Journal of Nutrition

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Shay, N. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Shay, N. F.
© 2007 American Society for Nutrition J. Nutr. 137:1705-1712, July 2007


Biochemical, Molecular, and Genetic Mechanisms

Human and Murine Hepatic Sterol-12-{alpha}-Hydroxylase and Other Xenobiotic Metabolism mRNA Are Upregulated by Soy Isoflavones1,2

Yilan Li3, Orsolya Mezei4 and Neil F. Shay5,*

Department of Biological Sciences, University of Notre Dame, Notre Dame, IN 46556

* To whom correspondence should be addressed. E-mail: neil.shay{at}kellogg.com.


    ABSTRACT
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
The transport and metabolism of xenobiotics is controlled by the drug transporters and drug-metabolizing enzymes in the liver and small intestine. Expression of these genes is 1 factor affecting the half-life of drugs and xenobiotics. Isoflavone-containing soyfood products and supplements are promoted to treat several different health conditions, including improvement of blood lipid profiles. Because relatively high isoflavone intake may be possible via use of supplements, we tested the hypothesis that isoflavones regulate the expression of genes critical to drug transport and metabolism. Using a gene array screening method, 2 drug transporters, Multidrug restistant-1 and Multidrug-related protein-2; 3 phase I enzymes, cytochrome 1A1, 3A4, and 8B1; and 2 phase II enzymes, carbohydrate sulfotransferase-5 and glutathione-sulfotransferase-2, were upregulated 3-fold or more of the initial expression levels in primary human hepatocytes exposed to soy isoflavones for 48 h. Isoflavone-related induction of 12-{alpha}-hydroxylase (CYP8B1) was further studied in other in vitro and murine in vivo models. Transfection studies suggest that isoflavones may act as a weak activating ligand for hepatocyte nuclear factor 4{alpha}, which in turn may activate the transcription of CYP8B1. The action of soy isoflavones on CYP8B1 may increase the conversion of cholesterol into bile acids and enhance synthesis of cholic acid. These isoflavone-induced changes in gene expression may help explain how isoflavones modulate cholesterol metabolism.



    Introduction
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Atherosclerotic coronary heart disease is influenced by many risk factors, most notably serum cholesterol concentrations. In mammals, ~50% of hepatic cholesterol is converted into bile acids. This process is important for the removal of cholesterol from the body (1). Bile acids serve to emulsify dietary fat; ~95% of luminal bile experiences enterohepatic circulation, a highly regulated and efficient process. The impairment of this pathway may result in severe hepatic disease (2).

Hepatic drug and xenobiotic metabolism involves a coordinated response by phase I and II metabolizing enzymes and phase III transporters (3). Phase I hydroxylase enzymes are members of the cytochrome P450 (CYP)6 superfamily, including the CYP1, CYP2, and CYP3 subfamilies. After phase I hydroxylation, phase II enzyme action involves conjugation of substrate with hydrophilic groups. This conjugation allows for excretion of conjugates into bile or urine. Phase III drug transporters modulate the absorption, distribution, and excretion of drugs by the liver and intestine and regulate cellular concentrations of bile acids, xenobiotics, and drugs (4). Drug transporters may transport drugs, xenobiotics, and other lipids against the concentration gradient, utilizing the energy of ATP hydrolysis (5). The expression or activity of drug-metabolizing enzymes (DME) and transporters is subject to considerable polymorphic differences that complicate assessment of therapeutic treatments (68).

Enzymes from some CYP families play important roles in bile acid metabolism. Three members, CYP7A1, 8B1, and 27A1, are key enzymes for the bile acid biosynthetic pathway (911). There are 2 important bile acid synthesis pathways; the classic and acidic pathways. Action of both pathways explains the existence of multiple bile acid metabolites in human plasma (12).

DME and transporters are directly or indirectly regulated by the coordinated action of multiple nuclear receptors (13,14). The expression of different genes encoding enzymes of a common pathway may be coordinately controlled by similar transcription factors and cofactors (15). The action of 12-{alpha}-hydroxylase (CYP8B1) favors production of the more hydrophilic cholic acid (CA) over chenodeoxycholic acid (CDCA). Thus, the activity of CYP8B1 influences both the ratio of CA to CDCA and hydrophilicity of the bile acid pool (16). Multiple transcription factor binding sites have been identified on the promoter of CYP8B1 and peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}), {alpha}-fetoprotein transcription factor (FTF), and hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) may regulate CYP8B1 at overlapping response element sites (1719). In addition, downregulation of CYP8B1 by sterols in an animal model has been attributed to sterol regulatory element binding proteins (20). Expression of CYP7A1, 27A1, and 8B1 is subject to inhibition by cholesterol, bile acids, and insulin; this inhibition may be due to the activation of small heterodimer partner (SHP), a universal repressor, by ligand-bound farnesoid x receptor (11).

Soy contains protein, lipids, fiber, and phytochemicals, such as isoflavones (21); although currently a matter of debate, in some studies, soy isoflavone intake has been associated with decreased blood cholesterol levels and improved blood lipoprotein profiles (2224). Soy isoflavones may exert at least part of their lipid-regulating effect by modifying the activity of some lipid-regulating transcription factors, as shown by us and others (2527). The regulation of DME and drug transporters by a variety of endogenous and exogenous compounds has been widely described and isoflavones have been shown as potential nuclear receptor ligands, thereby regulating expression of DME (2830) and drug transporters (31,32).

To test the hypothesis that soy isoflavones induce the expression of hepatic CYP, the goal of this study was to identify human hepatic messenger RNA (mRNA) of xenobiotic metabolism that are regulated by soy isoflavones.


    Materials and Methods
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Materials. Genistein, daidzein, and equol were purchased from Indofine Chemical Company. Dimethyl sulfoxide was purchased from Fisher Scientific and 24-cell culture plates were obtained from Corning. The Human Drug Metabolism Gene Array (catalogue no. HS-011) was from Superarray Company. Human CYP8B1 reporter plasmid [phCYP8B1–514/+300luciferase (Luc)] was generously provided by Dr. John Y.L. Chiang (Northeastern Ohio University, Ohio). The human SHP expression plasmid (CDM8-hSHP), human FTF (pc1-hFTF), and rat HNF4{alpha} (pcDNA1-rHNF4{alpha}) were kindly donated by Dr. David Moore (Baylor College of Medicine, Houston, Texas). HNF4{alpha} is a highly conserved nuclear receptor in species from insect to human and the rat and human HNF4{alpha} expression plasmids do not differ (33).

