Journal of Nutrition EB Program 2010 Abstracts

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chacko, B. K.
Right arrow Articles by Patel, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chacko, B. K.
Right arrow Articles by Patel, R. P.
Right arrowPubmed/NCBI databases
*Substance via MeSH
© 2007 The American Society for Nutrition J. Nutr. 137:351-356, February 2007


Biochemical, Molecular, and Genetic Mechanisms

Anti-Inflammatory Effects of Isoflavones are Dependent on Flow and Human Endothelial Cell PPAR{gamma}1

Balu K. Chacko2, Robert T. Chandler2, Tracy L. D'Alessandro3,4, Ameya Mundhekar2, Nicholas K. H. Khoo6, Nigel Botting7, Stephen Barnes3,4 and Rakesh P. Patel2,4,5,*

2 Department of Pathology, 3 Department of Pharmacology, 4 Purdue-UAB Botanical Center, and 5 Center for Free Radical Biology, University of Alabama, Birmingham, AL 35294; 6 Department of Pharmacology, University of Pittsburgh, Pittsburgh, PA 15261; and 7 School of Chemistry, University of St. Andrews, Fife KY16 9ST, Scotland

* To whom correspondence should be addressed. E-mail: patel{at}path.uab.edu.


    ABSTRACT
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
The mechanisms by which isoflavones protect against inflammatory vascular disease remain unclear. Our previous observations suggest that one mechanism involves inhibition of monocyte-endothelial cell interactions in a process that is absolutely dependent on flow. The molecular mechanisms involved and the effects of structurally distinct isoflavones on this process are not known and are investigated herein. Using static and flow-dependent monocyte adhesion assays, our data show that exposure of endothelial cells to biologically relevant concentrations of isoflavones inhibits subsequent TNF-{alpha} induced monocyte adhesion only during flow. This inhibition involved activating endothelial PPAR{gamma} by stimulating promoter sequences containing the PPAR{gamma} response element by isoflavones and attenuating antiadhesive effects by siRNA targeting of PPAR{gamma}. A comparison of structurally distinct isoflavones suggested a critical role for the A-ring. Using chlorinated derivatives of daidzein, a key structural requirement for PPAR{gamma} agonist activity appears to be the presence of the 7-OH group and the lack of chlorine at the 6- or 8-positions in the A-ring. Collectively, these data support 1) a novel flow-dependent anti-inflammatory mechanism for PPAR{gamma} ligands in vascular endothelial cells and 2) exemplify the current concepts of nutrients modulating disease via regulating specific cell signaling pathways.



    Introduction
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Both experimental and epidemiological studies have highlighted the potential for dietary isoflavones to prevent atherosclerosis and other chronic diseases in which inflammation plays a key role (17). In human-based studies, consumption of isoflavones is associated with improved vascular function and decreased markers of oxidative damage (711), observations that support the general conclusion that isoflavones are a class of polyphenols with the capacity to protect the vasculature against inflammation-induced toxicity (12,13). Despite these concepts and the fact that isoflavones are widely consumed in botanical-based supplements, an understanding of the molecular mechanisms by which these compounds may exert effects in the vascular compartment remains poor.

Recent studies promote the concept that low, biologically relevant concentrations of isoflavones modulate cell signaling processes that impact on vascular disease. Genistein, a primary constituent of many isoflavone preparations, is as efficient as 17ß-estradiol in binding to the ß-isoform of estrogen receptors and may explain the effects of this isoflavone on stimulating NO-dependent vasodilation (14). Furthermore, isoflavones are ligands for the nuclear receptor/transcription factors PPAR{alpha} and -{gamma} (15). Genistein and daidzein stimulated PPAR{gamma}-dependent gene transcription in macrophages (4), with similar results observed for genistein in a preosteoblastic cell line (16). In vivo studies have shown that antidiabetic effects and lipid lowering effects of isoflavones also may be mediated by PPAR{gamma} and/or PPAR{alpha} (4). In the context of atherosclerosis specifically, little is known about the vascular endothelial effects of PPAR{gamma} activation by isoflavones. Previous studies have documented that endothelial activation of PPAR{gamma} by synthetic ligands is anti-inflammatory by increased NO-bioavailability, inhibition of cytokine-dependent proinflammatory adhesion molecule expression, and subsequent leukocyte adhesion (1719). Monocyte adhesion to the endothelium is an early and critical step in inflammation and the development of atherosclerotic lesions, and therefore represents a potentially important target of dietary isoflavones that, in turn, inhibit lesion development.

