Journal of Nutrition LabDiet, Your World of Nutritional Answers

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chou, Y.-F.
Right arrow Articles by Huang, R.-F. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chou, Y.-F.
Right arrow Articles by Huang, R.-F. S.
© 2007 American Society for Nutrition J. Nutr. 137:2036-2042, September 2007


Biochemical, Molecular, and Genetic Mechanisms

Changes in Mitochondrial DNA Deletion, Content, and Biogenesis in Folate-Deficient Tissues of Young Rats Depend on Mitochondrial Folate and Oxidative DNA Injuries1–3,

Yi-Fang Chou, Chu-Ching Yu and Rwei-Fen S. Huang*

Department of Nutritional Science, Fu-Jen University, HsinChuang 242, Tapei, Taiwan, ROC

* To whom correspondence should be addressed. E-mail: 034825{at}mail.fju.edu.tw.


    ABSTRACT
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
We aimed to characterize folate-related changes in mitochondrial (mt) DNA of various tissues of young rats. Weaning Wistar rats were fed folate-deficient (FD) or folate-replete (control) diet for 2 or 4 wk. The mtDNA 4834-bp large deletion (mtDNA4834 deletion) and mtDNA content were analyzed by quantitative real-time PCR. Compared with pooled 2-wk and 4-wk control groups, 4-wk folate deprivation significantly increased the frequency of the mtDNA4834 deletion in pancreas, heart, brain, liver, and kidney and reduced mtDNA contents in brain, heart, and liver (P < 0.05). Decreased mt folate levels were correlated with increased mtDNA4834 deletion frequency in tissues from FD rats after 2 wk (r = –0.380, P = 0.001) and 4 wk FD (r = –0.275, P = 0.033) and with reduced mtDNA content after 4 wk (r = 0.513, P = 0.005). In liver of 4-wk FD rats, the accumulated mtDNA large deletions and decline in mtDNA accompanied increased expressions of messenger RNAs (mRNA) of factors that regulate mtDNA proliferation and transcription, including nuclear respiratory factor 1, mt transcriptional factor A, mt single-strand DNA-binding protein, and mt polymerase r. In parallel, expression of mRNA for nuclear-encoded cytochrome c oxidase subunits (CcOX) IV, V, cytochrome c, and mtDNA-encoded CcOX III increased significantly. This enhanced mt biogenesis in 4-wk FD liver coincided with an elevated ratio of 8 hydroxydeoxyguanosine (8-OHdG):deoxyguanosine (dG) (2.67 ± 1.41) relative to the controls (0.99 ± 0.36; P = 0.0002). The 8-OHdG:dG levels in FD liver were correlated with liver mt folate (r = –0.819, P < 0.001), mtDNA deletions (r = 0.580, P = 0.001), and mtDNA contents (r = –0.395, P = 0.045). Thus, folate deprivation induced aberrant changes of mtDNA4834 deletion and mtDNA content in a manner that was dependent on mt folate and oxidative DNA injuries. The folate-related mt biogenesis provides a molecular mechanism to compensate mtDNA impairment in FD tissues.



    Introduction
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Human mitochondrial (mt)4 DNA is a double-stranded, circular, 16.5-kb molecule containing genes necessary for the synthesis of the catalytic components of oxidative phosphorylation. Due to the absence of histones, inefficiencies in the DNA repair system, and the proximity to the electron transfer chain with its release of reactive oxygen species (ROS) (1), mtDNA is vulnerable to free radical attack, with a high mutation rate relative to nuclear DNA (2). Among various types of mtDNA mutations, large-scale deletions of mtDNA, a 4977-bp deletion in humans and a 4834-bp deletion (mtDNA4834 deletion) in rodents, are commonly found to accumulate in aging tissues (35) and in tissues of patients with mt myopathies (6), Kearns-Sayre syndrome (7), and progressive external ophthalmoplegia (8). Accumulation of large mtDNA deletions beyond a certain threshold may involve the altered synthesis of mt proteins, respiratory chain abnormalities, and the production of free radicals (9,10). mtDNA defects and dysfunctions have been implicated in several human diseases, such as liver cirrhosis (11), and in tumor progression and aggressiveness (12,13).

Although the exact causes of the accumulation of mtDNA large deletions remain elusive, oxidative stress may relate to altered mtDNA genome integrity (14). Sublethal redox stress may result in a dramatic loss of mtDNA molecules or in deletions or loss of function by base modification in the mtDNA (15,16). The smaller size of partially deleted molecules could have a replicative advantage, which may lead to the accumulation of mtDNA large deletions in aging tissues (17,18). This increased mtDNA proliferation requires regulated nuclear gene expression. The mt transcriptional factor A (TFAM) is one of the nuclear-encoded regulators of mtDNA replication and transcription (19). TFAM expression is coordinated and regulated by a specific set of transcription factors such as the nuclear respiratory factor (NRF)-1 and NRF-2 (20). Mt single-strand DNA-binding protein and mt polymerase r are 2 other proteins crucial for mtDNA replication, repair, and recombination (21). Redox stress can activate NRF to induce production of TFAM (22). mtDNA biogenesis is then promoted, as evidenced by increased mtDNA copy number in rat liver (23), rat hippocampus (24), and senescent cells or aging tissues (2528). Under oxidative stress, both nuclear and mt gene expressions work in concert to regulate mtDNA biogenesis so as to compensate for defective mtDNA.

