Journal of Nutrition EB Program 2010 Early Registration

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Z.
Right arrow Articles by Mason, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Z.
Right arrow Articles by Mason, J. B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diets
Hazardous Substances DB
*FOLIC ACID
© 2007 American Society for Nutrition J. Nutr. 137:2701-2708, December 2007

Nutrition and Disease

Mild Depletion of Dietary Folate Combined with Other B Vitamins Alters Multiple Components of the Wnt Pathway in Mouse Colon1,2

Zhenhua Liu3, Sang-Woon Choi3, Jimmy W. Crott3, Mary K. Keyes3, Hyeran Jang3, Donald E. Smith4, Myungjin Kim5, Peter W. Laird5, Roderick Bronson6 and Joel B. Mason3,7,*

3 Vitamins and Carcinogenesis Laboratory, 4 Comparative Biology Unit, Jean Mayer U.S. Department of Agriculture Human Nutrition Research Center on Aging, Tufts University, Boston, MA 02111; 5 Departments of Surgery and of Biochemistry and Molecular Biology, University of Southern California/Norris Comprehensive Cancer Center, Los Angeles, CA 90089; 6 Department of Pathology, Harvard Medical School, Boston, MA 02115; and 7 Divisions of Clinical Nutrition and Gastroenterology, New England Medical Center, Boston, MA 02111

* To whom correspondence should be addressed. E-mail: joel.mason{at}tufts.edu.


   ABSTRACT
TOP
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Preclinical and clinical studies suggest that diminished folate status increases the risk of colorectal carcinogenesis. However, many biochemical functions of folate are dependent on the adequate availability of other 1-carbon nutrients, including riboflavin, vitamin B-6, and vitamin B-12. Aberrations in the Wnt pathway are thought to play an important role in human colorectal cancers. This study therefore investigated if mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12 could induce alterations in the Wnt pathway in the colonic mucosa. Ninety-six mice were pair-fed diets with different combinations of B vitamin depletion for 10 wk. Genomic DNA methylation and uracil misincorporation were measured by LC/MS and GC/MS. Gene-specific methylation, strand breaks, and expressions were measured by real-time PCR and immunoblotting. Proliferation and apoptosis were determined by immunohistochemistry. DNA strand breaks within the Apc mutation cluster region were induced by folate depletion combined with inadequacies of riboflavin, vitamin B-6, and vitamin B-12 (P < 0.05), but such effects were not induced by folate depletion alone. Similarly, minor changes in the expression of Apc, ß-catenin, and cyclin D1 produced by mild folate depletion were significantly magnified by multiple vitamin depletion. Apoptosis, which can be suppressed by increased Wnt-signaling, was attenuated by the combined deficiency state (P < 0.05) but not by singlet or doublet deficiencies. These findings indicate that a mild depletion of folate that is of insufficient magnitude by itself to induce alterations in components of the Wnt pathway may produce such effects when present in conjunction with mild inadequacies of other 1-carbon nutrients.


   Introduction
TOP
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 
Epidemiologic observations as well as preclinical studies suggest that diminished folate status increases the risk of colorectal carcinogenesis (1,2). The underlying mechanism for this effect appears to relate to folate's role as an essential cofactor in biological methylation and nucleotide synthesis (3,4), because it is presently thought that anomalies in DNA methylation and in DNA synthesis are among the most common molecular alterations that contribute to the development of human neoplasia (5,6). Thus, mechanistic studies provide considerable support for a true cause and effect relationship between inadequate dietary folate and enhanced rates of colorectal cancer.

