![]() |
|
|
-Glutamyl Hydrolase, Not Glutamate Carboxypeptidase II, Hydrolyzes Dietary Folate in Rat Small Intestine1,2
Department of Internal Medicine, Clinical Nutrition, University of California, Davis, CA 95616
* To whom correspondence should be addressed. E-mail:chalsted{at}ucdsom.ucdavis.edu.
| ABSTRACT |
|---|
|
|
|---|
-glutamyl hydrolase (
-GH) gene and predominates in rats. We determined the respective roles of GCPII and
-GH in dietary folate hydrolysis in rat small intestine. Duodenal, jejunal, and ileal mucosa, pancreas, and duodenal luminal fluid were collected from 10 Sprague-Dawley rats that had not been food deprived. Folate hydrolase was assayed at pH 4.5 and 6.5 with and without parahydroxymercuribenzoate (pHMB), an inhibitor of intracellular folate hydrolase. Folate hydrolase activity occurred at pH 4.5 in all tissues, was significantly inhibited by the addition of pHMB at both pH 4.5 and 6.5, and was virtually absent from brush border fractions at pH 6.5. The highest activity was in the postprandial duodenal luminal fluid at pH 4.5. Rat-specific primers for GCPII and
-GH were used to detect mRNA expression in pancreas, jejunal mucosa, and liver. GCPII expression was detected only in the liver, whereas
-GH was expressed in all 3 tissues. These results suggest that the hydrolysis of polyglutamyl folates in rats requires the intracellular folate hydrolase that is expressed by pancreatic
-GH, in contrast to GCPII that is expressed in the jejunal mucosal brush border in pigs and humans.
-GH folate hydrolase is abundant in rat postprandial pancreatic secretions and appears to hydrolyze dietary folates in the intestinal lumen prior to intestinal absorption.
| Introduction |
|---|
|
|
|---|
Glutamate carboxypeptidase II (GCPII)3 is expressed in pig and human small intestine as folate hydrolase, which is the enzyme predominantly involved in the hydrolysis of dietary polyglutamyl folates. GCPII is also expressed in rat brain as N-acetylated
-linked acidic dipeptidase (1) and in human prostate as prostate-specific membrane antigen (PSMA) (2). Although all 3 proteins are expressed by GCPII, only folate hydrolase (intestinal GCPII) is involved in dietary polyglutamyl folate hydrolysis. Intestinal GCPII is a zinc-activated exopeptidase that is highly expressed in pig and human jejunal brush border membranes with an optimal pH of 6.5 (3,4) and sequentially cleaves terminal
-linked glutamate residues from dietary polyglutamyl folates prior to the uptake of the monoglutamyl folate products across the same membrane (3).
Wang et al. (5) compared folate hydrolase activities among various species and found high levels of jejunal brush border membrane activities in pigs and humans but negligible amounts in rats and monkeys (5). In a seperate study, rat jejunal brush border membrane folate hydrolase activity was found to be upregulated by folate deficiency, but the levels of activity under all experimental conditions were very low compared with other species (6).
Originally identified as an intracellular intestinal folate hydrolase (4),
-glutamyl hydrolase (
-GH) expresses a soluble endopeptidase glycoprotein that cleaves
-linked glutamate residues from polyglutamyl folates, is optimally active over a pH range of 4.5–6.0, and has been identified in pig, human, rat and monkey intestine as well as human liver, kidney, placenta, colon and brain (7,8,4,5). In contrast to intestinal GCPII,
-GH is localized in the lysosomal fraction of enterocytes and hepatocytes (4) and is found in serum, bile, and pancreatic secretions (8,9).
Although both enzymes hydrolyze polyglutamyl folates, the genes for GCPII and
-GH have distinct sequences and are expressed in different locations. As a type II membrane protein, intestinal GCPII is highly glycosylated, a modification that allows the enzyme to be targeted and anchored to the jejunal brush border membrane and is necessary for its hydrolytic activity (10,11). From this location, GCPII hydrolyzes dietary folates entering the intestinal lumen prior to intestinal absorption. Conversely,
-GH is involved in intracellular polyglutamyl folate hydrolysis, which probably allows for the generation of intracellular monoglutamyl folate, enabling its exit from the cell and entry into the circulation (8,12,4).