Our previous study showed that folate deprivation promoted oxidative injuries in liver mitochondria, including elevated protein carbonyl levels, accumulation of mtDNA large deletions, and superoxide overproduction (29). Rats given folic acid supplementation had fewer mtDNA4834 deletions in hepatic tissue upon chemotherapeutic drug treatments (30) or in aging liver tissues (31). As growing evidence supports folate's role as an antioxidant (32,33), the physiological consequences of dietary folate deprivation for oxidative stress (34) suggest that deprivation may also lead to accumulation of mtDNA deletions in other tissues. Little, however, is known about the impact of folate deprivation on genetic modifications of mitochondria in various tissues of young rats. This study aimed to characterize changes in the mtDNA4834 deletion and mtDNA contents in 5 tissues of young rats during dietary folate deprivation. In light of the fact that low folate intake leads to elevated homocysteine (Hcy) concentrations in humans (35) and animals (34), plasma Hcy levels of rats were measured to indicate functional folate deficiency. We tested the hypothesis that folate deprivation-induced mtDNA changes are linked to subcellular folate levels, oxidative stress, and the expression of factors responsive to mt biogenesis.


    Materials and Methods
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Animals and experimental diets. An L-amino acid–defined folate-deficient (FD) diet with 1% succinylsulfothiazole was specially formulated by Harlan Teklad. Because the use of antibiotics in all diets may reduce the absorption of gut folate, the basal FD diet supplemented with 8 mg folic acid/kg was designated the control diet (34,36). After a 3-d acclimation period during which male weaning Wistar rats (n = 24) were fed a nonpurified diet, they were randomly assigned to the FD or control diet using a pair-fed model as previously described (34). After a 2- or 4-wk feeding period, 6 rats, aged 6–8 wk old, from each group were killed with diethyl ether to collect blood and tissues. Five tissues (heart, liver, kidney, pancreas, and brain) were quickly excised, immediately frozen in liquid nitrogen, and stored at –80°C until analysis. The experimental protocols were approved by the Institutional Animal Care Committee of Fu-Jen University.

    Preparation of cytosolic and mt fractions from various tissues of rats. Mitochondria were isolated from various tissues of rats by conventional differential centrifugation in buffer containing 250 mmol/L sucrose, 5 mmol/L Tris-HCl (pH 7.4), and 1 mmol/L EGTA (37). Briefly, tissue homogenates were prepared in this buffer by using a Potter-Elvehjem-type homogenizer. The homogenate was centrifuged twice at 5000 x g; 10 min at 4°C and the mitochondria were then pelleted by centrifugation at 20,000 x g; 20 min. The purity was determined by measuring the relative specific activities of glutamate dehydrogenase in the supernatant (cytosolic fraction) and mt pellet, as described previously (37). Yields of mt fractions, as reflected by protein content (38), were similar in each experimental group.

    Folate and Hcy assay. Blood and tissue samples for folate analysis were prepared according to Varela-Moreiras and Selhub (39). After incubation of the thawed sample extracts with chicken pancreas conjugase (v:v 4:1) at 37°C for 6 h, a microbiologic assay was performed using cryoprotected Lactobacillus casei in 96-well microtiter plates (40). Absorbance was detected at 600 nm in an MRX model ELISA reader (Dynatech Laboratories). Hcy concentrations in plasma samples were analyzed by fluorescence polarization immunoassay and an Abbott AxSYM system (Becton Dickinson).

    Analysis of mtDNA4834 in various rat tissues. The quantity of the mtDNA4834 deletion was determined by coamplifying the mtDNA displacement-loop (D-loop) and mtDNA4834 deletion in a real-time PCR assay. Primers for each were previously described by Branda et al. (30). The degree of mtDNA4834 deletion was quantified with a deletion probe [DYXL-5'-(12952) TCACTTTAATCGCCACATCCATAACTGCTGT (12982)-3' BHQ1] and mtDNA probe [6FAM (15795) 5'-TTGGTTCATCGTCCATACGTTCCCCTTA (15822)-3' BHQ1]. PCR amplification was carried out in a 20-µL reaction volume consisting of TaqMan Universal Master mix (4 µL), 200 nmol/L each mtDNA4834 deletion primer, 50 nmol/L each D-loop primer, and 100 nmol/L each mtDNA4834 deletion and D-loop probe primer. The cycling condition included an initial phase of 2 min at 50°C, 10 min at 95°C, then 40 cycles of 15 s at 95°C and 0.5 min at 72°C. The fluorescence spectra were monitored by the LightCycler Detection system with Sequence Detection software version 4 (LightCycler, Roche Diagnostics).

    Qualification of mtDNA4834 deletion by DNA sequencing. After the reaction, we separated the desired amplified DNA fragments by electrophoresis in a 2% agarose gel at 100 V for 40 min. The mtDNA bands were excised from the gel, placed on the filter of a Spin-X Centrifuge Tube filter (Costar), frozen at –20°C, and recovered by centrifugation (10,000 x g; 1 min). DNA sequencing was performed with a Big Dye Terminator Cycle Sequencing kit (Perkin Elmer) and an ABI 377 automated sequencer (Applied Biosystems).