Leukocyte-endothelial interactions are characterized by the sequential and distinct events of tethering, rolling, firm adhesion, and then transmigration to the subendothelial region of the vessel. An important determinant of these interactions is the hydrodynamic forces associated with blood flow. In vivo, actively interacting leukocytes must overcome the shearing forces associated with blood flow to make close contact with the endothelium. In addition, chronic exposure of endothelial cells to shear stress is anti-inflammatory and may explain why atherosclerotic lesions are initiated at relatively low shear stress or turbulent flow sites in the vasculature. Our recent studies demonstrated that exposure of endothelial cells to genistein at low biologically relevant concentrations (≤1 µmol/L) inhibits leukocyte rolling and adhesion to TNF-{alpha} activated endothelial cells, representing a potent anti-inflammatory action of these compounds (20). Importantly, these effects were only observed in the presence of acute flow; no antiadhesive effect of genistein was observed if monocyte-endothelial cell interactions were determined under static conditions. Our data also indicated that neither estrogen receptors nor reactive species scavenging were important, and that the mechanism did not involve modulation of adhesion molecule expression but did suggest a role for PPAR{gamma}. Herein, we investigate the role of PPAR{gamma} in mediating anti-inflammatory effects of isoflavones during flow and evaluate potential structural motifs on isoflavones that may mediate these effects.


    Materials and Methods
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Human umbilical vein endothelial cells (HUVEC) and human acute monocytic leukemia cell line (THP-1) were purchased from ATCC or Clonetics. Daidzein, Biochanin A, and Equol were purchased from Indofine Chemicals. Genistein and chlorinated analogs of daidzein were prepared as previously described (21). Purity was assessed by MS/MS. The structure of all isoflavones used in this study are shown in Figure 1. Cell Tracker Green (CMFDA, C2925) or BCECF-AM fluorescent dyes were purchased from Molecular Probes. TNF-{alpha} and RPMI 1640 were purchased from Sigma Chemical. Endothelial growth medium (EGM) and the supplements (CC-3124) were purchased from Cambrex Biosciences. Rosiglitazone and GW 9662 were purchased from Cayman Chemicals. The nucleofection reagents and the green fluorescent protein (GFP)8 plasmid were purchased from Amaxa Biosystems. All other chemicals used in this study were of analytical grade.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
Figure 1  Structures of isoflavones used in this study.

 
    Cell culture and viability. HUVEC were used between passages 3 and 7 and cultured as previously described (20). All experiments were performed within 1 d of cells reaching confluency. THP-1 cells were maintained in RPMI 1640 as previously described (20). For adhesion experiments under static or flow conditions, monocytes were labeled with cell-tracker green (1 µmol/L) as previously described (20). Endothelial cells were treated with either TNF-{alpha} or different isoflavones (1 µmol/L, 16 h) as shown, washed with sterile warm PBS (2 times), and then used in adhesion assays. Due to varying specific activities of TNF-{alpha} from one batch to another, the concentrations that increased monocyte adhesion to endothelial cells by 50% under static conditions were determined (varied between 2 and 10 µg/L) and those concentrations were used in this study.

    Static adhesion assay. HUVEC were grown in 48-well plates and treated with isoflavones (1 µmol/L) for 16 h and during the last 4 h were coincubated with or without TNF-{alpha}. The percentage of monocyte adhesion under static conditions was then measured as previously described (20) using a final monocyte:endothelial cell ratio of 6:1 for 30 min.

    In vitro flow assay. HUVEC were cultured in 35 mm dishes and treated with vehicle or isoflavones (1 mol/L, 16 h) and during the last 4 h were coincubated with or without TNF-{alpha}. Leukocyte rolling and firm adhesion during flow was then determined as previously described (20) using the Glycotech flow chamber system and at flow rates of 300 µL/min (37°C) corresponding to a wall shear rate (or shear stress that the endothelial cells experience) of 1.5 dynes/cm2. Cells were viewed on a Leica inverted fluorescence microscope equipped with a Hamamatsu Orca ER digital CCD camera (Compix) and real-time images of each field captured at 33 frames/s for 2 min, and the resulting time-lapse images were analyzed by motion tracking analysis using Automated Image Capture and Motion Tracking and Analysis software (Simple PCI, Compix). Any cell that did not move for 5 s or more was considered firmly bound and numbers calculated per min of data acquired.