The mechanism for the hydrolysis of polyglutamyl folate in rats has not been confirmed. Early studies by Kesavan and Noronha (13) showed that incubation of polyglutamyl folates with rat luminal contents yielded monoglutamyl folates, in contrast to a study in which incubation with human luminal aspirates did not hydrolyze a mixture of labeled polyglutamyl folate (14). Kesavan and Noronha (9) also identified rat luminal folate hydrolase activity of pancreatic origin that could be induced by the ingestion of dietary polyglutamyl folates but not by the ingestion of synthetic monoglutamyl folates. In these experiments, rat pancreatic folate hydrolase activity showed a 2-fold increase, and proximal intestinal fluid showed an 8- to 9-fold increase, following the ingestion of polyglutamyl folates, whereas no increase occurred after the consumption of monoglutamyl folates. Additionally, pancreatectomized rats showed impaired hydrolysis and uptake of ingested dietary polyglutamyl folates, evident by the decreased rise in serum folate, whereas the rise in serum folate after ingesting monoglutamyl folates was unaffected by pancreatectomy (9).
The objective of the present study was to re-evaluate the role of the pancreas in the initial digestion of dietary folate in rats and to determine the respective roles of
-GH and intestinal GCPII in polyglutamyl folate hydrolysis in this species.
| Methods |
|---|
|
|
|---|
Animals and tissue collection.
Male Sprague-Dawley rats (n = 10) were purchased from Charles River Laboratories and were fed a diet of Purina Rodent Chow 5008 (Ralston Purina) ad libitum (15). This study complied with the Guide for the Use and Care of Laboratory Animals at the University of California, Davis, which is accredited by the Animal Association for the Accreditation of Laboratory Animal Care, and protocols for rat maintenance were approved by the UC Davis Animal Care and Use Committee. Immediately following asphyxiation in a CO2 chamber, the pancreas, duodenal intestinal contents, and the entire small intestine distal to the pylorus were removed from each rat. Luminal duodenal contents were collected by clamping and cutting the distal end of the duodenum and manually expressing the intestinal contents into a microcentrifuge tube. Segments of the small intestine were identified and collected as follows:
7.5 cm each of duodenum (between the pyloric sphincter and the ligament of Trietz), jejunum (immediately distal to the ligament of Trietz), and ileum (immediately proximal to the ileo-cecal junction) were excised, and mucosal scrapings from each segment were collected using glass slides. The tissue samples were wrapped in foil and immediately frozen in dry ice. In addition, 20 mg of pancreas and each intestinal segment were placed in RNAlater solution to stabilize RNA for future isolation. All tissue samples were maintained at –80°C until analysis.
Tissue preparation. Frozen intestinal mucosa and pancreas were homogenized in tris-mannitol buffer containing protease inhibitor cocktail using a Polytron homogenizer (Brinkman Instruments). Brush border membranes were isolated from mucosal scrapings by the calcium precipitation method (16), and purity was determined by measuring the enrichment of alkaline phosphatase activity. In all samples, brush border membrane fractions showed a 6- to 10-fold higher alkaline phosphatase specific activity compared with total homogenate (data not shown). The final membrane pellets were resuspended in 150 µL of homogenization buffer containing the protease inhibitor cocktail. Luminal duodenal contents were centrifuged at 32,000 x g for 20 min to separate undigested food particles. Luminal duodenal fluid was removed, and the remaining pellet was discarded.
Enzyme activity.
Based on initial kinetic studies conducted in our laboratory (12), the folate hydrolase activities of
-GH and intestinal GCPII were measured in tissue homogenates, intestinal brush border membranes, and luminal duodenal fluid by the method of Krumdieck and Baugh (17) using 12 µmol/L [14C] PteGlu3 as substrate. The 14C radiolabel is located on the terminal glutamate residue of the polyglutamyl folate so that both the exopeptidase activity of intestinal GCPII and the endopeptidase activity of
-GH can liberate the labeled glutamate and the rate of folate hydrolysis can be measured after charcoal precipitation of unreacted folate. The 3,3-dimethylglutarate buffer was adjusted to pH 4.5 and pH 6.5 to measure the different folate hydrolase activities, respectively. Parahydroxymercuribenzoate (p-HMB, 0.17 mmol/L) was added to the reaction mixture to inhibit the folate hydrolase activity of
-GH for select samples. pHMB has been shown in prior studies to completely inhibit intracellular folate hydrolase activity, whereas brush border membrane folate hydrolase activity is unaffected (12,4,5). Samples were incubated with radiolabeled substrate for 40 min at 37°C before terminating the reaction with 10% trichloroacetic acid. Two-percent charcoal in 0.1 mol/L acetic acid was then added to bind uncleaved substrate. After centrifugation at 2000 x g for 10 min, supernatants containing radiolabeled product were collected and measured using a liquid scintillation counter. Folate hydrolase activity in luminal duodenal fluid was measured over a pH range of 3.0–8.0 by adjusting the pH of the 3,3 dimethylglutarate buffer with 1 mol/L NaOH. Protein concentration was measured by spectrophotometry using Bio-Rad reagent at 595 nm. Folate hydrolase–specific activity was expressed as pmol cleaved substrate · mg protein–1 · min–1.
