown in our own experimental facilities (INRA, Donzacq, France) at 18°C under artificial photoperiods (12 h/12 h) and fed ad libitum with a commercial trout feed (Skretting: crude protein, 49.8% dry matter; crude fat, 13.8% dry matter; gross energy, 22 kJ/g dry matter) before the experiment. They were food deprived for 7 and 14 d. The trout that were food deprived for 14 d were then refed with an experimental diet (Table 1) by hand until visual satiation and sampled (n = 6) at 2, 6, 12, and 24 h after feeding. As control, a group of fish (n = 6) was sampled prior to refeeding. The food deprivation reduced the weight of the eviscerated fish (43.9 ± 1.1 g at d 14 vs. 50.6 ± 2.6 g at d 0; Student's t test; P < 0.05). After blood sampling, trout were killed and muscles were removed, quickly frozen, powdered in liquid nitrogen, and stored at –80°C.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Composition of the experimental diet

 
    Determination of atrogin1 gene expression by real-time PCR. Total RNA was extracted from the samples using TRIzol reagent (Invitrogen). Following first-strand synthesis, expression levels of atrogin1 mRNA were analyzed by real-time PCR performed by means of the iCycler iQ (Bio-Rad), using the iQ SYBR green supermix. Primer sequences (5'-3' forward primer: TTCAACAACCTAATCGCTCTCT; 5'-3' reverse primer: TTCTCCT-GGTAAACAAACTGTGA) were chosen based on the rainbow trout atrogin1 gene sequence available in the expressed sequence transcript databases from National Institute of Agronomic Research (26). Primers were chosen overlapping an intron when possible using Primer3 software (27). Relative quantification of the target gene transcript (atrogin1) with a chosen reference gene transcript (18S ribosomal RNA) was made following the Pfaffl method with the Relative Expression Software tool (28,29). We ensured that 18S ribosomal RNA did not vary during starvation and refeeding before using it as a reference transcript.

    Assay of proteasome activity in vitro. Proteins from rainbow trout white muscles were homogenized in ice-cold buffer (pH 7.5) containing 50 mmol/L Tris, 250 mmol/L sucrose, 10 mmol/L ATP, 5 mmol/L MgCl2, 1 mmol/L dithiothreitol, and protease inhibitors (10 mg/L of antipain, aprotinin, leupeptin, and pepstatin A, and 20 µmol/L phenylmethylsulfonyl fluoride). The proteasomes were isolated by 3 sequential centrifugations as described previously (30,31). The final pellet was resuspended in buffer containing 50 mmol/L Tris (pH 7.5), 5 mmol/L MgCl2, and 20% glycerol. The protein content of the proteasome preparation was determined according to Bradford protein assay (32) using bovine serum albumin for the standard curve. Peptidase activities of the proteasome were determined at 37°C as described previously (33) by measuring the hydrolysis of the fluorogenic substrates succinyl-Leu-Leu-Val-Tyr-7-amido-4-methylcoumarin and Boc-Leu-Arg-Arg-7-amido-4-methylcoumarin (Sigma Chemical); these 2 substrates are preferentially hydrolyzed by the chymotrypsin-like and the trypsin-like activities of the proteasome, respectively (30,34). The release of the fluorogenic reagent methylcoumaryl-amide was determined at excitation and emission wavelengths of 360 nm and 430 nm, respectively.

    Western blot analysis. Protein homogenates from muscles were prepared as previously described (35). Protein concentrations were measured using the Bradford reagent method (32). Muscle lysates (40 µg of protein) were subjected to SDS-PAGE gel electrophoresis and Western blotting using an antibody specific for the phosphorylated form of PKB at Ser-473 (Cell Signaling Technology/Ozyme). Bands were revealed by enhanced chemiluminescence after the action of horseradish peroxidase-linked anti-rabbit {gamma}-globulin. Blots were then stripped and reprobed with an antibody recognizing total PKB (Cell Signaling Technology/Ozyme). The immunoblots were quantified by densitometry and the ratio phospho PKB:total PKB was determined.

The level of polyubiquitinated proteins in muscle was also monitored by Western blotting, using a specific antibody recognizing polyubiquitinated proteins (clone FK1 from Upstate/Chemicon Direct). Prior the immunoblotting, blots were stained with Ponceau Red and each line was quantified by densitometry to monitor the total amount of proteins.