    Primary human hepatocytes. Primary human hepatocytes were obtained through the Liver Tissue Procurement and Distribution System, Pittsburgh, PA (funded by NIH contract no. N01-DK-9-2310). Use of these cells was approved by the Institutional Review Board of the University of Notre Dame. Cells were cultured in serum-free Williams' E medium supplemented with 100 nmol/L dexamethasone and insulin-transferrin-selenium (ITS-G; Invitrogen). At 48 h after isolation, hepatocytes were treated with dimethyl sulfoxide + ethanol (D+E) as vehicle [0.1% (v:v)] or with the isoflavones genistein and daidzein at 40 µmol/L. In preliminary tests, equol was found to be a potent inducer of several CYP mRNA and 10 µmol/L provided a robust cellular response. Further, equol at 40 µmol/L apparently reduced cell viability whereas genistein and daidzein did not. Thus, we screened at 10 µmol/L for equol and 40 µmol/L for genistein and daidzein. Although these screening concentrations are somewhat higher than in vivo serum concentrations of isoflavones, the concentrations were chosen to produce robust induction levels; candidate mRNA obtained from this screen could then be later evaluated at lower, more physiological concentrations. Cells were cultured for a further 48 h before total RNA isolation using TRI Reagent (Sigma) according to the manufacturer's instructions. The concentration of RNA was determined using the SmartSpec 3000 spectrophotometer (BioRad); integrity of RNA was confirmed by evaluating 18S and 28S ribosomal RNA (rRNA) after RNA gel electrophoresis.

    Mouse diet studies. To evaluate the contribution of PPAR{alpha} on CYP8B1 expression, PPAR{alpha}-null and matched wild-type (wt) mice from a 129/Sv background were obtained from the Jackson Laboratory; 64 -null and 72 wt mice were used in the study. The animal protocol was approved by the institutional review board of the University of Notre Dame. All the mice had free access to water and food (Purina rodent diet no. 5015) until 11 wk of age. At 12 wk of age, we randomly divided the null and wt mice into 1 of 4 diet groups for each sex, and mice consumed a high-fat diet for 6 wk. We evaluated male and female mice separately. The experimental diets were: soy protein containing essentially no isoflavones (S); soy protein containing 1.82 mg isoflavones (aglycone form)/g protein (S+I); S plus 0.2% fenofibrate (S+F); and S+I plus 0.2% fenofibrate (S+I+F). Experimental diets are as in Mezei et al. (34) (Table 1). On the last day of wk 6, mice were killed and total RNA from liver was isolated following GenElute mammalian total RNA miniprep kit (Sigma).


View this table:
[in this window]
[in a new window]

 
TABLE 1 Composition of experimental diets1

 
    Pathway-specific gene array. An ampolabeling-linear polymerase replication kit (Superarray) and biotin-16-dUTP (Roche) was used to measure relative mRNA levels for genes specific to drug and xenobiotic metabolism. The manufacturer-recommended protocol was followed. Total RNA (1.0 µg) from treated primary human hepatocytes was used; X-ray film (Fisher) was used to capture an image subsequently scanned using Quantity One software (BioRad) to convert images to numerical data. For each of 4 donors, hepatocytes were treated with control and 3 different isoflavones. RNA was isolated from cells, RT probes made, and 2 independent gene-specific biotin-labeled PCR probes were made. These 2 probes were hybridized separately to 2 different filters. Signals obtained from the 2 filters were quantitated separately, then means were calculated to produce 1 set of expression levels for a given donor and treatment. Thus, for each donor, a total of 8 hybridizations were completed for the 4 donors; we made a total of 32 probes and used 32 filters. ANOVA for relative mRNA expression was based on n = 4 (Table 2). Control values were set by definition to 100% and are not shown in Table 2.


View this table:
[in this window]
[in a new window]

 
TABLE 2 Relative expressions of selected hepatic mRNA of drug and xenobiotic metabolism in human hepatocytes exposed to soy isoflavones for 48 h1

 
    Northern analysis. Northern analysis was as described previously (29). Fifteen micrograms of total RNA from primary human hepatocytes was used for analysis. The relative density of hybridization signals was quantified using Quantity I system (BioRad) and the values of CYP8B1 were normalized with 18S.

    Plasmid construct for northern analysis. The forward primer for the CYP8B1 probe was 5'-CCTGTCCTTTGTAATGCGACGT-3' and the reverse primer was 5'- AGGGTTGAGGAAGCGATCGTA-3'. The RT-PCR product of the probe (795 bp) was cloned into the TOPO TA cloning vector for sequencing following the manufacturer protocol (Invitrogen) and the EcoRI-digested cDNA fragment from the plasmid was gel purified (Qiagen) and further used as probe.

    Real time PCR. Three micrograms of mouse liver total RNA was used to make first-strand cDNA with Maloney Murine Leukemia Virus (M-MLV) RT (Invitrogen) using random primers. RNA from every mouse was used to make independent cDNA samples. Real time PCR were performed with 1 µL cDNA using Sybr-green real time PCR Master mix (Applied Biosystems) in an ABI Prism 7700 sequence detector system (Applied Biosystems). The primers for mouse carnitine palmitoyltransferase 1{alpha} (Cpt1{alpha}) (catalogue no. PPM25930A) and CYP8B1 (catalogue no. PPH01265A) were from Superarray and the sequence of mouse 18S primers was FWD-5'AGTCCCTGCCCTTTGTACACA3' and REV-5'GATCCGAGGGCCTCACTAAAC3'. Cycle threshold was plotted as separate standard curves and the final values of Cpt1{alpha} or CYP8B1 were normalized to 18S rRNA abundance in each sample.