    Quantification of mtDNA4834 deletion. The cycle at which a significant increase in normalized fluorescence was first detected was designated as the threshold cycle number (Ct). The ratio of mtDNA4834 deletion to mtDNA was calculated with {Delta}Ct (= mt Ct del – mt Ct D-loop); a smaller {Delta}Ct indicates more deletions. The relative expression (RE) indicates the factorial difference in deletions between the 2-wk FD, 4-wk FD, and pooled control groups. RE was calculated as 2{Delta}{Delta}Ct, where {Delta}{Delta}Ct = {Delta}Ct mtDNA deletion in FD group{Delta}Ct mtDNA deletion in the control.

    Analysis of relative amount of mtDNA content. The content of mtDNA (abundance) relative to nuclear genomic DNA was determined by coamplifying the mt D-loop and the nuclear-encoded ß-actin gene by real-time PCR assay. Primers for each were previously described by Branda et al. (30). The amount of ß-actin gene was quantified by a fluorescent probe [DYXL 5'-(3347) CGGTCGCCTTCACCG-TTCCAGTT (3325)-3' BHQ1]. PCR amplification and the cycling conditions were as described above. The fluorescence spectra were monitored by LightCycler (Roche Diagnostics). The ratio of mtDNA to genomic DNA content was calculated with {Delta}Ct (mt Ct D-loop – nuclear Ct ß-actin). A smaller {Delta}Ct indicates a less relative mtDNA content. RE indicates the factorial difference in mtDNA content between the 2-wk FD, 4-wk FD, and pooled control groups. RE was calculated as 2{Delta}{Delta}Ct, where {Delta}{Delta}Ct = {Delta}Ct mtDNA content in FD group{Delta}Ct mtDNA content in the control.

    mRNA expression levels. Total RNA was extracted with an RNAzol Bee-RNA isolation kit (Tel-Test). Briefly, 1 µg of each sample was reverse-transcribed using Moloney murine leukemia virus RT in a reaction buffer containing random hexamer primers, deoxyribonucleoside triphosphates, and the ribonuclease inhibitor RNasin (Clontech Laboratories). Gene transcripts were amplified using gene-specific primers (see Supplemental Table 1) and ß-actin was used to control for variation in efficiency of RNA extraction and reverse transcription. The cycling conditions included an initial phase of 2 min at 50°C, 10 min at 95°C, then 40 cycles of 10 s at 95°C, 0.5 min at 60°C, and 10 s at 72°C. Amplified cDNA was quantified using the QuantiTect SYBR Green PCR kit in a LightCycler (Roche Diagnostics).

    Analyses of 8-hydroxydeoxyguanosine levels. Total DNA was extracted and the 8-hydroxydeoxyguanosine (8-OHdG) levels were measured according to the method of Shigenaga et al. (41). An aliquot of 25 µg DNA was dissolved in 20 mmol/L sodium acetate/1 mmol/L deferoxamine mesylate, heated to 98°C for 10 min, and then cooled rapidly on ice. The DNA solution was treated with 20 units of DNase I in 25 µL of 0.1 mol/L MgCl2 and incubated at 37°C for 30 min. DNAs were hydrolyzed to nucleotides by further incubation with nuclease P1, sodium acetate (0.25 mol/L, pH 5.4), and 0.1 mol/L zinc sulfate at 37°C for 60 min. The resultant mixture was hydrolyzed to nucleosides by incubation with calf intestine alkaline phosphatase for 30 min at 37°C. A reverse-phase C18 HPLC column (4.6 mm x 150 cm, with a particle size of 5 µm; Waters Associates) was used to separate the nucleosides. The mobile phase of 50 mmol/L KH2PO4 buffer (pH 5.5) and 20% methanol was delivered at a flow rate of 0.8 mL/min. Pure deoxyguanosine (dG; Sigma Chemical) and 8-OHdG (Cayman Chemical) were used as standards. An HP 1100 series UV detector (Shimadzu SPD-M 10A) set at 254 nm was used to measure dG and an ECD detector (Shodex EC-1), with the electrode potential adjusted to 0.594 V, was used to detect 8-OHdG. The results are expressed as the ratio of 8-OHdG:dG.

    Statistical methods. Data are presented as means ± SD. Student's t test was used to compare animal growth and messenger RNA (mRNA) expression between the FD and the control group at 2 and 4 wk, and variables between each control group. Because plasma folate (250.5 ± 14.2 vs. 260.3 ± 20.8 nmol/L), RBC folate (585 ± 121 vs. 646 ± 187 nmol/L), Hcy levels (19.7 ± 3.0 vs. 20.4 ± 4.7 µmol/L), 8-OHdG ratio (0.92 ± 0.42 vs. 1.03 ± 0.29), and liver mtDNA deletions ({Delta}Ct = 3.67 ± 0.22 vs. 4.34 ± 0.59) in 2-wk and 4-wk control groups did not differ significantly, the 2 control groups were pooled. The effects of dietary folate deprivation with the pooled controls were analyzed by 1-way ANOVA and Duncan's multiple range test using the General Linear Model of SAS Institute. Unequal variances were first transformed using a logarithmic function. Pearson's correlation coefficient was used to measure the association among mtDNA damage, mtDNA biogenesis, and folate depletion variables in the controls and FD groups separately. Differences were considered significant at P < 0.05.