    PPRE reporter assay. Activation of PPAR{gamma}-dependent genes was assessed by evaluating the ability of isoflavones to stimulate the PPAR{gamma}-promoter responsive element (PPRE) linked to the luciferase gene. For these studies, HUVEC were transiently transfected with a CD36 reporter construct with (–273) or without (–261) its PPRE (transcription start site +1) (22) and inserted into pGL3b vector (Promega) (2 µg) (both kindly provided by Dr. Tom McIntyre) using Nucleofector according to manufacturer's instructions. HUVEC were cotransfected with GFP or ß-galactosidase (0.5–1 µg) to control for transfection efficiency. HUVEC were treated after transfection with isoflavones (1 µmol/L) or rosiglitazone (2 µmol/L) in EGM complete medium with 2% fetal bovine serum (FBS) for 16 h. All transfection experiments with peroxisomal proliferator response element (PPRE)-luciferase constructs included a luciferase control vector, pGL3b, as a negative control and the data were normalized to either ß-galactosidase or GFP.

    Measurement of luciferase activity. After treatment, cultures were rinsed twice with PBS, lysed with passive lysis buffer (Promega), centrifuged at 16,000 x g for 1 min, and the supernatants were collected. Luciferase activity was measured using Luciferase Assay Reagent (Promega) according to manufacturer's directions. Transfection efficiency was determined by measuring ß-galactosidase activity (Promega) at 420 nm using o-nitrophenyl ß-d-galactopyranoside (Sigma) as the substrate. Alternatively, the GFP fluorescence (excitation 485 nm, emission 535 nm) was measured to control for transfection. Changes in reporter gene activity were calculated as a fold change in luciferase activity using the PPRE (–273) vs. PPRE-negative (–261) construct.

    siRNA-dependent knockdown of PPAR{gamma}. HUVEC (passages 3–5) were grown (seed density of 12000 cells/cm2) in antibiotic free-EGM-2 medium containing 2% FBS until 50–60% confluence. Lipofectamine-siRNA transfection complexes were prepared by mixing 4 µL of Lipofectamine 2000 (Invitrogen) in 500 µL of OPTI-MEM with an appropriate amount of PPAR{gamma} siRNA [sequence: 5'AAUGGAAGACCACUCCCACUC 3' (Qiagen)], previously shown to be effective in downregulating PPAR{gamma} in endothelial cells (23) to reach a final concentration of 300 nmol/L. The siRNA-lipofectamine complex was incubated at room temperature for 20 min and then added by drops into 1 well of a 6-well plate (2 mL volume) followed by gentle mixing. After 8 h the medium was changed to EGM containing 2% FBS. After 40 h HUVEC were treated with genistein and adhesion of monocytes determined as described above. In parallel incubations, cell lysates were collected after 40 h and percentage knockdown of PPAR{gamma} was determined by Western blot using 20 µg protein and separated by SDS-PAGE and wet-transfer to nitrocellulose membranes. Membranes were probed with anti-human PPAR{gamma} monoclonal antibody (SantaCruz Biotechnology) and developed using SuperSignal West Dura chemiluminescent substrate (Pierce Biotechnology). Band intensities were quantified using Scion Image software and normalized to ß-actin. In parallel, controls using an equal amount of nonsilencing siRNA (sequence: 5'CUUACGCUGAGUACUUCGA 3') and RNA-free lipofectamine control were also performed.

    Statistical methods. In vitro flow and static adhesion experiments were conducted in triplicate and repeated at least 3 times. For in vitro flow experiments, data are plotted as fold changes relative to TNF-{alpha}. Significance was assessed using Student's t test (for data in Fig. 2) and ANOVA (for data in Figs. 35) with post hoc analysis using Tukey test. Significance was set at a value of P < 0.05.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
Figure 2  Genistein inhibits monocyte adhesion during flow via endothelial PPAR{gamma}. siRNA decreased PPAR{gamma} in HUVEC (Panel A) and reversed the antiadhesive effects of genistein (Panel B). A representative Western blot is shown (A). Quantitative data are expressed as fold of the control and are means ± SEM, n = 3–5. *Different from control, P = ≤ 0.05. Data are expressed as fold of TNF{alpha} and are means ± SEM, n = 3–5 (B). *Different from TNF{alpha}, P = ≤ 0.05.

 

Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
Figure 3  Isoflavones activate PPAR{gamma} promoter activity in HUVEC transfected with PPRE-reporter plasmids. Data are expressed as fold of the control (i.e., no isoflavone treated cells) and are means ± SEM, n = 3–6. Also shown are vehicle (methanol and DMSO for isoflavones and rosliglitazone, respectively) controls and effects of genistein in cells transfected with PPRE-negative plasmids. *Different from control, P = ≤ 0.005.