    HepG2 cell culture and transient transfections. Human hepatoma HepG2 cells (ATCC) were maintained in minimal essential medium (MEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Invitrogen). Cells were maintained at 37°C, 5% CO2, and 100% relative humidity. Transient transfections were performed on 24-well plates. On d 1, cells were plated in MEM plus 10% serum. Cell medium was changed to serum-free MEM and cells were transfected using Lipofectamine 2000 (Invitrogen) on d 2. For transfecting 2 plasmids [CYP8B1-Luc and ß-galactosidase (gal) plasmids], 0.5 µg of each plasmid was used; for transfecting 3, 4, or 5 plasmids simultaneously (FTF, HNF4{alpha}, PPAR{alpha}, CYP8B1-Luc, and ß-gal plasmids), 0.3 µg of each plasmid was added to each well. The ß-gal plasmid was used as an internal control for transfection efficiency. Six hours after transfection, cell medium was replaced by fresh MEM. Twenty-four hours after adding plasmids to the cells, cells were exposed to the experimental conditions. All of the isoflavone treatments were prepared in 1000x stock dissolved in D+E and the final concentration of D+E in cell treatment medium was 0.1% (v:v). After the appropriate treatment period, HepG2 cells were lysed with 1x Reporter lysis buffer (Promega) and assays for Luc (Promega) and ß-gal (Promega) expression were performed. ß-Gal activity was measured at 420 nm (Bio-Tek Instruments). Luc activity was determined with LMax II 384 luminometer (Molecular Devices) and the ratio of Luc to ß-gal calculated. All transfection studies were repeated at least twice and each individual test involved independent triplicate measurements.

    Statistical analysis. One-way ANOVA and the Newman-Keuls multiple comparison test were used in the analysis of gene array data. Murine gene expression and all transfection experiments were analyzed by 1- or 2-way ANOVA where appropriate, followed by the Newman-Keuls post hoc multiple comparison test when the F test was significant at P ≤ 0.05.


    Results
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Isoflavone regulation of human drug metabolism genes and further evaluation of CYP8B1 mRNA levels in primary human hepatocytes. To identify genes of the drug-metabolizing process regulated by soy isoflavones, we employed a focused gene array containing 96 genes of drug metabolism and transport. The quality of the array images were ensured by use of positive controls (GAPD and ß-actin) and negative controls (PUC18 and blanks) on every array used in the study (Fig. 1). Hepatocytes from 4 different donors, 3 men and 1 woman, were used. The mRNA of 2 drug transporters, Multi-drug restistant-1 (MDR1) and Multidrug-related protein-2 (MRP2); 3 phase I enzymes, CYP1A1, 3A4, 8B1; and 2 phase II enzymes, carbohydrate sulfotransferase-5 (CHST5) and glutathione-sulfotransferase-2 (GSTT2), were upregulated in human hepatocytes exposed to isoflavones (Table 2). We selected mRNA for further evaluation if their relative expression was 3.0-fold of control levels. Seven of the 96 mRNA were upregulated to this degree in at least 1 of 3 treatments; 4 of the 7 mRNA were expressed at greater levels for at least 1 of the 3 isoflavone treatments (P < 0.05). Despite vast inter-donor expression differences, including testing both sexes, the inductions of MRP2, CYP8B1, and GSTT2 mRNA by equol and of CHST5 by daidzein were significantly greater compared with the control. To further confirm the induction of CYP8B1 mRNA by isoflavones, we utilized northern analysis of hepatic RNA obtained from 3 additional male donors. The upregulation of CYP8B1 mRNA levels by isoflavones was confirmed in all 3 donors; a representative northern analysis is shown (Fig. 2). After comparing expression levels with the 18S rRNA control, the fold-induction measured by northern analysis was similar to the gene expression increases measured by gene array. Thus, CYP8B1 was induced (P < 0.05) in a set of mRNA obtained from 4 human donors; CYP8B1 mRNA levels were also induced by isoflavones in all 3 of the additional donors.


Figure 1
View larger version (141K):
[in this window]
[in a new window]

 
FIGURE 1  Representative images of drug metabolism gene arrays corresponding to primary human hepatocytes administered control and equol treatments. Primary human hepatocytes were treated with D+E [0.1% (v:v)] or 10 µmol/L equol for 48 h. Each array contains 96 different genes of drug metabolism (first 12 rows), negative controls (first 6 dots on row 13), and positive controls (last 2 dots on row 13 and 8 dots on the last row). Each treatment was duplicated for the hepatocytes from each donor and the results from 4 different donors were analyzed.

 

Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 2  Northern analysis of CYP8B1 gene expression in primary human hepatocytes treated for 48 h in 10 or 40 µmol/L genistein, daidzein, or equol. Total RNA was isolated from the hepatocytes and 20 µg RNA was used for analysis. Values are normalized to 18S rRNA expression and the ratio is shown between the 2 bands. Image shown is 1 representative image from 3 different trials.

 
CYP8B1 is reportedly regulated by PPAR{alpha}; the PPAR{alpha} agonist WY-14,643 induced CYP8B1 mRNA and changed bile acid composition in wt mice. The absence of induction by the positive controls in PPAR{alpha}-null mice indicated that the effect is through PPAR{alpha} (18). Following this work, we used wt and PPAR{alpha}-null mice to examine the in vivo effect of isoflavone consumption on CYP8B1 mRNA levels and to determine whether the upregulation of isoflavones on CYP8B1 is mediated by PPAR{alpha}. The Cpt1{alpha} gene encodes the transporter responsible for uptake of fatty acids into the mitochondria; expression of the CPT1{alpha} mRNA is known to be primarily regulated by PPAR{alpha} (35). As expected, we found CPT1{alpha} mRNA expression significantly increased in wt mice that had consumed fenofibrate, but this upregulation was completely abrogated in similarly fed PPAR{alpha}-null mice (34). CYP8B1 mRNA levels increased by intake of isoflavones in both female and male mice. In contrast to PPAR{alpha} regulation of CPT1{alpha} mRNA (18), consumption of PPAR{alpha} agonist fenofibrate did not affect the expression of CYP8B1 to any degree. Interestingly, intake of soy isoflavones plus fenofibrate did not increase CYP8B1 mRNA levels in females, whereas there was an obvious upregulation in males (Table 3). Surprisingly, intake of isoflavones in a high-fat diet dramatically increased CYP8B1 mRNA levels in both female and male PPAR{alpha}-null mice; consumption of the S+I+F diet significantly induced hepatic CYP8B1 mRNA levels in male but not in female mice (Table 3). The lack of PPAR{alpha} resulted in a nearly 20-fold increase of CYP8B1 mRNA caused by intake of isoflavones in females and a nearly 10-fold increase in male mice fed either the S+I or S+I+F diet. Thus, the presence of PPAR{alpha} attenuates isoflavone induction of CYP8B1 mRNA levels in 129/Sv mice fed a high-fat diet.