    Results
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Blood folate and Hcy levels. Rats in each group were fed a similar amount of food. Accumulated weight gains did not differ between the 4-wk control (300 ± 18 g) and 4-wk FD group (286 ± 16 g). Compared with the controls, plasma folate levels of rats decreased significantly after 2-wk FD feeding followed by a reduction in red blood cell folate and a corresponding elevation in plasma Hcy levels after 4-wk FD feeding (Fig. 1). The biochemical measurements indicated signs of functional folate deficit in rats fed the FD diet for 4 wk.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 1  Plasma and RBC folate and Hcy concentrations of controls, 2-wk, and 4-wk FD rats. Values are means ± SD, n = 12 for control group, n = 6 for each FD group. Means for a variable without a common letter differ, P < 0.05.

 
    Changes in subcellular folate levels during dietary folate deprivation. In liver, pancreas, and kidney, cytosolic and mt folate levels decreased in parallel after 2- and 4-wk folate deprivation compared with the controls (Table 1). In heart and brain, mt folate levels decreased before cytosolic folate levels (2 wk). In all tissues, 4-wk folate deprivation depleted mt folate levels and all cytosolic folate levels except in brain to <50% of the control values. Pancreas of FD rats after 4 wk had the most depleted mt folate pool, with 77% reduction of the control values.


View this table:
[in this window]
[in a new window]

 
TABLE 1 Folate levels in compartmental fractions isolated from 5 tissues of rats fed the control or FD diet for 2 or 4 wk1

 
    Detection and mapping of mtDNA4834 common deletion. Amplification of the sequence with the mtDNA4834 loss gave different Ct values between groups, suggesting different quantities of mtDNA4834 deletion in control and FD tissues (Supplemental Fig. 1A). To confirm the deleted mtDNA at the breakpoints of the mtDNA4834 deletion with 2 16-bp repeats that normally flank the wild-type mtDNA, we directly sequenced the PCR fragments. Sequence comparison with rodent mtDNA sequence data (42) showed that the deletion junction (bp 8103, bp 12937–12952) was present in PCR fragments amplified from FD rat liver and confirmed that the common deletion region was 4834 bp (Supplemental Fig. 1B).

    Changes in accumulation of mtDNA4834 deletion among FD tissues. By real-time PCR analysis, we found spontaneous or background mtDNA common deletions in tissues of the controls (Table 2). Compared with the controls, 2-wk folate deprivation significantly increased the frequency of the mtDNA4834 deletion in pancreas, heart, and liver. Further mtDNA deletions in those tissues were accumulated after 4-wk folate deprivation, with RE values of 2.3–5.2 (P < 0.05). mtDNA deletions did not change significantly in brain and kidney until 4 wk. Pancreas accumulated the mtDNA4834 deletion at the greatest rate among the measured tissues.


View this table:
[in this window]
[in a new window]

 
TABLE 2 Changes in the accumulation of mtDNA4834 deletions in 5 tissues of rats fed the control or FD diet for 2 or 4 wk1

 
    Changes in mtDNA content among FD tissues. Compared with the controls, 2-wk folate deprivation did not significantly alter mtDNA content of any tissues except pancreas (Table 3). Four-week folate deprivation significantly decreased mtDNA content in brain, heart, and liver. Among the measured tissues, brain had the highest reduction and kidney the lowest, with RE values of 0.2 and 0.8, respectively.


View this table:
[in this window]
[in a new window]

 
TABLE 3 Changes in relative mtDNA content in 5 tissues of rats fed control or FD diet for 2 or 4 wk1

 
    Correlations between folate status, mtDNA4834 deletion, and mtDNA content of rat tissues. Relationships between subcellular folate status and mtDNA alterations were analyzed (Table 4). There was a lack of correlations in the controls. In FD groups, decreased mt folate levels were associated with increased mtDNA4834 deletions (after 2 wk, r = –0.380, P = 0.001; after 4 wk, r = –0.275, P = 0.033). Decreased mtDNA contents in FD rats after 4 wk were strongly associated with mt folate (r = 0.513, P = 0.005). There was a negative correlation between mtDNA content and accumulation of mtDNA4834 deletions after 2 wk (r = –0.504, P = 0.004) and 4 wk (r = –0.587, P = 0.001).


View this table:
[in this window]
[in a new window]

 
TABLE 4 Pearson's correlation coefficients of relationships between compartmental folate levels and alteration of mtDNA in 5 tissues of young rats fed control or FD diet1

 
    Effects of folate deprivation on expression of mRNA for factors involved in mt biogenesis and respiratory function. We postulated that FD-related mtDNA changes may be linked to factors involved in mt biogenesis and tested this hypothesis in rat liver. Four-week folate deprivation induced 30–60% higher expression of NRF-1, TFAM, mt single-strand DNA-binding protein, and mt polymerase r mRNA than the control (Fig. 2A). In parallel, expression of mRNA for nuclear-encoded cytochrome c oxidase subunits (CcOX IV, V) and cytochrome C (Cyt c) increased (Fig. 2B). mtDNA-encoded genes for respiratory subunits seemed to be differentially regulated. CcOX III mRNA expression was significantly elevated, whereas expressions of NADPH dehydrogenase subunit 1 and CcOX II mRNA did not alter significantly (Fig. 2B). Expressions of mRNA for factors involved in mtDNA biogenesis and respiratory function in 2-wk FD rat livers did not differ from the control (data not shown).