 

Figure 5
View larger version (9K):
[in this window]
[in a new window]

 
Figure 5  Effects of isoflavone chlorination on PPAR{gamma} agonist activity (Panel A) and monocyte adhesion during flow (Panel B). Data are expressed as fold of control (i.e., no treatment for Panel A and TNF{alpha} alone for Panel B) and are means ± SEM, n = 3–6, *Different from control, P = ≤ 0.05.

 

Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
Figure 4  Isoflavones inhibit monocyte adhesion to TNF-{alpha} activated HUVEC only in the presence of flow (Panel B) but not under static conditions (Panel A). Data are expressed as fold of control (i.e., no treatment for Panel A and TNF{alpha} for Panel B) and are means ± SEM, n = 6–12. *Different from control, P ≤ 0.005, #Different from control, P ≤ 0.02.

 

    Results
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
    Genistein mediated inhibition of monoycte adhesion during flow is dependent on PPAR{gamma}. To test whether genistein-mediated inhibition of monocyte adhesion during flow is PPAR{gamma}-dependent, an siRNA-based approach was used. siRNA effectively decreased PPAR{gamma} levels by ~75% compared with scrambled (nonsilencing) siRNA and empty vector controls (Fig. 2A). The addition of genistein to control or nonsilencing siRNA-treated cells significantly inhibited monocyte adhesion during flow (Fig. 2B). This inhibition is completely reversed, however, in cells treated with PPAR{gamma} siRNA.

    Isoflavones activate PPAR{gamma}-dependent gene transcription in endothelial cells. To assess the PPAR{gamma} agonist activity of genistein and other structurally distinct isoflavones, HUVEC were transiently transfected with a plasmid containing the PPRE or corresponding control plasmids (empty or containing luciferase without PPRE). Isoflavones were then added to test their ability to stimulate PPAR{gamma}-dependent gene transcription. The synthetic PPAR{gamma} ligand rosiglitazone (positive control) and all the isoflavones tested, but not vehicle controls, increased PPRE-linked luciferase relative to control (i.e., no isoflavone treatment) cells transfected with PPRE containing plasmid (Fig. 3). Genistein increased luciferase activity to >3-fold that of the control. Relative to genistein, the effects of biochanin A were similar, whereas daidzein and equol activated PPAR{gamma} to a lesser extent. Importantly, genistein did not increase luciferase in cells transfected with PPRE-negative (–261) plasmids (control plasmid).

    Isoflavones inhibit leukocyte-endothelial adhesion during flow. To test if PPAR{gamma} activation is translated into a functional inhibition of monocyte adhesion, the effects of these polyphenols on static- and flow-dependent monocyte adhesion was determined. Under static conditions, none of the isoflavones tested affected TNF-{alpha} induced THP-1 adhesion (Fig. 4A). However, in the presence of flow, all isoflavones inhibited monocyte adhesion consistent with the hypothesis that PPAR{gamma} plays a critical role in this inhibition (Fig. 4B).

    Chlorination of daidzein modulates their ability to activate PPAR{gamma} and inhibit monocyte adhesion. We have shown that isoflavones can be chlorinated by hypochlorous acid formed during the phagocytic respiratory burst and that, in turn, this modification alters the antioxidant activity of these compounds (21,24). To test if chlorination affects PPAR{gamma} activation, and to gain further insights into the structural determinants that regulate isoflavone activation of PPAR{gamma}, specific chlorinated isomers of daidzein (see Fig. 1) were tested. These isomers have been synthesized to purity and, importantly, are formed upon exposure of the parent isoflavone to cellular-derived hypochlorous acid (21). Chlorination of daidzein at the 6- or 8-position ablated its ability to activate PPAR{gamma}-dependent transcription, whereas chlorination at the 3' position had little effect (Fig. 5A). Moreover, these effects on PPAR{gamma} agonist activity were reflected functionally on monocyte adhesion. Specifically, modification at the 6- or 8-position also reversed the inhibitory effects of daidzein on monocyte adhesion during flow, whereas chlorination at the 3'-position had no effect, with 3'-Cl-daidzein inhibiting flow-dependent monocyte adhesion to TNF-{alpha}-activated HUVEC to a similar extent compared with native daidzein (Fig. 5B).


    Discussion
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Many studies have documented an association between the consumption of isoflavones and protection against cardiovascular disease. However, a more recent meta-analysis of controlled trials concluded that isoflavones (within the context of soy-based diets) confer only minimal cardiovascular benefits (25). These conclusions are based primarily on the effects of isoflavone consumption on cholesterol-lowering effects. However, few insights as to the potential effects of isoflavones on other elements of vascular disease were provided. This is critical because isoflavones exhibit antioxidant effects in vitro (2628) and in vivo (7,8) and have more recently been shown to modulate vascular cell function that would limit vascular disease. Potential mechanisms for the latter include increasing nitric oxide bioavailability (911) and stimulating anti-inflammatory signaling pathways (12,13). The present data supports the latter concept, forwarding a critical role for isoflavones as inhibitors of inflammatory interactions between monocytes and endothelial cells.