View this table:
[in this window]
[in a new window]

 
TABLE 3 CYP8B1 gene expression in wt and PPAR{alpha}-null 129/SV mice fed diets with or without isoflavones and fenofibrate1

 
    Isoflavones induce the transcription of CYP8B1 in a transfected cell model. The mechanism of human CYP8B1 transcription has been described previously and nucleotides –57 to 300 were important for the basal- and liver-specific gene transcription activities (17). To identify the transcriptional mechanism of isoflavones on CYP8B1, we used a human CYP8B1–514/+300/Luc construct in transient transfection experiments. Although HepG2 cells reportedly lack the expression of certain key liver-specific transcription factors (36), we first added different concentrations of isoflavones to HepG2 cells transfected with only the CYP8B1-Luc reporter and ß-gal plasmids. This step allowed examination of the effects of isoflavones on the basal transcription activity of the CYP8B1 proximal promoter without the expression of extra transcription regulators. After treatments lasting 48 h, the transcription of the CYP8B1 promoter was induced at similar modest levels by genistein, daidzein, and equol, but not by glycitein (Table 4). Genistein treatment significantly induced CYP8B1-Luc expression at 5 µmol/L, whereas daidzein and equol both significantly induced CYP8B1-Luc expression at concentrations as low as 1 µmol/L. The lack of an effect of glycitein on the target receptor gene expression in transfected cells has been reported previously (25,26). The specific lack of a dose-dependent response suggests that cofactors may be responsible for mediating a part of the isoflavone effect.


View this table:
[in this window]
[in a new window]

 
TABLE 4 Isoflavone upregulation of CYP8B1-directed Luc expression in HepG2 cells12

 
    Identification of transcription factors responsible for induction of CYP8B1 gene expression caused by isoflavones. We cotransfected HepG2 cells with expression plasmids encoding different transcription factors together with the CYP8B1/Luc reporter vector to identify regulatory factors that might mediate the induction of CYP8B1 by isoflavones. In cotransfections, PPAR{alpha} and FTF were only weak regulators (17). However, cotransfection of HNF4{alpha} robustly increased basal CYP8B1 promoter activity. The addition of FTF with HNF4{alpha} did not change the dominant constitutive activity of HNF4{alpha} on CYP8B1. However, SHP, a universal inhibitor for several receptor-signaling pathways, markedly downregulated the transactivation of CYP8B1 by HNF4{alpha} (Table 5).


View this table:
[in this window]
[in a new window]

 
TABLE 5 CYP8B1-directed Luc expression in HepG2 cells transfected with expression plasmids encoding transcription factors12

 
To examine the effect of isoflavones on CYP8B1 transcription activity with the expression of FTF, HNF4{alpha}, or PPAR{alpha}, we exposed transfected HepG2 cells to the same concentration of individual isoflavones tested previously. Under the same experimental conditions, all 4 isoflavones produced a modest induction of CYP8B1-driven Luc with cotransfection of human FTF (Table 6). CYP8B1 reporter activity in cells cotransfected with HNF4{alpha} was induced by isoflavones, especially genistein, daidzein, and glycitein, but not equol (Table 6). Not surprisingly, there was no induction on CYP8B1 by isoflavone treatments in cells transfected with PPAR{alpha} (Table 6). The inclusion of HNF4{alpha} dramatically upregulated the basal activity of CYP8B1; at least 3 different isoflavones induce the upregulation of CYP8B1 via HNF4{alpha} (Table 5).


View this table:
[in this window]
[in a new window]

 
TABLE 6 FTF and HNF4{alpha} mediate isoflavone upregulation of CYP8B1-directed Luc activity in HepG2 cells12

 
    The presence of PPAR{alpha} inhibits isoflavone upregulation of CYP8B1 in cotransfected HepG2 cells. The absence of PPAR{alpha} in PPAR{alpha}-null mice resulted in the dramatic induction of CYP8B1 mRNA in isoflavone-fed mice. This suggested that normal expression of PPAR{alpha} may have some inhibitory effect on the regulation of FTF and HNF4{alpha} on CYP8B1. To test this hypothesis, we cotransfected FTF and/or HNF4{alpha} with PPAR{alpha} in transient transfection experiments and examined the effect of the exposure to genistein and daidzein on CYP8B1 reporter expression. The presence of PPAR{alpha} prevented the induction of CYP8B1 by isoflavones. Interestingly, the presence of transfected FTF, HNF4{alpha}, and PPAR{alpha} dramatically decreased the basal activation of HNF4{alpha} on CYP8B1 (Table 7).


View this table:
[in this window]
[in a new window]

 
TABLE 7 CYP8B1-directed Luc expression in HepG2 cells cotransfected with PPAR{alpha}, FTF, and HNF4{alpha}12

 

    Discussion
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
There is a long history of the use of herbal or other natural ingredients to treat various disorders; soy isoflavones have been prominently advanced as a diet supplement as a "safe and natural" alternative to hormone replacement therapy (37), hyperlipidemia (38), and cancer prevention (39). However, there is distinct lack of information regarding the effects of isoflavone intake on the expression of genes of the drug metabolism pathway in the human liver.