Figure 2
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 2  Effects of folate deprivation on expression of mRNA for regulatory factors involved in mtDNA biogenesis (A) and nuclear or mtDNA-encoded respiratory subunits (B) in livers of rats fed control or FD diet for 4 wk. Changes in the specific gene PCR products were corrected for the corresponding level of ß-actin in the sample. The data are expressed as a percentage of the control. Values are means ± SEM, n = 3 (means of duplicate samples). *Different from control, P < 0.05 (Student's t test).

 
    Effects of folate deprivation on oxidative DNA injuries in liver. To understand whether increased mtDNA biogenesis at the transcriptional level was linked to increased oxidative stress, we analyzed DNA oxidative injuries by HPLC (Supplemental Fig. 2). The level of oxidative DNA injury was calculated as the ratio of 8-OHdG to dG. The levels were 0.99 ± 0.36 in the control rat liver, 1.46 ± 0.08 in the FD rat liver after 2 wk, and 2.67 ± 1.41 in the FD rat liver after 4 wk. 8-OHdG levels in FD rat liver after 4 wk were 1.8 times those after 2 wk (P = 0.0135) and 2.7 times those in the control group (P = 0.0002). The increased 8-OHdG levels in liver tissue of FD rats after 2 and 4 wk were correlated with cytosolic folate (r = –0.834, P < 0.001), mt folate (r = –0.819, P < 0.001), mtDNA deletions (r = 0.580, P = 0.001), and mtDNA contents (r = –0.395, P = 0.045).


    Discussion
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Our study identified a substantial rise in the mtDNA4834 deletion in various tissues of young rats during dietary folate deprivation. This mtDNA large deletion in FD tissues was found to accumulate at levels 1.6–5.2 times those in control rats. Crott et al. (31) reported similar changes of mtDNA4834 deletion in liver of old rats at a difference of 3.2 times between FD- and folate-supplemented rats. The mtDNA4834 deletion in FD tissues of young rats increased the most in pancreas, heart, brain, and liver but increased only a little in kidney. This folate-related distribution of altered mtDNA4834 deletion levels in young rat tissues mimics the age-related pattern of deleted mtDNA accumulation in humans; the mtDNA4977 common deletion in aging human tissues is present at the highest levels in brain and heart and at a much lower level in kidney (3,4345). Reduced mtDNA copy numbers have been reported to occur with aging in rat liver and heart (46), whereas folate deprivation significantly depleted mtDNA content in rat brain, heart, and liver of young rats. Given the similarities in the deletion levels, accumulation pattern of mtDNA large deletions, and changes in mtDNA content between aging and FD tissues, our data therefore suggest an ability of dietary folate deprivation to accelerate mtDNA premature aging in tissues of young animals.

The exact cause of the increased mtDNA4834 deletion levels in FD tissues remains unknown. Several lines of evidence from this study indicate that mtDNA4834 deletion level in FD tissues is mt folate-dependent. First, the FD tissue with the most depleted mt folate content harbored the highest increase in mtDNA4834 deletions. Also, decreased mt folate levels were strongly correlated with increased frequency of mtDNA deletion among all measured tissues. This relationship was not found in tissues of the control rats. Reduced mt folate content resulted in mt oxidative injuries, including compromised antioxidant enzymatic activities, elevated protein carbonyl contents, and ROS production, as we have previously demonstrated in primary hepatocytes of FD rats after 4 wk (29). The elicited oxidative stress inside FD mitochondria could be attributable to mtDNA large deletions. This speculation is supported by the finding that sublethal redox stress such ROS production could lead to loss of mtDNA molecules or to deletions or a loss of function by base modification in the mtDNA (15,16). Similarly, tissues with high antioxidant capability in mitochondria essentially have a low level of mtDNA deletions (47). It has also been hypothesized that mtDNA large deletions could arise by slip-replication, in which replication is stalled by oxidative damage, allowing slipped mispairing between repeated sequences or by erroneous RNA splicing (48). Indeed, we found that the increased accumulation of the mtDNA4834 deletion in FD rat liver significantly correlated with increased 8-OHdG content, a biomarker of DNA oxidative injuries. Thus, our work and others' suggest that reduced mt folate content and elicited oxidative stress inside mitochondria contribute to the increased frequency of the mtDNA4834 deletion in FD tissues.

Our data demonstrate for the first time, to our knowledge, that mt biogenesis was enhanced during folate deficiency. In FD rat livers after 4 wk, the adaptive response occurred via the genetic regulation of factors for mt biogenesis (Fig. 2). NRF-1 is an oxidative-responsive transcriptional factor that binds to the promoter region of genes for proteins such as TFAM and cyt c (20,21) to trigger mt biogenesis. In 4-wk FD rat liver with elevated oxidative DNA damage, expression of NRF-1 mRNA was significantly induced. The NRF-1 induction coincided with upregulation of NRF-1 target genes, Cyt c, and TFAM (Fig. 2). In parallel, expression of mRNA for nuclear-encoded and mt-encoded respiratory subunits (CcOX IV, V, III, Cyt c) increased. This finding was consistent with reports that showed that oxidative stress caused via the stimulation of LPS (23), reactive oxygen (15), and elevated Hcy (49) could induce NRF and TFAM mRNA expression. It is likely that the enhanced mtDNA biogenesis at the transcriptional level in FD tissues was the consequence of mt oxidative injuries as a compensation to rescue the impaired tissues, a scenario previously reported in LPS-treated rat liver (23) and in senescent cells or aging tissues (2428). Several studies have shown in cardiac myocytes (15), human fibroblasts (27), leukocytes (28), and mouse brains (24) that the elevated oxidative stress was related to increased mtDNA damage and mtDNA biogenesis. On the other hand, triggered mt biogenesis may reciprocally facilitate propagation of mutated mtDNA already carried within the impaired tissues, particularly in growing cells (16,17). Certain mutant mtDNA molecules exhibit a replicative advantage and mitochondria that undergo replication appear to acquire DNA damage more readily (18). The enhanced mt biogenesis in 4-wk FD liver of young rats that are still growing and undergoing cell division may explain in part, if not all, the accumulation of mtDNA4834 deletion in FD tissues.