Monocyte rolling and adhesion to endothelial cells are among the early steps of the inflammatory cascade that ultimately leads to development of atherosclerotic lesions. We have shown that isoflavones at low biologically relevant concentrations (discussed below) do not modulate adhesion of monocytes to endothelial cells under static conditions [Fig. 4A and (20)]. However, monocyte adhesion in vivo occurs in the presence of flow and associated physical forces. Moreover, flow itself is a critical regulator of endothelial function with shear stress being shown to exhibit anti-inflammatory effects through multiple acute and chronic mechanisms, which underscores the importance of incorporating flow into experimental studies testing leukocyte-endothelial adhesion. Interestingly, when assessed during flow, isoflavones significantly inhibited TNF-{alpha} induced monocyte adhesion. The experimental protocol used suggests that isoflavones modulate how endothelial cells respond to inflammatory stimuli in the presence of physical forces associated with acute flow. It is important to distinguish this from chronic shear stress–mediated effects. In summary, our data suggest that long-term exposure to isoflavones regulate how endothelial cells respond to inflammatory stimuli, which are only functionally observed in the presence of flow (i.e., monocyte adhesion).

These antiadhesive effects of isoflavones are not mediated by their potential antioxidant activity, estrogenic potential, ability to inhibit tyrosine phosphorylation, nor by affecting expression of the adhesion molecules [i.e., endothelial selectin, vascular cell adhesion molecule-1 (VCAM-1), intercellular cell adhesion molecule-1 (ICAM-1), or platelet endothelial cell adhesion molecule-1 (PECAM-1)], typically involved in mediating monocyte-endothelial cell interactions (20). These data do not exclude a role for other adhesion molecules nor potential effects of genistein on post-translational regulation of adhesion molecule function. These possibilities are currently under investigation. Our study focused on elucidating the molecular mechanisms involved and demonstrated that, using both reporter assays and siRNA targeting, PPAR{gamma} plays a critical role. These data are consistent with previous reports documenting a PPAR{gamma} agonist activity of isoflavones in adipocytes and macrophages (4,15,16). The PPAR{gamma} function in the endothelium and PPAR{gamma} agonist activity of isoflavones are not extensively characterized. It is important to note that synthetic/endogenous ligands of PPAR{gamma} also prevent inflammatory monocyte-endothelial interactions during flow (29) similar to the effects reported herein. Moreover, all tested isoflavones that inhibited monocyte adhesion also activated PPAR{gamma} binding to its promoter response element and subsequent transcription. Furthermore, siRNA, targeted to PPAR{gamma}, but not scrambled siRNA, reversed genistein-mediated inhibition of monocyte adhesion. Recent reports suggest that 8 h of exposure to shear stress can activate PPAR{gamma} in endothelial cells (23) which could account for the effects of siRNA observed herein. However, in our studies, endothelial cells are exposed only to acute shear stress (for 1–2 min), precluding significant PPAR{gamma}-dependent transcription due to shear stress alone. Taken together, these data support 1) a critical role for endothelial PPAR{gamma} in modulating monocyte rolling and adhesion and 2) the potential importance of endothelial PPAR{gamma} as a molecular target for the anti-inflammatory effects of isoflavones.

Another critical variable in any effect of isoflavones is their specific composition within foods and commercially available botanical-based supplements, which varies widely and may contribute to disparate biological effects as discussed above. The issue is further complicated with the recognition that isoflavone metabolism involves glucuronidation, sulfation, and potential modification by reactive chlorinating and nitrating agents, and will depend on the specific composition of gut microflora and the degree of inflammatory stress (30,31). Our study demonstrates that structurally distinct isoflavones are able to inhibit monocyte adhesion to endothelial cells through the activation of PPAR{gamma}-dependent pathways. Furthermore, these effects are observed at low biologically relevant concentrations, which, for genistein can range between 0.3 and 0.8µmol/L in the circulation (3234).