We first screened the expression of 96 target genes in drug metabolism pathways using primary human hepatocytes exposed to different isoflavones. We chose to expose human hepatocytes to higher concentrations of isoflavones than would be generally expected in vivo, electing to utilize these higher concentrations to maximize the possibility that robust differences would be observed, at least for some of the 96 different mRNA. We further evaluated expression levels at different isoflavone concentrations, including lower concentrations close to those expected in vivo (0.1–~1 µmol/L). Our subsequent evaluation of CYP8B1 in this study illustrated the validity of this approach. It is worthy to note that despite the genetic, sex, and metabolic variability encountered because we used 4 different human donors for the gene screening project, we identified significant increases for 4 mRNA.

MDR1 is the best characterized MDR/ABC transporter and is universally expressed in most secretory cells. MRP2 is expressed exclusively in the canalicular (apical) membrane of the hepatocyte. Similar to other MDR, the substrates of MRP2 include some anticancer drugs; the overexpression of MDR and MRP proteins can confer drug resistance to cells (40,41). The induction of CYP1A1 and 3A4 in human hepatocytes exposed to isoflavones is similar to our prior findings that isoflavones upregulate the expression of CYP1A2 and 3A4 in transfected HepG2 cells and in primary human hepatocytes (data not shown). Two transferases, CHST5 and GSTT2, are phase II-conjugating enzymes whose mRNA were induced by isoflavones in our studies. Recent studies have demonstrated that the pregnane x receptor (PXR) and constitutive androstane receptor may bind with retinoid x receptor (RXR) as heterodimers to activate the transcription of MDR1 and MRP2 (42,43). Interestingly, studies of other phase II genes identify similar response elements in their promoter and enhancer regions and they are activated by multiple compounds via the aryl hydrocarbon receptor, constitutive androstane receptor, or PXR (44). We have found that isoflavones may serve as potential ligands for human aryl hydrocarbon receptor or PXR, binding to xenobiotic response elements to activate the transcription of CYP1A and 3A genes separately (data not shown). Therefore, it is not surprising to find that isoflavones may activate the transcription of other target genes through a similar pathway potentially mediated by PXR or other receptors.

The upregulation of CYP8B1 mRNA levels was observed in most of the donors used in the gene array study and in 3 additional donors evaluated via northern analysis (Fig. 2). The involvement of CYP8B1 in cholesterol and bile metabolism motivated us to study its regulation further. HepG2 cells and in vivo animal studies (Tables 3 and 4) suggest an interaction between dietary isoflavone levels and fenofibrate. Although with low dietary isoflavone intake the presence of fenofibrate did not affect 8B1 induction, the presence of fenofibrate significantly lowered 8B1 expression in 3 of the 4 cases when high levels of isoflavones were consumed (male and female in wt and knock-out (KO); Table 3). This interaction may be due to isoflavone activation of the PXR receptor. Inhibition of CYP7A1 gene expression by recirculated bile acids decreases the rate of conversion of cholesterol to bile acids and CDCA is the strongest inhibitor of CYP7A1 in all bile acids (45,46). When CYP8B1 is induced by isoflavones, there may be greater synthesis of the more hydrophilic CA rather than CDCA (Fig. 3A). If so, then during enterohepatic circulation, more of the hydrophilic, less inhibitory CA will be reabsorbed into hepatocytes, producing less transcriptional repression and greater activity of CYP7A1. This, in turn will lead to more bile acid synthesis and excretion into the intestine (Fig. 3A). This activation of CYP7A1 by isoflavones is consistent with other reports (47,48). Not surprisingly, the upregulation of CYP7A1 and 8B1 was associated with a decrease in plasma cholesterol levels in an animal study (49). From our study, the upregulation of CYP8B1 may help us explain at least in part a potential cholesterol-lowering effect of isoflavones. Other data from our laboratory demonstrate enhanced bile excretion in mice fed an isoflavone-containing diet (data not shown).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
FIGURE 3  Modeling the effect of soy isoflavones on CYP8B1 expression and bile metabolism. (A) CDCA and CA are the 2 primary bile acids and CYP8B1 is the enzyme at a branch point in the biliary pathway, enhancing production of the more hydrophilic CA. The induction of CYP8B1 by isoflavones results in an increase in the ratio of CA:CDCA. More CA delivered to the liver via enterohepatic recirculation reduces sterol inhibition on CYP7A1, increasing the conversion of cholesterol to bile salts and enhancing bile secretion and excretion. Upregulation of CYP8B1 by isoflavones in PPAR{alpha}-null mice and wt mice. HNF4{alpha} and FTF have been shown to bind to the same response element; either may activate the CYP8B1 promoter. Isoflavones may serve as a ligand for HNF4{alpha} and/or FTF, further activating the transcription of CYP8B1. SHP, a universal repressor, inhibits the transactivation of CYP8B1 via HNF4{alpha} and/or FTF. PPAR{alpha} may serve as a negative regulator of SHP, increasing the repressive action of SHP on HNF4{alpha} and FTF. The absence of PPAR{alpha} may reduce the inhibitory effect of SHP or may permit increased CYP8B1 gene transcription by isoflavones. Plus and minus signs and up and down arrows indicate pathways that may become up- or downregulated.

 
Transfection experiments using different expression plasmids helped discriminate the roles of FTF, HNF4{alpha}, and PPAR{alpha} on the induction of CYP8B1 by isoflavones (Table 6). FTF has been described as a weak regulator of CYP8B1 (17) with no known activating ligand. The slight increase in CYP8B1-Luc expression associated with cotransfection of FTF does not correspond to the robust increases observed in CYP8B1 mRNA levels. HNF4{alpha} is widely described as a constitutive, ligand-independent orphan receptor although fatty acids may be weak ligands of the receptor (50). Isoflavone-treated cells cotransfected with HNF4{alpha} produced a significant induction of CYP8B1, suggesting that isoflavones may serve to activate HNF4{alpha}. In contrast to FTF and HNF4{alpha}, cotransfection of PPAR{alpha} abrogates the upregulation of CYP8B1 produced by exposure to isoflavones (Table 6).