    Statistical analysis. Results are expressed as means ± SEM. Significant differences between the weight of initial (d 0) and food-deprived fish were assessed using an unpaired 2-tailed Student's t test (Statview Software program, version 5; SAS Institute). For multiple comparisons, data were analyzed by 1-way ANOVA (Statview Software program, version 5; SAS Institute) to detect significant intergroup differences. The Newman-Keuls multiple-range test was used to compare means in case of a significant effect (P < 0.05). For PKB phosphorylation, the data were log transformed prior to statistical analysis.


    Results
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    PKB strongly responds to the feeding status in trout muscle. According to numerous previous studies, PKB is activated by phosphorylation within the carbo-terminus at Ser-473 (36). Here, we showed that the phosphorylation of PKB at Ser-473 was 13% of the initial value (d 0) after 7 d of food deprivation and 25% at 14 d (P < 0.05). This decrease was followed by a sharp increase 2 h after refeeding and PKB phosphorylation remained significantly higher than the phosphorylation level of unfed trout until 24 h after refeeding (Fig. 1).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 1  Effect of prolonged starvation and refeeding on the phosphorylation of PKB at Ser-473 in trout muscle. Representative immunoblots of 5 independent experiments showing the phosphorylated form of PKB at Ser-473 (upper panel) and the total forms of PKB (upper panel) in muscle of experimental fish. Bar graph shows the means of individual densitometric analysis of several immunoblots of PKB phosphorylation on Ser-473 in homogenates corrected for the total amount of PKB. Values are means ± SE; n = 5. Means without a common letter differ, P < 0.05 by the Student Newman-Keuls test.

 
    Atrogin1 expression similarly varies with the feeding status in trout muscle. The expression of atrogin1 displayed an opposite response by increasing >2-fold the initial value (d 0) after 14 d of food deprivation (P < 0.05) (Fig. 2A) and then significantly decreasing after 6 h of refeeding and remained lower than the level of unfed trout until 24 h after refeeding (Fig. 2B).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 2  Effect of prolonged starvation (A) and refeeding (B) on atrogin1 gene expression in trout muscle. Analysis by real time RT-PCR performed on total RNA extracted from white muscle of food-deprived and refed trout. The results were expressed as the atrogin-1 mRNA:18S ribosomal RNA ratio, n = 6. Means without a common letter differ, P < 0.05 by the Student Newman-Keuls test.

 
    Polyubiquitination rates are consistent with the atrogin1 expression data. We then studied the effect of starvation and refeeding on muscle polyubiquitination rates by using a specific antibody recognizing polyubiquitinated proteins. The level of polyubiquitinated proteins in muscle on d 14 of food deprivation rose to over 2 times the value on d 0 (P < 0.05) and decreased significantly at 12 h after refeeding (Fig. 3), suggesting a possible regulation of the ubiquitin–proteasome-dependent proteolysis by the nutritional state in fish as in other species.


Figure 3
View larger version (58K):
[in this window]
[in a new window]

 
FIGURE 3  Effect of prolonged food deprivation and refeeding on polyubiquitination rates in trout muscle. Representative immunoblot of 6 independent experiments showing the polyubiquitinated proteins in muscle of experimental fish. Bar graph shows the means of individual densitometric analysis of several immunoblots of polyubiquitinylated proteins in homogenates corrected for the total amount of proteins (Ponceau Red staining). Values shown are means ± SE, n = 6. Means without a common letter differ, P < 0.05 by the Student Newman-Keuls test.

 
    The feeding status has little effect on 20S proteasome activity in trout muscle. Because the chymotrypsin-like and trypsin-like activities are rate limiting in protein breakdown by proteasomes, we measured them in our trout muscle samples. Chymotrypsin-like activity did not change during both the starvation and the refeeding period (Fig. 4). However, 6 and 12 h after a meal, refed trout exhibited a significantly lower peptidase activity compared with that of fed fish (d 0), possibly due to a short anabolic drive after a long-term food deprivation. The trypsin-like activity did not change irrespective of the nutritional status of animals (data not shown). Taken together, our data suggest that in trout muscle, the feeding status has no major effect on the 2 main peptidase activities of the proteasome.


Figure 4
View larger version (9K):
[in this window]
[in a new window]

 
FIGURE 4  Chymotrypsin-like peptidase activities of the proteasome in white muscle of food-deprived and refed trout. Data represent the slopes of best fit of arbitrary fluorescence units released from the fluorogenic substrate succinyl-Leu-Leu-Val-Tyr-7-amido-4-methylcoumarin-methylcoumaryl-amide (chymotrypsin-like activity) vs. time. Values shown are means ± SE, n = 6. Means without a common letter differ, P < 0.05 by the Student Newman-Keuls test.