The isoflavones tested in Figures 3 and 4 vary significantly in their antioxidant activities, but they all stimulated PPAR{gamma}-dependent gene transcription (Fig. 3) and inhibited monocyte adhesion (Fig. 4B). The structures (Fig. 1) of genistein, daidzein, biochanin A, and equol show that the hydroxyl group at the 7-position on the A-ring is a common structural feature of these isoflavones. The 5-hydroxy-ketone moiety is absent in equol and daidzein. In the case of biochanin A, methylation of the 4'-OH occurs. The fact that all the isoflavones displayed PPAR{gamma} agonist activity indicates a central role for the 7-OH group on the A-ring in this process. Data shown in Figure 3 would also suggest a role for the hydroxyl group on the 5-position of the A-ring because biochaninA and genistein (which both contain this group) showed greater PPAR{gamma} agonist activity compared with daidzein or equol (which lack this group).

To further determine the structural elements involved, we tested a variety of chlorinated daidzein derivatives. Chlorination at the 3'-position did not alter PPRE-dependent luciferase expression or effects on monocyte adhesion. However, modification at the 6- or 8-position on the A-ring attenuated these effects of daidzein. Together with the structure-activity insights discussed above, these data suggest that the isoflavone A-ring is critical in mediating specific interactions with PPAR{gamma}. We showed that chlorination of isoflavones occurs by phagocyte-derived hypochlorous acid, resulting in products with altered antioxidant properties toward lipid-based radicals (21). The present data extend these concepts to include modulation of endothelial PPAR{gamma} activity and suggest that halogenation on the A-ring will inhibit, but on the B-ring will have no affect on the anti-inflammatory properties.

In summary, this study demonstrates that isoflavones may protect against inflammatory vascular disease by inhibiting monocyte-endothelial cell adhesion through a mechanism that is absolutely dependent on flow and involves activation of endothelial PPAR{gamma}. However, phagocyte-derived hypochlorous acid and chlorination of isoflavones at the 6- or 8-positions on the A-ring, but not the 3'-position in the B-ring, prevent the antiadhesive effects of these isoflavones.


    ACKNOWLEDGMENTS
 
We thank Dr. Tom McIntyre (Lerner Research Institute, Cleveland, OH) for providing PPRE-constructs.


    FOOTNOTES
 
1 This work was supported by an AHA-southeastern postdoctoral fellowship to B.K.C., a NIH cardiovascular training grant T32 HL007918-08 to T.L.D., and support from the Purdue-UAB Botanicals Center for Age-Related Disease P50 AT00477 (Connie Weaver, PI) grant from the National Center for Complementary and Alternative Medicine. Back

8 Abbreviations used: EGM, endothelial growth medium; FBS, fetal bovine serum; GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cells; PPRE, peroxisomal proliferator response element; THP-1, human acute monocytic leukemia cell line. Back

Manuscript received 7 September 2006. Initial review completed 3 October 2006. Revision accepted 7 November 2006.


    LITERATURE CITED
 TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Lissin LW, Cooke JP. Phytoestrogens and cardiovascular health. J Am Coll Cardiol. 2000;35:1403–10.[Abstract/Free Full Text]

2. Anthony MS, Clarkson TB, Williams JK. Effects of soy isoflavones on atherosclerosis: potential mechanisms. Am J Clin Nutr. 1998;68:1390S–3S.[Abstract]

3. Barnes S. Soy isoflavones–phytoestrogens and what else? J Nutr. 2004;134:1225S–8S.[Abstract/Free Full Text]

4. Mezei O, Banz WJ, Steger RW, Peluso MR, Winters TA, Shay N. Soy isoflavones exert antidiabetic and hypolipidemic effects through the PPAR pathways in obese Zucker rats and murine RAW 264.7 cells. J Nutr. 2003;133:1238–43.[Abstract/Free Full Text]

5. Tikkanen MJ, Adlercreutz H. Dietary soy-derived isoflavone phytoestrogens. Could they have a role in coronary heart disease prevention? Biochem Pharmacol. 2000;60:1–5.[Medline]

6. Yamakoshi J, Piskula MK, Izumi T, Tobe K, Saito M, Kataoka S, Obata A, Kikuchi M. Isoflavone aglycone-rich extract without soy protein attenuates atherosclerosis development in cholesterol-fed rabbits. J Nutr. 2000;130:1887–93.[Abstract/Free Full Text]

7. Wiseman H, O'Reilly JD, Adlercreutz H, Mallet AI, Bowey EA, Rowland IR, Sanders TA. Isoflavone phytoestrogens consumed in soy decrease F(2)-isoprostane concentrations and increase resistance of low-density lipoprotein to oxidation in humans. Am J Clin Nutr. 2000;72:395–400.[Abstract/Free Full Text]

8. Tikkanen MJ, Wahala K, Ojala S, Vihma V, Adlercreutz H. Effect of soybean phytoestrogen intake on low density lipoprotein oxidation resistance. Proc Natl Acad Sci U S A. 1998;95:3106–10.[Abstract/Free Full Text]