Studies in PPAR{alpha}-null mice showed unexpectedly robust increases in CYP8B1 mRNA levels after intake of isoflavones, suggesting an inhibitory role of PPAR{alpha} on the regulation of the CYP8B1 gene (Table 3). In our transfected cell model, we observed a lack of induction of CYP8B1 by isoflavones when PPAR{alpha} was cotransfected with other transcription factors. Interestingly, the coexpression of PPAR{alpha} with FTF and HNF4{alpha} significantly decreased the constitutive action of HNF4{alpha} on CYP8B1 in the transfected cell model (Table 7). This effect is consistent with other findings showing PPAR{alpha}/RXR{alpha} significantly reduced HNF4 expression in HepG2 cells (51,52). To summarize the effect of isoflavones on CYP8B1 regulation, summary models provide an overview of bile synthesis and recirculation and transcriptional activation of the CYP8B1 gene promoter (Fig. 3B).

In this study, we found that isoflavones were able to induce the transcription of CYP8B1 and we hypothesized the subsequent changes of CYP8B1 upregulation on bile acid pathway. Our findings regarding potential agonists for CYP8B1 gene expression are novel in contrast to previous reports identifying several antagonists for CYP8B1, such as bile acids, cholesterol, and inflammatory cytokines (53). Changes in CYP8B1 activity will lead to altered ratios of primary bile acids CA and CDCA (Fig. 3A).

Contrary to a previous finding about the active regulation of PPAR{alpha} on CYP8B1 (18), our data showed a prominent lack of activation of CYP8B1 by PPAR{alpha}; indeed, PPAR{alpha} was even shown to play an inhibitory role. In contrast to the prior study, we used a very high-fat diet fed for 6 wk to assess the ability of isoflavones to reduce serum and tissue lipid levels and to determine whether this phenomenon occurred via a PPAR{alpha}-dependent pathway (34). Although cholesterol feeding of mice and rats has been shown to decrease the activity of CYP8B1 (54), we observed the upregulation of CYP8B1 with isoflavone intake. This upregulation was not similarly related to intake of the PPAR{alpha} agonist, fenofibrate. These data indicate that PPAR{alpha} may work as a weak transcription activator, a conclusion similar to another study (17).

In conclusion, this study demonstrates that isoflavones induce expression of several important genes of drug metabolism pathways in human hepatocytes; a notable target is CYP8B1. The mechanism producing this induction further clarifies the roles of different nuclear receptors on CYP8B1 regulation and demonstrates that HNF4{alpha} is, at present, one likely candidate mediating the effect of isoflavones on CYP8B1. Our model helps explain a potential hypolipidemic role of isoflavones and the interaction of PPAR{alpha} with other transcription factors on the regulation of bile acid synthesis.


    FOOTNOTES
 
1 Supported by the NIH AT000862 (to N.F.S.) and Solae Company (St. Louis, MO). Back

2 Author disclosures: Y. Li, O. Mezei, and N. F. Shay, no conflicts of interest. Back

3 Present address: Department of Pathology, Wayne State University, 111 Lande Building, 550 E. Canfield, Detroit, MI 48201 (yilanli{at}med.wayne.edu). Back

4 Present address: Baylor College of Medicine, 1100 Bates Street, Houston, TX 77030. Back

5 Present address: WK Kellogg Institute for Food and Nutrition Research, 2 Hamblin Avenue, Battle Creek, MI 49017 (neil.shay{at}kellogg.com). Back

6 Abbreviations used: CA, cholic acid; CDCA, chenodeoxycholic acid; CHST5, carbohydrate sulfotransferase-5; Cpt1{alpha}, carnitine palmitoyltransferase 1{alpha}; CYP, cytochrome P450; CYP8B1, 12-{alpha}-hydroxylase; DME, drug-metabolizing enzyme; D+E, dimethyl sulfoxide + ethanol; FTF, {alpha}-fetoprotein transcription factor; gal, galactosidase; GSTT2, glutathione-sulfotransferase-2; HNF4{alpha}, hepatocyte nuclear factor 4{alpha}; KO, knock-out; Luc, luciferase; MDR1, Multi-drug restistant-1; MEM, minimal essential medium; mRNA, messenger RNA; MRP2, Multidrug-related protein-2; PPAR{alpha}, peroxisome proliferator-activated receptor {alpha}; PXR, pregnane x receptor; rRNA, ribosomal RNA; S, soy protein diet containing essentially no isoflavones; S+F, soy protein diet containing essentially no isoflavones plus 0.2% fenofibrate; SHP, small heterodimer partner; S+I, soy protein diet containing 1.82 mg isoflavones (aglycone form)/g protein; S+I+F, soy protein diet containing 1.82 mg isoflavones (aglycone form)/g protein plus 0.2% fenofibrate; wt, wild-type. Back

Manuscript received 30 August 2006. Initial review completed 19 October 2006. Revision accepted 11 April 2007.


    LITERATURE CITED
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Russell DW. The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem. 2003;72:137–74.[Medline]

2. Trauner M, Boyer JL. Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev. 2003;83:633–71.[Abstract/Free Full Text]

3. Xu C, Li CY, Kong AN. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch Pharm Res. 2005;28:249–68.[Medline]

4. Faber KN, Muller M, Jansen PL. Drug transport proteins in the liver. Adv Drug Deliv Rev. 2003;55:107–24.[Medline]

5. Leslie EM, Deeley RG, Cole SP. Multidrug resistance proteins: role of P-glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol Appl Pharmacol. 2005;204:216–37.[Medline]

6. Dorne JL, Walton K, Renwick AG. Human variability in xenobiotic metabolism and pathway-related uncertainty factors for chemical risk assessment: a review. Food Chem Toxicol. 2005;43:203–16.[Medline]

7. Michael M, Doherty MM. Tumoral drug metabolism: overview and its implications for cancer therapy. J Clin Oncol. 2005;23:205–29.[Abstract/Free Full Text]

8. Lee W, Lockhart AC, Kim RB, Rothenberg ML. Cancer pharmacogenomics: powerful tools in cancer chemotherapy and drug development. Oncologist. 2005;10:104–11.[Abstract/Free Full Text]