Although machinery of mt biogenesis for mtDNA proliferation and transcription was triggered during the 4-wk FD period, mtDNA content of FD tissues did not increase accordingly. This decline of mtDNA content significantly associated with decreased mt folate levels of FD tissues in general and with elevated 8-OHdG levels of FD liver in particular. The data suggested that elicited oxidative stress (29) and DNA oxidative injuries (this study) as a result of mt folate deficit may otherwise interfere with mtDNA replication. The mtDNA molecule contains the noncoding region of a unique D-loop that contains the leading strand origin of replication and the promoters of transcription (50). Mutations in this region might affect the rate of DNA replication by modifying the binding affinity of important trans-acting factors. The D-loop region is a "hot spot" for somatic mutations in human cancers (51). Frequent mutations in the D-loop region and decreased mtDNA contents were found in oxidative stress-associated human liver diseases such as hepatitis and hepatocellular carcinoma (52,53). Whether mt folate deficit and elevated DNA oxidative injuries may result in increased mutations of D-loop leading to reduced mtDNA contents warrants more studies.

In summary, this study demonstrates that the mtDNA4834 deletion is increasingly accumulated in various tissues of young rats during dietary folate deprivation. The corollary findings of elevated oxidative DNA injuries and enhanced mt biogenesis associated with this mtDNA large deletion apparently represent novel phenomena observed in FD tissues of young animals. mt Folate level was a significant predictor of increased accumulation of the mtDNA common deletion and decreased mtDNA content. The folate-related mt biogenesis depicts a molecular mechanism to compensate mtDNA impairment in folate-deficient tissues.


    ACKNOWLEDGMENTS
 
The authors are deeply grateful to Professor Y.-H. Wei, Department of Biochemistry, National Yang-Ming University, Taiwan, for his kind support and invaluable advice on mt DNA mutations.


    FOOTNOTES
 
1 Supported by grants from the National Science Council, Taiwan (NSC 94-2320-B-030-002 and NSC 95-2320-B-002 to R.F.S. Huang). Back

2 Author disclosures: Y.-F. Chou, C.-C. Yu, and R.-F. S. Huang, no conflicts of interest. Back

3 Supplemental Table 1 and Supplemental Figures 1 and 2 are available with the online posting of this paper at jn.nutrition.org. Back

4 Abbreviations used: CcOX, cytochrome c oxidase; Ct, threshold cycle number; Cyt c, cytochrome c; dG, deoxyguanosine; D-loop, displacement loop; 8-OHdG, 8-hydroxydeoxyguanosine; FD, folate deficient; Hcy, homocysteine; mRNA, messenger RNA; mt, mitochondrial; mtDNA4834 deletion, 4834-bp large deletion in mtDNA; NRF, nuclear respiratory factor; RE, relative expression; ROS, reactive oxygen species; TFAM, mitochondrial transcriptional factor A. Back

Manuscript received 13 June 2007. Initial review completed 13 June 2007. Revision accepted 3 July 2007.


    LITERATURE CITED
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Sawyer DE, Van Houten B. Repair of DNA damage in mitochondria. Mutat Res. 1999;434:161–76.[Medline]

2. Richter C, Park JW, Ames BN. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc Natl Acad Sci USA. 1988;85:6465–7.[Abstract/Free Full Text]

3. Cortopassi GA, Shibata DD, Soong NW, Arnheim N. A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci USA. 1992;89:7370–4.[Abstract/Free Full Text]

4. Cortopassi GA, Arnheim N. Detection of a specific mitochondrial DNA deletion in tissues of older humans. Nucleic Acids Res. 1990;18:6927–33.[Abstract/Free Full Text]

5. Wei YH. Mitochondrial DNA alterations as ageing-associated molecular events. Mutat Res. 1992;275:145–55.[Medline]

6. Holt IJ, Harding AE, Morgan-Hughes JA. Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature. 1988;331:717–9.[Medline]

7. Lestienne P, Ponsot G. Kearns-Sayre syndrome with muscle mitochondrial deletion. Lancet. 1988;1:885.[Medline]

8. Moraes CT, DiMauro S, Zeviani M, Lombes A, Shanske S, Miranda AF, Nakase H, Bonilla E, Werneck LC, et al. Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns-Sayre syndrome. N Engl J Med. 1989;320:1293–9.[Abstract]

9. Lezza AM, Boffoli D, Scacco S, Cantatore P, Gadaleta MN. Correlation between mitochondrial DNA 4977-bp deletion and respiratory chain enzyme activities in aging human skeletal muscles. Biochem Biophys Res Commun. 1994;205:772–9.[Medline]