RT-PCR.
Total RNA from all tissue samples except luminal duodenal fluid was isolated using the Trizol reagent method (18). Intestinal cDNA was prepared by reverse transcription using Invitrogen First Strand Synthesis kit. The quality of cDNA was analyzed by PCR using 18s primers. Rat-specific primers for
-GH and GCPII were designed using Primer Express software (Applied Biosystems). The
-GH primers included forward (GGCTGTCCGGATCCTATGAG) and reverse (CCGGAACATTCTGCTCTGCT). The GCPII primers included forward (GTGAAGTCCTATCCAGATGGTTGG) and reverse (GCTGCTCCACTCTGAGGGTC). The melting temperature for both primer sets was 58°C, and PCR were carried out for 36 cycles. Two µL of PCR product were loaded onto a 2.5% agarose gel containing ethidium bromide and was electrophoresed at 100 v for 25 min. Bands corresponding to
-GH and GCPII transcripts were visualized using UV detection.
Statistical analysis.
ANOVA was used to compare folate hydrolase activity among tissues at each pH and in the presence or absence of pHMB (
= 0.05). Student's paired t test was used to compare folate hydrolase activity within each tissue at each pH. Student's t test for unequal variance was used to compare activity in luminal fluid at each pH without pHMB. Activity assays were performed in triplicate. Values are presented as the mean ± SEM (n = 10), and differences were considered significant at P
0.01.
| Results |
|---|
|
|
|---|
-GH. The highest activity was found in the cytosolic fraction at pH 4.5, whereas negligible activity was detected at either pH in jejunal brush border membranes. The results of the pilot study were the basis for the experiments conducted in the present study. Folate hydrolase activity in duodenal, jejunal, and ileal total mucosal homogenates was measured at pH 4.5 and 6.5 alone and with the addition of 0.17 mmol/L pHMB, an inhibitor of intracellular folate hydrolase activity that has no effect on membrane folate hydrolase activity (12). In this experiment, folate hydrolase activity was detected at pH 4.5 in all segments of rat small intestine mucosal homogenate, but activities were significantly lower at pH 6.5 (Table 1). The addition of pHMB blocked all folate hydrolase activity at both pH 4.5 and 6.5 in all segments of the intestine, except there was a minimal jejunal activity at pH 6.5 in the presence of pHMB.
|
|
|
-GH and GCPII mRNA expression.
To further establish the identities of the enzymes involved in folate hydrolysis in various tissues in rats, RT-PCR of jejunal mucosa and pancreas cDNA was performed using rat-specific primers for
-GH and GCPII (Fig. 1). RT-PCR was utilized to determine relative differences among tissues rather than to quantify absolute levels of mRNA transcripts. Rat liver cDNA was used as a positive control for both genes.
-GH transcripts were detected in all 3 rat tissues with the highest expression in the pancreas. In contrast, GCPII transcripts were detected at low levels in rat liver, but not in pancreas or jejunum, indicating a lack of GCP II expression in these tissues.
|
| Discussion |
|---|
|
|
|---|
Based on preliminary results from our pilot study, rat jejunal folate hydrolase activity was concentrated in the cytosol at pH 4.5, corresponding to the activity of the intracellular enzyme
-GH (8). However, if dietary polyglutamyl folates are hydrolyzed prior to jejunal uptake, they would not come in contact with jejunal cytosolic
-GH. Although all intestinal total homogenates had folate hydrolase activity at pH 4.5 and less at 6.5, all activity was completely inhibited with the addition of pHMB with the exception of very low activity in the jejunal mucosa (Table 1). These results indicate that
-GH is the enzyme providing intracellular folate hydrolase activity in these tissues at pH 4.5 and at pH 6.5.