9. Squadrito F, Altavilla D, Crisafulli A, Saitta A, Cucinotta D, Morabito N, D'Anna R, Corrado F, Ruggeri P, et al. Effect of genistein on endothelial function in postmenopausal women: a randomized, double-blind, controlled study. Am J Med. 2003;114:470–6.[Medline]

10. Squadrito F, Altavilla D, Morabito N, Crisafulli A, D'Anna R, Corrado F, Ruggeri P, Campo GM, Calapai G, et al. The effect of the phytoestrogen genistein on plasma nitric oxide concentrations, endothelin-1 levels and endothelium dependent vasodilation in postmenopausal women. Atherosclerosis. 2002;163:339–47.[Medline]

11. Walker HA, Dean TS, Sanders TA, Jackson G, Ritter JM, Chowienczyk PJ. The phytoestrogen genistein produces acute nitric oxide-dependent dilation of human forearm vasculature with similar potency to 17beta-estradiol. Circulation. 2001;103:258–62.

12. Gottstein N, Ewins BA, Eccleston C, Hubbard GP, Kavanagh IC, Minihane AM, Weinberg PD, Rimbach G. Effect of genistein and daidzein on platelet aggregation and monocyte and endothelial function. Br J Nutr. 2003;89:607–16.[Medline]

13. Verdrengh M, Jonsson IM, Holmdahl R, Tarkowski A. Genistein as an anti-inflammatory agent. Inflamm Res. 2003;52:341–6.[Medline]

14. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology. 1998;139:4252–63.[Abstract/Free Full Text]

15. Ricketts ML, Moore DD, Banz WJ, Mezei O, Shay NF. Molecular mechanisms of action of the soy isoflavones includes activation of promiscuous nuclear receptors. A review. J Nutr Biochem. 2005;16:321–30.[Medline]

16. Dang ZC, Audinot V, Papapoulos SE, Boutin JA, Lowik CW. Peroxisome proliferator-activated receptor gamma (PPARgamma) as a molecular target for the soy phytoestrogen genistein. J Biol Chem. 2003;278:962–7.[Abstract/Free Full Text]

17. Sasaki M, Jordan P, Welbourne T, Minagar A, Joh T, Itoh M, Elrod JW, Alexander JS. Troglitazone, a PPAR-gamma activator prevents endothelial cell adhesion molecule expression and lymphocyte adhesion mediated by TNF-alpha. BMC Physiol. 2005;5:3.[Medline]

18. Calnek DS, Mazzella L, Roser S, Roman J, Hart CM. Peroxisome proliferator-activated receptor gamma ligands increase release of nitric oxide from endothelial cells. Arterioscler Thromb Vasc Biol. 2003;23:52–7.[Abstract/Free Full Text]

19. Wang N, Verna L, Chen NG, Chen J, Li H, Forman BM, Stemerman MB. Constitutive activation of peroxisome proliferator-activated receptor-gamma suppresses pro-inflammatory adhesion molecules in human vascular endothelial cells. J Biol Chem. 2002;277:34176–81.[Abstract/Free Full Text]

20. Chacko BK, Chandler RT, Mundhekar A, Khoo N, Pruitt HM, Kucik DF, Parks DA, Kevil CG, Barnes S, Patel RP. Revealing anti-inflammatory mechanisms of soy isoflavones by flow: modulation of leukocyte-endothelial cell interactions. Am J Physiol Heart Circ Physiol. 2005;289:H908–15.[Abstract/Free Full Text]

21. Boersma BJ, D'Alessandro T, Benton MR, Kirk M, Wilson LS, Prasain J, Botting NP, Barnes S, Darley-Usmar VM, Patel RP. Neutrophil myeloperoxidase chlorinates and nitrates soy isoflavones and enhances their antioxidant properties. Free Radic Biol Med. 2003;35:1417–30.[Medline]

22. Davies SS, Pontsler AV, Marathe GK, Harrison KA, Murphy RC, Hinshaw JC, Prestwich GD, Hilaire AS, Prescott SM, et al. Oxidized alkyl phospholipids are specific, high affinity peroxisome proliferator-activated receptor gamma ligands and agonists. J Biol Chem. 2001;276:16015–23.[Abstract/Free Full Text]

23. Liu Y, Zhu Y, Rannou F, Lee TS, Formentin K, Zeng L, Yuan X, Wang N, Chien S, et al. Laminar flow activates peroxisome proliferator-activated receptor-gamma in vascular endothelial cells. Circulation. 2004;110:1128–33.