9. Schuetz EG, Strom S, Yasuda K, Lecureur V, Assem M, Brimer C, Lamba J, Kim RB, Ramachandran V, et al. Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone receptors, transporters, and cytochrome P450. J Biol Chem. 2001;276:39411–8.[Abstract/Free Full Text]

10. Handschin C, Podvinec M, Amherd R, Looser R, Ourlin JC, Meyer UA. Cholesterol and bile acids regulate xenosensor signaling in drug-mediated induction of cytochromes P450. J Biol Chem. 2002;277:29561–7.[Abstract/Free Full Text]

11. Eloranta JJ, Kullak-Ublick GA. Coordinate transcriptional regulation of bile acid homeostasis and drug metabolism. Arch Biochem Biophys. 2005;433:397–412.[Medline]

12. Chiang JY. Regulation of bile acid synthesis. Front Biosci. 1998;3:d176–93.[Medline]

13. Sonoda J, Rosenfeld JM, Xu L, Evans RM, Xie W. A nuclear receptor-mediated xenobiotic response and its implication in drug metabolism and host protection. Curr Drug Metab. 2003;4:59–72.[Medline]

14. Christians U. Transport proteins and intestinal metabolism: P-glycoprotein and cytochrome P4503A. Ther Drug Monit. 2004;26:104–6.[Medline]

15. Honkakoski P, Sueyoshi T, Negishi M. Drug-activated nuclear receptors CAR and PXR. Ann Med. 2003;35:172–82.[Medline]

16. Li-Hawkins J, Gafvels M, Olin M, Lund EG, Andersson U, Schuster G, Bjorkhem I, Russell DW, Eggertsen G. Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. J Clin Invest. 2002;110:1191–200.[Medline]

17. Zhang M, Chiang JY. Transcriptional regulation of the human sterol 12alpha-hydroxylase gene (CYP8B1): roles of heaptocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem. 2001;276:41690–9.[Abstract/Free Full Text]

18. Hunt MC, Yang YZ, Eggertsen G, Carneheim CM, Gafvels M, Einarsson C, Alexson SE. The peroxisome proliferator-activated receptor alpha (PPARalpha) regulates bile acid biosynthesis. J Biol Chem. 2000;275:28947–53.[Abstract/Free Full Text]

19. del Castillo-Olivares A, Gil G. Alpha 1-fetoprotein transcription factor is required for the expression of sterol 12alpha -hydroxylase, the specific enzyme for cholic acid synthesis. Potential role in the bile acid-mediated regulation of gene transcription. J Biol Chem. 2000;275:17793–9.[Abstract/Free Full Text]

20. Yang Y, Eggertsen G, Gafvels M, Andersson U, Einarsson C, Bjorkhem I, Chiang JY. Mechanisms of cholesterol and sterol regulatory element binding protein regulation of the sterol 12alpha-hydroxylase gene (CYP8B1). Biochem Biophys Res Commun. 2004;320:1204–10.[Medline]

21. Lichtenstein AH. Soy protein, isoflavones and cardiovascular disease risk. J Nutr. 1998;128:1589–92.[Abstract/Free Full Text]

22. Zhuo XG, Melby MK, Watanabe S. Soy isoflavone intake lowers serum LDL cholesterol: a meta-analysis of 8 randomized controlled trials in humans. J Nutr. 2004;134:2395–400.[Abstract/Free Full Text]

23. Zhan S, Ho SC. Meta-analysis of the effects of soy protein containing isoflavones on the lipid profile. Am J Clin Nutr. 2005;81:397–408.[Abstract/Free Full Text]

24. Anthony MS. Soy and cardiovascular disease: cholesterol lowering and beyond. J Nutr. 2000;130:S662–3.

25. Mezei O, Banz WJ, Steger RW, Peluso MR, Winters TA, Shay N. Soy isoflavones exert antidiabetic and hypolipidemic effects through the PPAR pathways in obese Zucker rats and murine RAW 264.7 cells. J Nutr. 2003;133:1238–43.[Abstract/Free Full Text]

26. Mullen E, Brown RM, Osborne TF, Shay NF. Soy isoflavones affect sterol regulatory element binding proteins (SREBPs) and SREBP-regulated genes in HepG2 cells. J Nutr. 2004;134:2942–7.[Abstract/Free Full Text]

27. Kim S, Shin HJ, Kim SY, Kim JH, Lee YS, Kim DH, Lee MO. Genistein enhances expression of genes involved in fatty acid catabolism through activation of PPARalpha. Mol Cell Endocrinol. 2004;220:51–8.[Medline]

28. Ronis MJ, Rowlands JC, Hakkak R, Badger TM. Altered expression and glucocorticoid-inducibility of hepatic CYP3A and CYP2B enzymes in male rats fed diets containing soy protein isolate. J Nutr. 1999;129:1958–65.[Abstract/Free Full Text]

29. Mezei O, Chou CN, Kennedy KJ, Tovar-Palacio C, Shay NF. Hepatic cytochrome p450–2A and phosphoribosylpyrophosphate synthetase-associated protein mRNA are induced in gerbils after consumption of isoflavone-containing protein. J Nutr. 2002;132:2538–44.[Abstract/Free Full Text]

30. Backlund M, Johansson I, Mkrtchian S, Ingelman-Sundberg M. Signal transduction-mediated activation of the aryl hydrocarbon receptor in rat hepatoma H4IIE cells. J Biol Chem. 1997;272:31755–63.[Abstract/Free Full Text]

31. Imai Y, Tsukahara S, Asada S, Sugimoto Y. Phytoestrogens/flavonoids reverse breast cancer resistance protein/ABCG2-mediated multidrug resistance. Cancer Res. 2004;64:4346–52.[Abstract/Free Full Text]

32. Morel C, Stermitz FR, Tegos G, Lewis K. Isoflavones as potentiators of antibacterial activity. J Agric Food Chem. 2003;51:5677–9.[Medline]

33. Sladek FM. Orphan receptor HNF-4 and liver-specific gene expression. Receptor. 1993;3:223–32.[Medline]

34. Mezei O, Li Y, Mullen E, Ross-Viola JS, Shay NF. Dietary isoflavone supplementation modulates lipid metabolism via PPARalpha-dependent and -independent mechanisms. Physiol Genomics. 2006;26:8–14.[Abstract/Free Full Text]