The maintenance of normal patterns of biological methylation and nucleotide synthesis depends not only upon adequate availability of folate but also on the adequate availability of other 1-carbon nutrients, including riboflavin, vitamin B-6, and vitamin B-12 (7). Although folate plays a central role in the synthesis of S-adenosylmethionine (the universal methyl donor for biological methylation) and in the synthesis of nucleotides, the other above-mentioned vitamins also assume critical roles as cofactors in the 1-carbon metabolic network (Fig. 1): riboflavin is a precursor for the cofactor of methylenetetrahydrofolate reductase, which catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate (8); vitamin B-12 is a cofactor for methionine synthase, a reaction in which 5-methyltetrahydrofolate participates as a substrate in the remethylation of homocysteine to form methionine (8); and vitamin B-6 is a necessary cofactor for the inter-conversion of other coenzymatic forms of folate and the metabolism of homocysteine (9). Thus, the metabolic functions of all these 1-carbon vitamins are highly inter-dependent, so depletion of one may lead to biochemical phenotypes characteristic of deficiencies of the others. This study was therefore designed to define biochemical and molecular pathways by which carcinogenesis is modulated when riboflavin, vitamin B-6, and/or vitamin B-12 depletion are superimposed on folate depletion.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 1  Impact of folate and other B vitamins on biological methylation and nucleotide synthesis in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12. SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; DHF, dihydrofolate; THF, tetrahydrofolate.

 
Aberrant signaling along the Wnt pathway is an early event in 90% of human colorectal cancers and is thought to play an important mechanistic role (10). A variety of mutational and epigenetic silencing events in Wnt pathway genes, which ultimately effect decreased degradation of ß-catenin and increased catenin-mediated transcription of pro-carcinogenic genes, have been identified in human colon neoplasia (11,12). Classical mutations of Apc are often present, but de novo methylation of the Apc promoter region also plays an important role as a "second hit" in silencing Apc expression in colorectal neoplasia (13). We recently reported that Apc expression is also impaired by a severe degree of folate depletion: after 5 wk of depletion, strand breaks appeared in Apc gene and these breaks were inversely correlated to steady-state transcriptional levels of Apc (4). Thus, there is evidence that Wnt signaling could be altered by dietary inadequacy of folate, albeit in response to a deficiency state of severe proportions. Therefore, the expression of Apc and the ß-catenin gene, along with some of their downstream effects, were selected to investigate the mechanistic linkage between 1-carbon nutrients and carcinogenesis in this study.

Flagrant deficiencies of 1-carbon nutrients are rare in the industrialized world. In contrast, marginal status is relatively common. For instance, population-based studies have reported that 18–25% of adults have low vitamin B-6 status (14) and 10–20% of healthy elders are thought to have marginal vitamin B-12 status (15). We hypothesized that biochemical and molecular aberrations in the colon due to folate depletion are magnified in the presence of mild inadequacies of other B vitamins in a manner that would not otherwise be observed with folate depletion alone. We therefore designed a mouse study to examine the proposed synergies between these vitamins in regard to how they might impact on Wnt pathway. We intentionally used very mild levels of vitamin inadequacy that produce no anemia or outward signs of disease to simulate the marginal but not flagrant inadequacies that are common in the general population. In addition, we intentionally chose to study a mouse strain that is not predisposed to colorectal neoplasia, because we wished to examine the molecular and biochemical effects of these states of vitamin restriction in the absence of the confounding effects of a colon that is intrinsically driven toward neoplastic transformation.


   Materials and Methods
TOP
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 LITERATURE CITED
 