The highest level of folate hydrolase activity in the present study was found in pancreas and in postprandial intraluminal duodenal fluid at both pH 4.5 and 6.5 (Table 3). The activity measured in intestinal fluid at pH 4.5 was
4.5-fold higher than the activity at either pH in all other tissues (Table 1). With the exception of the minimal activity in luminal fluid, all activity at pH 4.5 and 6.5 was 90–99% inhibited by the addition of pHMB, indicating that activity at pH 6.5 is most likely attributable to residual activity of
-GH, whereas peak activity at pH 4.5 is characteristic of this enzyme. The presence of relatively less pHMB inhibition at pH 6.5 in luminal fluid (Table 3) is unexplained. The presence of an acid microclimate in rat small intestine coincides with the optimal conditions for
-GH activity (pH 4.5) in rat intestinal lumen (21).
To identify the gene of origin of the folate hydrolase expressed and secreted into rat intestinal lumen we performed RT-PCR with cDNA from rat pancreas and jejunum using rat-specific primers for GCPII and
-GH (Fig. 1). Our findings show that the GCPII transcript was absent in rat pancreas and jejunum, whereas a high level of
-GH transcript was expressed mainly in rat pancreas and to a lesser extent in jejunum. The cDNA for
-GH has been described as containing a leader sequence that targets it to the endoplasmic reticulum for secretion (8). This observation suggests that the abundance of
-GH transcripts in rat pancreas corresponds with the high enzymatic activity in duodenal luminal fluid (Table 3). Our findings are consistent with findings of a lack of intestinal brush border GCPII activity in rats in a previous study (5).
Horne et al. (22) described a folate hydrolase activity in rat bile that was inhibited by pHMB. His finding is consistent with the expression of
-GH in liver, and with our present data showing the presence of
-GH transcript in rat liver. However, our finding of a much greater abundance of
-GH transcript in rat pancreas than liver (Fig. 1) suggests that pancreatic secretion provides a greater contribution of folate hydrolase to the intestinal lumen than biliary secretion.
Previous studies showed that folate hydrolase is expressed in rat pancreas and secreted into the proximal intestinal lumen (9,5). Although pancreatic secretion of folate hydrolase activity was previously reported in pigs (23), it is thought to play a minor role in dietary polyglutamyl folate hydrolysis compared with that of jejunal GCPII in humans and pigs (3,19). To date, the roles of
-GH and intestinal GCPII in dietary folate hydrolysis by rats have not previously been determined. The results of the present study confirm that
-GH is expressed in the pancreas with the probable origin of its content in the intestinal lumen and, rather than GCPII, appears to be involved in the hydrolysis of dietary folate in rats. Additionally, our study demonstrates contrasting mechanisms of intestinal folate hydrolysis in rats, humans, and pigs, confirming prior studies that suggest the use of the rat model for human dietary folate digestion and absorption may not be appropriate (5,24).
| FOOTNOTES |
|---|
2 Author disclosure: T. B. Shafizadeh, no conflicts of interest; and C. H. Halsted, no conflicts of interest. ![]()
3 Abbreviations used:
-GH,
-glutamyl hydrolase; GCPII, glutamate carboxypeptidase II; p-HMB, parahydroxymercuribenzoate. ![]()
Manuscript received 27 November 2006. Initial review completed 8 December 2006. Revision accepted 13 February 2007.
| LITERATURE CITED |
|---|
|
|
|---|
1. Luthi-Carter R, Berger UV, Barczak AK, Enna M, Coyle JT. Isolation and expression of a rat brain cDNA encoding glutamate carboxypeptidase II. Proc Natl Acad Sci USA. 1998;95:3215–20.
2. Israeli RS, Powell CT, Fair WR, Heston WD. Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res. 1993;53:227–30.
3. Chandler CJ, Wang TT, Halsted CH. Pteroylpolyglutamate hydrolase from human jejunal brush borders. Purification and characterization. J Biol Chem. 1986;261:928–33.