 

    Discussion
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
We report here for the first time, to our knowledge, the existence and the nutritional regulation of major steps controlling ubiquitin–proteasome-dependent muscle proteolysis in a fish species. Our results showed that 14 d of food deprivation reduced the phosphorylation of PKB and induced increased expression of atrogin1 in muscle, whereas refeeding lead to the opposite effects. In mammals and chickens, there is evidence that in situations of skeletal muscle loss, the downregulation of PKB signaling permits the transcription of atrogin1 and murf1 (20,22,37,38). More precisely, the dephosphorylation of PKB removes its inhibitory effect on Forkehead box-O transcription factor family of transcription factors, with the latter permitting to translocate from the cytosol to the nucleus and to induce the expression of several genes, including atrogin1 and murf1 (38,39,40). Here, we showed similar profiles for the phosphorylation of PKB and the expression of atrogin1, suggesting that the mechanisms involved in the regulation of this pathway are well conserved between lower and higher vertebrates.

Atrogin1 is not the only factor regulating the polyubiquitination of proteins directed toward 26S proteasome-mediated degradation. Therefore, we studied the effect of starvation and refeeding on muscle polyubiquitination as well as on the activity of major peptidases (chymotrypsin-like and trypsin-like) of the proteasome. Here, we showed that the level of polyubiquitinated proteins in muscle on d 14 of food deprivation increased to over 2 times the value on d 0 (P < 0.05) and decreased significantly at 12 h after refeeding (Fig. 3). Our results demonstrate that the polyubiquitination step exhibits, in rainbow trout, a regulation by the feeding status similar to the one observed in mammals. Moreover, these findings are in good agreement with previous data in mammals showing that 10 h of refeeding is required to decrease the rate of ubiquitination of muscle proteins (41).

However, the nutritional conditions tested led to little, if any, changes of the activity of the major proteasomal peptidases (chymotrypsin-like and trypsin-like), in agreement with earlier data on rainbow trout under different conditions of muscle atrophy (7,42). In contrast, a very recent study has shown a slight but significant increase in 20S proteasome activity in the muscle of rainbow trout food deprived for 3 wk (43). These results suggest that the stress of food deprivation in the present study is not strong enough to affect the degradative capacity of the proteasome and that the basal level of peptide cleavage activity is sufficient to keep up with the amount of substrate being ubiquitinated and introduced into the proteasome. Interestingly, the decline in muscle mass observed in aged rats is similarly accompanied by an increased level of ubiquitin conjugates and atrogin1 expression, whereas the functionality of the proteasome (monitored by the measure of proteasomal peptidases activities) remains constant compared with young rats (44). These findings support protein polyubiquitination as a limiting step of the ubiquitin–proteasome-dependent proteolysis in some conditions affecting muscle mass.

In conclusion, data presented here support the importance of the ubiquitin-proteasome route in rainbow trout and suggest its involvement in controlling protein degradation. From a practical aquaculture point of view, detailed knowledge of protein degradation in fish is of particular importance, because it plays a major role in regulating protein growth (45). Further studies are warranted to follow this specific pathway as affected by nutritional factors. Other key elements such as the atrophy-related ubiquitin ligase murf1 are also worth investigation.


    ACKNOWLEDGMENTS
 
We thank F. Sandres, F. Terrier, and Y. Hontang for their assistance during the growth trials in the experimental fish farms. We also thank M.J Borthaire and M. Sallaber for their technical assistance.


    FOOTNOTES
 
1 Author disclosures: I. Seiliez, S. Panserat, S. Skiba-Cassy, A. Fricot, C. Vachot, S. Kaushik, and S. Tesseraud, no conflicts of interest. Back

Manuscript received 4 October 2007. Initial review completed 1 November 2007. Revision accepted 10 December 2007.


    LITERATURE CITED
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Hershko A, Ciechanover A, Varshavsky A. Basic medical research award. The ubiquitin system. Nat Med. 2000;6:1073–81.[Medline]

2. Attaix D, Taillandier D. The critical role of the ubiquitin-proteasome pathway in muscle wasting in comparison to lysosomal and Ca2+-dependent systems. In: Bittar EE, Rivett AJ, editors. Advances in molecular and cell biology. Stamford (CT): JAI Press; 1998. p. 235–66.