10. Wei YH, Lee HC. Oxidative stress, mitochondrial DNA mutation, and impairment of antioxidant enzymes in aging. Exp Biol Med (Maywood). 2002;227:671–82.[Abstract/Free Full Text]

11. Yamamoto H, Tanaka M, Katayama M, Obayashi T, Nimura Y, Ozawa T. Significant existence of deleted mitochondrial DNA in cirrhotic liver surrounding hepatic tumor. Biochem Biophys Res Commun. 1992;182:913–20.[Medline]

12. Amuthan G, Biswas G, Zhang SY, Klein-Szanto A, Vijayasarathy C, Avadhani NG. Mitochondria-to-nucleus stress signaling induces phenotypic changes, tumor progression and cell invasion. EMBO J. 2001;20:1910–20.[Medline]

13. Chinnery PF, Samuels DC, Elson J, Turnbull DM. Accumulation of mitochondrial DNA mutations in ageing, cancer, and mitochondrial disease: is there a common mechanism? Lancet. 2002;360:1323–5.[Medline]

14. Raha S, Robinson BH. Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem Sci. 2000;25:502–8.[Medline]

15. Suematsu N, Tsutsui H, Wen J, Kang D, Ikeuchi M, Ide T, Hayashidani S, Shiomi T, Kubota T, et al. Oxidative stress mediates tumor necrosis factor-alpha-induced mitochondrial DNA damage and dysfunction in cardiac myocytes. Circulation. 2003;107:1418–23.[Abstract/Free Full Text]

16. Suliman HB, Caraway MS, Velsor LW, Day BJ, Ghio AJ, Piantadosi CA. Rapid mtDNA deletion by oxidants in rat liver mitochondria after hemin exposure. Free Radic Biol Med. 2002;32:246–56.[Medline]

17. Elson JL, Samuels DC, Turnbull DM, Chinnery PF. Random intracellular drift explains the clonal expansion of mitochondrial DNA mutations with age. Am J Hum Genet. 2001;68:802–6.[Medline]

18. Diaz F, Bayona-Bafaluy MP, Rana M, Mora M, Hao H, Moraes CT. Human mitochondrial DNA with large deletions repopulates organelles faster than full-length genomes under relaxed copy number control. Nucleic Acids Res. 2002;30:4626–33.[Abstract/Free Full Text]

19. Ekstrand MI, Falkenberg M, Rantanen A, Park CB, Gaspari M, Hultenby K, Rustin P, Gustafsson CM, Larsson NG. Mitochondrial transcription factor A regulates mtDNA copy number in mammals. Hum Mol Genet. 2004;13:935–44.[Abstract/Free Full Text]

20. Virbasius JV, Scarpulla RC. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis. Proc Natl Acad Sci USA. 1994;91:1309–13.[Abstract/Free Full Text]

21. Scarpulla RC. Nuclear control of respiratory gene expression in mammalian cells. J Cell Biochem. 2006;97:673–83.[Medline]

22. Piantadosi CA, Suliman HB. Mitochondrial transcription factor A induction by redox activation of nuclear respiratory factor 1. J Biol Chem. 2006;281:324–33.[Abstract/Free Full Text]

23. Suliman HB, Carraway MS, Welty-Wolf KE, Whorton AR, Piantadosi CA. Lipopolysaccharide stimulates mitochondrial biogenesis via activation of nuclear respiratory factor-1. J Biol Chem. 2003;278:41510–8.[Abstract/Free Full Text]

24. Gutsaeva DR, Suliman HB, Carraway MS, Demchenko IT, Piantadosi CA. Oxygen-induced mitochondrial biogenesis in the rat hippocampus. Neuroscience. 2006;137:493–504.[Medline]

25. Pesce V, Cormio A, Fracasso F, Vecchiet J, Felzani G, Lezza AM, Cantatore P, Gadaleta MN. Age-related mitochondrial genotypic and phenotypic alterations in human skeletal muscle. Free Radic Biol Med. 2001;30:1223–33.[Medline]

26. Wei YH, Lee CF, Lee HC, Ma YS, Wang CW, Lu CY, Pang CY. Increases of mitochondrial mass and mitochondrial genome in association with enhanced oxidative stress in human cells harboring 4,977 bp-deleted mitochondrial DNA. Ann N Y Acad Sci. 2001;928:97–112.[Medline]

27. Lee HC, Yin PH, Chi CW, Wei YH. Increase in mitochondrial mass in human fibroblast under oxidative stress and replicative cell senescence. J Biomed Sci. 2002;9:517–26.[Medline]

28. Liu CS, Tsai CS, Kuo CL, Chen HW, Lii CK, Ma YS, Wei YH. Oxidative stress-related alterations of the copy number of mitochondrial DNA in human leukocytes. Free Radic Res. 2003;37:1307–17.[Medline]

29. Chang CM, Yu CC, Lu HT, Chou YF, Huang RFS. Folate deprivation promotes mitochondrial oxidative decay: DNA large deletions, cytochrome c oxidase dysfunction, membrane depolarization and superoxide overproduction in rat liver. Br J Nutr. 2007;97:855–63.[Medline]

30. Branda RF, Brooks EM, Chen Z, Naud SJ, Nicklas JA. Dietary modulation of mitochondrial DNA deletions and copy number after chemotherapy in rats. Mutat Res. 2002;501:29–36.[Medline]