24. Boersma BJ, Patel RP, Kirk M, Jackson PL, Muccio D, Darley-Usmar VM, Barnes S. Chlorination and nitration of soy isoflavones. Arch Biochem Biophys. 1999;368:265–75.[Medline]

25. Sacks FM, Lichtenstein A, Van Horn L, Harris W, Kris-Etherton P, Winston M. Soy protein, isoflavones, and cardiovascular health: an American Heart Association Science Advisory for professionals from the Nutrition Committee. Circulation. 2006;113:1034–44.

26. Kapiotis S, Hermann M, Held I, Seelos C, Ehringer H, Gmeiner BM. Genistein, the dietary-derived angiogenesis inhibitor, prevents LDL oxidation and protects endothelial cells from damage by atherogenic LDL. Arterioscler Thromb Vasc Biol. 1997;17:2868–74.[Abstract/Free Full Text]

27. Kerry N, Abbey M. The isoflavone genistein inhibits copper and peroxyl radical mediated low density lipoprotein oxidation in vitro. Atherosclerosis. 1998;140:341–7.[Medline]

28. Patel RP, Boersma BJ, Crawford JH, Hogg N, Kirk M, Kalyanaraman B, Parks DA, Barnes S, Darley-Usmar V. Antioxidant mechanisms of isoflavones in lipid systems: paradoxical effects of peroxyl radical scavenging. Free Radic Biol Med. 2001;31:1570–81.[Medline]

29. Cui T, Schopfer FJ, Zhang J, Chen K, Ichikawa T, Baker PR, Batthyany C, Chacko BK, Feng X, et al. Nitrated fatty acids: Endogenous anti-inflammatory signaling mediators. J Biol Chem. 2006;3 [Epub ahead of print].

30. Hall WL, Vafeiadou K, Hallund J, Bugel S, Koebnick C, Reimann M, Ferrari M, Branca F, Talbot D, et al. Soy-isoflavone-enriched foods and inflammatory biomarkers of cardiovascular disease risk in postmenopausal women: interactions with genotype and equol production. Am J Clin Nutr. 2005;82:1260–8; quiz 365–6.[Abstract/Free Full Text]

31. Cassidy A, Brown JE, Hawdon A, Faughnan MS, King LJ, Millward J, Zimmer-Nechemias L, Wolfe B, Setchell KD. Factors affecting the bioavailability of soy isoflavones in humans after ingestion of physiologically relevant levels from different soy foods. J Nutr. 2006;136:45–51.[Abstract/Free Full Text]

32. Urban D, Irwin W, Kirk M, Markiewicz MA, Myers R, Smith M, Weiss H, Grizzle WE, Barnes S. The effect of isolated soy protein on plasma biomarkers in elderly men with elevated serum prostate specific antigen. J Urol. 2001;165:294–300.[Medline]

33. Adlercreutz H, Markkanen H, Watanabe S. Plasma concentrations of phyto-oestrogens in Japanese men. Lancet. 1993;342:1209–10.[Medline]

34. Coward L, Kirk M, Albin N, Barnes S. Analysis of plasma isoflavones by reversed-phase HPLC-multiple reaction ion monitoring-mass spectrometry. Clin Chim Acta. 1996;247:121–42.[Medline]




This article has been cited by other articles:


Home page
LupusHome page
Y. Hong, T. Wang, C. Huang, W. Cheng, and B. Lin
Soy isoflavones supplementation alleviates disease severity in autoimmune-prone MRL-lpr/lpr mice
Lupus, September 1, 2008; 17(9): 814 - 821.
[Abstract] [PDF]


Home page
Am. J. Clin. Nutr.Home page
C. M Weaver, S. Barnes, J M. Wyss, H. Kim, D. M Morre, D J. Morre, J. E Simon, M. A. Lila, E. M Janle, and M. G Ferruzzi
Botanicals for age-related diseases: from field to practice
Am. J. Clinical Nutrition, February 1, 2008; 87(2): 493S - 497S.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. Nagarajan, R. L. Burris, B. W. Stewart, J. E. Wilkerson, and T. M. Badger
Dietary Soy Protein Isolate Ameliorates Atherosclerotic Lesions in Apolipoprotein E-Deficient Mice Potentially by Inhibiting Monocyte Chemoattractant Protein-1 Expression
J. Nutr., February 1, 2008; 138(2): 332 - 337.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chacko, B. K.
Right arrow Articles by Patel, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chacko, B. K.
Right arrow Articles by Patel, R. P.
Right arrowPubmed/NCBI databases
*Substance via MeSH


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by American Society for Nutrition