35. Gloerich J, van Vlies N, Jansen GA, Denis S, Ruiter JP, van Werkhoven MA, Duran M, Vaz FM, Wanders RJ, et al. A phytol-enriched diet induces changes in fatty acid metabolism in mice both via PPARalpha-dependent and -independent pathways. J Lipid Res. 2005;46:716–26.[Abstract/Free Full Text]

36. Rodriguez-Antona C, Donato MT, Boobis A, Edwards RJ, Watts PS, Castell JV, Gomez-Lechon MJ. Cytochrome P450 expression in human hepatocytes and hepatoma cell lines: molecular mechanisms that determine lower expression in cultured cells. Xenobiotica. 2002;32:505–20.[Medline]

37. Russell L, Hicks GS, Low AK, Shepherd JM, Brown CA. Phytoestrogens: a viable option? Am J Med Sci. 2002;324:185–8.[Medline]

38. Hasler CM. The cardiovascular effects of soy products. J Cardiovasc Nurs 2002;16:50–63.[Medline]

39. Lambert JD, Hong J, Yang GY, Liao J, Yang CS. Inhibition of carcinogenesis by polyphenols: evidence from laboratory investigations. Am J Clin Nutr. 2005;81 Suppl 1:S284–91.[Abstract/Free Full Text]

40. Kuwano M, Toh S, Uchiumi T, Takano H, Kohno K, Wada M. Multidrug resistance-associated protein subfamily transporters and drug resistance. Anticancer Drug Des. 1999;14:123–31.[Medline]

41. Cheng SC, Zhou J, Xie Y. P-Glycoprotein expression induced by glucose depletion enhanced the chemosensitivity in human hepatocellular carcinoma cell-lines. Cell Biol Int. 2005;29:269–75.[Medline]

42. Kast HR, Goodwin B, Tarr PT, Jones SA, Anisfeld AM, Stoltz CM, Tontonoz P, Kliewer S, Willson TM, et al. Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J Biol Chem. 2002;277:2908–15.[Abstract/Free Full Text]

43. Burk O, Arnold KA, Nussler AK, Schaeffeler E, Efimova E, Avery BA, Avery MA, Fromm MF, Eichelbaum M. Anti-malarial artemisinin drugs induce CYP and MDR1 expression by activation of xenosensors pregnane X receptor and constitutive androstane receptor. Mol Pharmacol. 2005;67:1954–65.[Abstract/Free Full Text]

44. Rushmore TH, Kong AN, Haddad JJ. Pharmacogenomics, regulation and signaling pathways of phase I and II drug metabolizing enzymes pharmaco-redox regulation of cytokine-related pathways: from receptor signaling to pharmacogenomics. Curr Drug Metab. 2002;3:481–90.[Medline]

45. Russell DW, Setchell KD. Bile acid biosynthesis. Biochemistry. 1992;31:4737–49.[Medline]

46. Ellis E, Axelson M, Abrahamsson A, Eggertsen G, Thorne A, Nowak G, Ericzon BG, Bjorkhem I, Einarsson C. Feedback regulation of bile acid synthesis in primary human hepatocytes: evidence that CDCA is the strongest inhibitor. Hepatology. 2003;38:930–8.[Medline]

47. Ronis M, Chen Y, Badger TM. Effect of soy protein isolate and dietary isoflavones on cholesterol metabolism and transport in weanling rats. FASEB J. 2005;19:A1075.

48. Ross-Viola JS, Suckow M, Mezei O, Shay NF. Reduction of hepatic ischemic injury in fenofibrate-treated mice consuming a soy isoflavone-containing diet. FASEB J. 2005;19:A1048.

49. del Castillo-Olivares A, Campos JA, Pandak WM, Gil G. The role of alpha1-fetoprotein transcription factor/LRH-1 in bile acid biosynthesis: a known nuclear receptor activator that can act as a suppressor of bile acid biosynthesis. J Biol Chem. 2004;279:16813–21.[Abstract/Free Full Text]

50. Dhe-Paganon S, Duda K, Iwamoto M, Chi YI, Shoelson SE. Crystal structure of the HNF4 alpha ligand binding domain in complex with endogenous fatty acid ligand. J Biol Chem. 2002;277:37973–6.[Abstract/Free Full Text]

51. Marrapodi M, Chiang JY. Peroxisome proliferator-activated receptor alpha (PPARalpha) and agonist inhibit cholesterol 7alpha-hydroxylase gene (CYP7A1) transcription. J Lipid Res. 2000;41:514–20.[Abstract/Free Full Text]

52. Patel DD, Knight BL, Soutar AK, Gibbons GF, Wade DP. The effect of peroxisome-proliferator-activated receptor-alpha on the activity of the cholesterol 7 alpha-hydroxylase gene. Biochem J. 2000;351:747–53.[Medline]

53. Jahan A, Chiang JY. Cytokine regulation of human sterol 12alpha-hydroxylase (CYP8B1) gene. Am J Physiol Gastrointest Liver Physiol. 2005;288:G685–95.[Abstract/Free Full Text]

54. Vlahcevic ZR, Eggertsen G, Bjorkhem I, Hylemon PB, Redford K, Pandak WM. Regulation of sterol 12alpha-hydroxylase and cholic acid biosynthesis in the rat. Gastroenterology. 2000;118:599–607.[Medline]




This article has been cited by other articles:


Home page
J. Nutr.Home page
Y. Li, J. S. Ross-Viola, N. F. Shay, D. D. Moore, and M.-L. Ricketts
Human CYP3A4 and Murine Cyp3A11 Are Regulated by Equol and Genistein via the Pregnane X Receptor in a Species-Specific Manner
J. Nutr., May 1, 2009; 139(5): 898 - 904.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
S. Engdal, O. Klepp, and O. G. Nilsen
Identification and Exploration of Herb-Drug Combinations Used By Cancer Patients
Integr Cancer Ther, March 1, 2009; 8(1): 29 - 36.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Shay, N. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Shay, N. F.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by American Society for Nutrition