31. Crott JW, Choi SW, Branda RF, Mason JB. Accumulation of mitochondrial DNA deletions is age, tissue and folate-dependent in rats. Mutat Res. 2005;570:63–70.[Medline]

32. Joshi R, Adhikari S, Patro BS, Chattopadhyay S, Mukherjee T. Free radical scavenging behavior of folic acid: evidence for possible antioxidant activity. Free Radic Biol Med. 2001;30:1390–9.[Medline]

33. Rezk BM, Haenen GRMM, van der Vijgh WJF, Bast A. Tetrahydrofolate and 5-methyltetrahydrofolate are folates with high antioxidant activity. Identification of the antioxidant pharmacophore. FEBS Lett. 2003;555:601–5.[Medline]

34. Huang RFS, Hsu YC, Lin HL, Yang FL. Folate depletion and elevated plasma homocysteine promote oxidative stress in rat livers. J Nutr. 2001;131:33–8.[Abstract/Free Full Text]

35. Jacob RA, Gretz DM, Taylor PC, James SJ, Pogripny IP, Miller BJ, Henning SM, Swendseid ME. Moderate folate depletion increases plasma homocysteine and decreases lymphocyte DNA methylation in postmenopausal women. J Nutr. 1998;128:1204–12.[Abstract/Free Full Text]

36. Walzem RL, Clifford AJ. Folate deficiency in rats fed diets containing free amino acid or intact proteins. J Nutr. 1988;118:1089–96.[Abstract/Free Full Text]

37. Evans WH. Isolation and characterization of membranes and cell organelles. In: Rickwood D, editor. Preparative centrifugation: a practical approach. New York: Oxford University Press; 1992. p. 233–70.

38. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.[Medline]

39. Varela-Moreiras G, Selhub J. Long-term folate deficiency alters folate content and distribution differentially in rat tissues. J Nutr. 1992;122:986–91.[Abstract/Free Full Text]

40. Horne DW, Patterson D. Lactobacillus casei microbiological assay of folic acid derivatives in 96-well microtiter plates. Clin Chem. 1988;34:2357–9.[Abstract/Free Full Text]

41. Shigenaga MK, Aboujaoude EN, Chen Q, Ames BN. Assays of oxidative DNA damage biomarkers 8-oxo-2(-deoxyguanosine and 8-oxoguanine in nuclear DNA and biological fluids by high performance liquid chromatography with electrochemical detection. Methods Enzymol. 1994;234:16–33.[Medline]

42. The National Center for Biotechnology Information (NCBI) [database on the internet]. Saccone,C;[cited 2006 Jul 06]. Unique AC_000022.2. Available from: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=110189662.

43. Simonetti S, Chen X, Dimauro S, Schon EA. Accumulation of deletions in human mitochondrial DNA during normal aging analysis by quantitative PCR. Biochim Biophys Acta. 1992;1180:113–22.[Medline]

44. Lee HC, Pang CY, Hsu HS, Wei YH. Differential accumulations of 4,977 bp deletion in mitochondrial DNA of various tissues in human ageing. Biochim Biophys Acta. 1994;1226:37–43.[Medline]

45. Yowe DL, Ames BN. Quantitation of age-related mitochondrial DNA deletions in rat tissues shows that their pattern of accumulation differs from that of humans. Gene. 1998;209:23–30.[Medline]

46. Barazzoni R, Short KR, Sreekumaran NK. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart. J Biol Chem. 2000;275:3343–7.[Abstract/Free Full Text]

47. Ji LL, Dillon D, Wu E. Myocardial aging: antioxidant enzyme systems and related biochemical properties. Am J Physiol. 1991;261:R386–92.[Medline]

48. Madsen CS, Ghivizzani SC, Hauswirth WW. In vivo and in vitro evidence for slipped mispairing in mammalian mitochondria. Proc Natl Acad Sci USA. 1993;90:7671–5.[Abstract/Free Full Text]

49. Perez-de-Arce K, Foncea R, Leighton F. Reactive oxygen species mediates homocysteine-induced mitochondrial biogenesis in human endothelial cells: modulation by antioxidants. Biochem Biophys Res Commun. 2005;338:1103–9.[Medline]

50. Clayton DA. Replication of animal mitochondrial DNA. Cell. 1982;28:693–705.[Medline]

51. Sanchez-Cespedes M, Parrella P, Nomoto S, Cohen D, Xiao Y, Esteller M, Jeronimo C, Jordan RCK, Nicol T, et al. Identification of a mononucleotide repeat as a major target for mitochondrial DNA alterations in human tumors. Cancer Res. 2001;61:7015–9.[Abstract/Free Full Text]

52. Kubo S, Nishikawa M, Hirohashi K, Tanaka H, Shuto T, Tamori A, Kinoshita H, Inoue M, Nishiguchi S. Multicentric occurrence of hepatocellular carcinoma in patients with a somatic mutation of mitochondrial DNA and hepatitis C virus. Hepatol Res. 2003;25:78–82.[Medline]

53. Lee HC, Li SH, Lin JC, Wu CC, Yeh DC, Wei YH. Somatic mutations in the D-loop and decrease in the copy number of mitochondrial DNA in human hepatocellular carcinoma. Mutat Res. 2004;547:71–8.[Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chou, Y.-F.
Right arrow Articles by Huang, R.-F. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chou, Y.-F.
Right arrow Articles by Huang, R.-F. S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by American Society for Nutrition