3. Lecker SH, Solomon V, Mitch WE, Goldberg AL. Muscle protein breakdown and the critical role of the ubiquitin-proteasome pathway in normal and disease states. J Nutr. 1999;129:S227–37.[Free Full Text]

4. Kumamoto T, Fujimoto S, Ito T, Horinouchi H, Ueyama H, Tsuda T. Proteasome expression in the skeletal muscles of patients with muscular dystrophy. Acta Neuropathol (Berl). 2000;100:595–602.[Medline]

5. Jagoe RT, Goldberg AL. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr Opin Clin Nutr Metab Care. 2001;4:183–90.[Medline]

6. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, Goldberg AL. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J. 2004;18:39–51.[Abstract/Free Full Text]

7. Martin SA, Blaney S, Bowman AS, Houlihan DF. Ubiquitin-proteasome-dependent proteolysis in rainbow trout (Oncorhynchus mykiss): effect of food deprivation. Pflugers Arch. 2002;445:257–66.[Medline]

8. Salem M, Kenney PB, Rexroad CE III, Yao J. Microarray gene expression analysis in atrophying rainbow trout muscle: a unique nonmammalian muscle degradation model. Physiol Genomics. 2006;28:33–45.[Abstract/Free Full Text]

9. Mommsen TP. Salmon spawning migration and muscle protein metabolism: the August Krogh principle at work. Comp Biochem Physiol B Biochem Mol Biol. 2004;139:383–400.[Medline]

10. Ciechanover A. The ubiquitin-proteasome proteolytic pathway. Cell. 1994;79:13–21.[Medline]

11. Goldberg AL. Functions of the proteasome: the lysis at the end of the tunnel. Science. 1995;268:522–3.[Free Full Text]

12. Kornitzer D, Ciechanover A. Modes of regulation of ubiquitin-mediated protein degradation. J Cell Physiol. 2000;182:1–11.[Medline]

13. Voges D, Zwickl P, Baumeister W. The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu Rev Biochem. 1999;68:1015–68.[Medline]

14. Attaix D, Combaret L, Pouch MN, Taillandier D. Regulation of proteolysis. Curr Opin Clin Nutr Metab Care. 2001;4:45–9.[Medline]

15. Pickart CM. Mechanisms underlying ubiquitination. Annu Rev Biochem. 2001;70:503–33.[Medline]

16. Attaix D, Ventadour S, Codran A, Bechet D, Taillandier D, Combaret L. The ubiquitin-proteasome system and skeletal muscle wasting. Essays Biochem. 2005;41:173–86.[Medline]

17. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro FJ, Na E, et al. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science. 2001;294:1704–8.[Abstract/Free Full Text]

18. Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci USA. 2001;98:14440–5.[Abstract/Free Full Text]

19. Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R, Zlotchenko E, Scrimgeour A, Lawrence JC, et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol. 2001;3:1014–9.[Medline]

20. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, et al. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell. 2004;117:399–412.[Medline]

21. Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL. IGF-I stimulates muscle growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. Am J Physiol Endocrinol Metab. 2004;287:E591–601.[Abstract/Free Full Text]

22. Latres E, Amini AR, Amini AA, Griffiths J, Martin FJ, Wei Y, Lin HC, Yancopoulos GD, Glass DJ. Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-induced genes via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway. J Biol Chem. 2005;280:2737–44.[Abstract/Free Full Text]

23. Tesseraud S, Metayer-Coustard S, Boussaid S, Crochet S, Audouin E, Derouet M, Seiliez I. Insulin and amino acid availability regulate atrogin-1 in avian QT6 cells. Biochem Biophys Res Commun. 2007;357:181–6.[Medline]

24. Castillo J, Ammendrup-Johnsen I, Codina M, Navarro I, Gutierrez J. IGF-I and insulin receptor signal transduction in trout muscle cells. Am J Physiol Regul Integr Comp Physiol. 2006;290:R1683–90.[Abstract/Free Full Text]

25. Pozios KC, Ding J, Degger B, Upton Z, Duan C. IGFs stimulate zebrafish cell proliferation by activating MAP kinase and PI3-kinase-signaling pathways. Am J Physiol Regul Integr Comp Physiol. 2001;280:R1230–9.[Abstract/Free Full Text]

26. SIGENAE. Information System of AGENAE (Analysis of Breeding Animals' Genome) INRA national program. 2007. Available from: http://www.sigenae.org/

27. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa: Humana Press; 2000. p. 365–386. Available from: http://frodo.wi.mit.edu/.

28. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45.[Abstract/Free Full Text]

29. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30:e36.[Abstract/Free Full Text]

30. Hobler SC, Williams A, Fischer D, Wang JJ, Sun X, Fischer JE, Monaco JJ, Hasselgren PO. Activity and expression of the 20S proteasome are increased in skeletal muscle during sepsis. Am J Physiol. 1999;277:R434–40.[Medline]

31. Fang CH, Li BG, Fischer DR, Wang JJ, Runnels HA, Monaco JJ, Hasselgren PO. Burn injury upregulates the activity and gene expression of the 20 S proteasome in rat skeletal muscle. Clin Sci (Lond). 2000;99:181–7.[Medline]

32. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.[Medline]

33. Combaret L, Dardevet D, Rieu I, Pouch MN, Bechet D, Taillandier D, Grizard J, Attaix D. A leucine-supplemented diet restores the defective postprandial inhibition of proteasome-dependent proteolysis in aged rat skeletal muscle. J Physiol. 2005;569:489–99.[Abstract/Free Full Text]

34. Craiu A, Gaczynska M, Akopian T, Gramm CF, Fenteany G, Goldberg AL, Rock KL. Lactacystin and clasto-lactacystin beta-lactone modify multiple proteasome beta-subunits and inhibit intracellular protein degradation and major histocompatibility complex class I antigen presentation. J Biol Chem. 1997;272:13437–45.[Abstract/Free Full Text]

35. Dupont J, Derouet M, Simon J, Taouis M. Nutritional state regulates insulin receptor and IRS-1 phosphorylation and expression in chicken. Am J Physiol. 1998;274:E309–16.[Medline]

36. Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol. 1997;7:261–9.[Medline]

37. Nakashima K, Yakabe Y, Yamazaki M, Abe H. Effects of fasting and refeeding on expression of atrogin-1 and Akt/FOXO signaling pathway in skeletal muscle of chicks. Biosci Biotechnol Biochem. 2006;70:2775–8.[Medline]

38. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14:395–403.[Medline]

39. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, et al. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999;96:857–68.[Medline]

40. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, Sellers WR. A novel mechanism of gene regulation and tumor suppression by the transcription factor FKHR. Cancer Cell. 2002;2:81–91.[Medline]

41. Kee AJ, Combaret L, Tilignac T, Souweine B, Aurousseau E, Dalle M, Taillandier D, Attaix D. Ubiquitin-proteasome-dependent muscle proteolysis responds slowly to insulin release and refeeding in starved rats. J Physiol. 2003;546:765–76.[Abstract/Free Full Text]

42. Salem M, Nath J, Rexroad CE, Killefer J, Yao J. Identification and molecular characterization of the rainbow trout calpains (Capn1 and Capn2): their expression in muscle wasting during starvation. Comp Biochem Physiol B Biochem Mol Biol. 2005;140:63–71.[Medline]

43. Salem M, Silverstein J, Rexroad CE III, Yao J. Effect of starvation on global gene expression and proteolysis in rainbow trout (Oncorhynchus mykiss). BMC Genomics. 2007;8:328.[Medline]

44. Clavel S, Coldefy AS, Kurkdjian E, Salles J, Margaritis I, Derijard B. Atrophy-related ubiquitin ligases, atrogin-1 and MuRF1 are up-regulated in aged rat tibialis anterior muscle. Mech Ageing Dev. 2006;127:794–801.[Medline]

45. Carter CG, Houlihan DF. Protein synthesis. In: Anderson P, Wright P, editors. Fish Physiology: Nitrogen Excretion. 20th vol. London: Academic Press; 2001. p. 31–75.




This article has been cited by other articles:


Home page
J. Nutr.Home page
S. Tesseraud, I. Bouvarel, A. Collin, E. Audouin, S. Crochet, I. Seiliez, and C. Leterrier
Daily Variations in Dietary Lysine Content Alter the Expression of Genes Related to Proteolysis in Chicken Pectoralis major Muscle
J. Nutr., January 1, 2009; 139(1): 38 - 43.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
E. Plagnes-Juan, M. Lansard, I. Seiliez, F. Medale, G. Corraze, S. Kaushik, S. Panserat, and S. Skiba-Cassy
Insulin regulates the expression of several metabolism-related genes in the liver and primary hepatocytes of rainbow trout (Oncorhynchus mykiss)
J. Exp. Biol., August 1, 2008; 211(15): 2510 - 2518.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seiliez, I.
Right arrow Articles by Tesseraud, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seiliez, I.
Right arrow Articles by Tesseraud, S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2008 by American Society for Nutrition