4. Wang TT, Chandler CJ, Halsted CH. Intracellular pteroylpolyglutamate hydrolase from human jejunal mucosa. Isolation and characterization. J Biol Chem. 1986;261:13551–5.
5. Wang TT, Reisenauer AM, Halsted CH. Comparison of folate conjugase activities in human, pig, rat and monkey intestine. J Nutr. 1985;115:814–9.
6. Said HM, Chatterjee N, Haq RU, Subramanian VS, Ortiz A, Matherly LH, Sirotnak FM, Halsted C, Rubin SA. Adaptive regulation of intestinal folate uptake: effect of dietary folate deficiency. Am J Physiol Cell Physiol. 2000;279:C1889–1895.
7. Elsenhans B, Ahmad O, Rosenberg IH. Isolation and characterization of pteroylpolyglutamate hydrolase from rat intestinal mucosa. J Biol Chem. 1984;259:6364–8.
8. Galivan J, Ryan TJ, Chave K, Rhee M, Yao R, Yin D. Glutamyl hydrolase. pharmacological role and enzymatic characterization. Pharmacol Ther. 2000;85:207–15.[Medline]
9. Kesavan V, Noronha JM. Evidence for the induction and release of pancreatic folylpolyglutamate hydrolase by the ingestion of folyl polyglutamates in the rat. Experientia. 1992;48:869–71.[Medline]
10. Barinka C, Mlcochova P, Sacha P, Hilgert I, Majer P, Slusher BS, Horejsi V, Konvalinka J. Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding. Eur J Biochem. 2004;271:2782–90.[Medline]
11. Barinka C, Sacha P, Sklenar J, Man P, Bezouska K, Slusher BS, Konvalinka J. Identification of the N-glycosylation sites on glutamate carboxypeptidase II necessary for proteolytic activity. Protein Sci. 2004;13:1627–35.
12. Reisenauer AM, Krumdieck CL, Halsted CH. Folate conjugase: two separate activities in human jejunum. Science. 1977;198:196–7.
13. Kesavan V, Noronha JM. Folate malabsorption in aged rats related to low levels of pancreatic folyl conjugase. Am J Clin Nutr. 1983;37:262–7.
14. Halsted CH, Baugh CM, Butterworth CE, Jr. Jejunal perfusion of simple and conjugated folates in man. Gastroenterology. 1975;68:261–9.[Medline]
15. Fu WJ, Haynes TE, Kohli R, Hu J, Shi W, Spencer TE, Carroll RJ, Meininger CJ, Wu G. Dietary L-arginine supplementation reduces fat mass in Zucker diabetic fatty rats. J Nutr. 2005;135:714–21.
16. Schmitz J, Preiser H, Maestracci D, Ghosh BK, Cerda JJ, Crane RK. Purification of the human intestinal brush border membrane. Biochim Biophys Acta. 1973;323:98–112.[Medline]
17. Krumdieck CL, Baugh CM. Radioactive assay of folic acid polyglutamate conjugase(s). Anal Biochem. 1970;35:123–9.[Medline]
18. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–9.[Medline]
19. Chandler CJ, Harrison DA, Buffington CA, Santiago NA, Halsted CH. Functional specificity of jejunal brush-border pteroylpolyglutamate hydrolase in pig. Am J Physiol. 1991;260:G865–872.[Medline]
20. Halsted CH, Ling EH, Luthi-Carter R, Villanueva JA, Gardner JM, Coyle JT. Folylpoly-gamma-glutamate carboxypeptidase from pig jejunum. Molecular characterization and relation to glutamate carboxypeptidase II. J Biol Chem. 1998;273:20417–24.
21. Said HM, Blair JA, Lucas ML, Hilburn ME. Intestinal surface acid microclimate in vitro and in vivo in the rat. J Lab Clin Med. 1986;107:420–4.[Medline]
22. Horne DW, Krumdieck CL, Wagner C. Properties of folic acid
-glutamyl hydrolase in rat bile and plasma. J Nutr. 1981;111:442–9.
23. Bhandari SD, Gregory, 3rd JF, Renuart DR, Merritt AM. Properties of pteroylpolyglutamate hydrolase in pancreatic juice of the pig. J Nutr. 1990;120:467–75.
24. Abad AR, Gregory, 3rd JF. Determination of folate bioavailability with a rat bioassay. J Nutr. 1987;117:866–73.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||