    Mice and diets. The protocol was approved by the Institutional Animal Care and Use Committee of the Jean Mayer USDA Human Nutrition Research Center on Aging at Tufts University. C57BL/6J male mice were used and housed individually in a temperature-controlled (24°C) room, given ad libitum access to water and group pair-fed their respective diet. No animals were observed to develop anemia or appear ill. Ninety-six 4-mo-old mice were weight-matched and assigned to 1 of 6 amino acid-defined diets (16), each containing different levels of folate and riboflavin, vitamin B-6, and vitamin B-12. Table 1 describes the vitamin composition of the 6 diets; the diet composition was otherwise identical to that described by Walzem and Clifford (16), except that 50 g of pectin/kg of diet was incorporated into each diet to facilitate the depletion of vitamin B-12. Unlike the typical Western diet, this diet is modest in fat (22.5% of total energy), adequate in fiber (50 g/kg of diet), and contains adequate amounts of vitamin D and calcium [2.5 mg of vitamin D3 in sucrose (equal to 1000 IU)/kg of diet and 5.1 g of calcium/kg of diet, respectively]. All diets were made by Harlan Teklad. The vitamin concentrations of each diet were chemically analyzed and confirmed (data not shown) by Covance, utilizing those methods adopted by AOAC International (17). We also confirmed the folate content of each diet with the microbiologic assay and found that the actual concentrations never varied >10% from the stated value. Although no folate was present in the folate-deplete diet, succinylsulfathiazole was not added and therefore folate synthesis by the intestinal microflora was able to occur, which prevents the development of severe folate deficiency (16).


View this table:
[in this window]
[in a new window]

  		TABLE 1 Composition of vitamin mix in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12

 
    Tissue preparation. After 10 wk of the feeding trial, all mice were anesthetized and then exsanguinated by cardiac puncture. Colonocytes were isolated from 8 mice in each group with 30 mM EDTA at 4°C as previously described (18) for subsequent DNA and RNA extraction (Easy DNA kit and Trizol, Invitrogen). All DNA and RNA samples had 260/280 spectrophotometry absorption ratios >1.6 and >1.8, respectively. This DNA and RNA was later used for measurements of genomic and gene-specific DNA methylation, uracil misincorporation, and analyses of DNA strand breaks and gene expression. The mucosa from the other 8 mice was gently removed by scraping after being washed with ice-cold saline. These mucosal scrapings were later used for analyses of tissue folate and protein expression. A central segment of colon was excised and fixed in 10% buffered formalin overnight followed by paraffin embedding.

    Measurement of blood and tissue vitamin status. Plasma folate was measured by radioimmunoassay (Bio-Rad Laboratories); riboflavin was measured by the erythrocyte glutathione reductase activation coefficient assay (19); vitamin B-6 (pyridoxal phosphate) was measured by a radioenzymatic assay (20); and vitamin B-12 was measured by a competitive protein-binding assay (Bio-Rad Laboratories). Plasma homocysteine was measured by HPLC with fluorescence detection (21) and colonic folate was determined by a conventional microbiological microtiter plate assay using Lactobacillus casei assay as previously described (22).

    Genomic DNA methylation and uracil misincorporation. Liquid chromatography/electrospray ionization MS was used to analyze genomic DNA methylation. Briefly, DNA was hydrolyzed by sequential digestion with 3 enzymes: nuclease P1, venom phosphodiesterase I, and alkaline phosphatase (23). Identification of cytosine and 5-methylcytosine was obtained by MS analysis of chromatographic peaks. The amount of uracil in DNA was measured by a previously described GC-MS method (24,25).

    Region-specific methylation and strand break assays of the Apc gene. The state of methylation within 3 CpG islands located in upstream portions of the Apc gene, 1 in the promoter region and the other 2 in the first intron, was analyzed by MethyLight as described previously (26). Mouse genomic DNA, treated with the DNA methyltransferase M.SssI, was used to generate standard curves representing log-transformed DNA quantities vs. the Ct value. Methylation-independent reactions for Lhx1 and Guca2a were used to control for input DNA amounts. Apc DNA methylation was reported as a percentage of methylated reference as described (27).

Strand breaks in the mutation cluster region (MCR),8 a region associated with ß-catenin degradation, and the basic domain region (28) of the Apc gene were each measured by real-time PCR. This method is based on the principle that strand breaks inhibit PCR amplification and is a method that has been used by several investigators for over a decade (4,29). The MCR in exon 15 of Apc gene in the mouse extends approximately from base 3750 to 4500 (Fig. 2A) (30). Because the optimal amplicon size for real-time PCR is <300 bp, 3 primer sets, collectively covering >90% of the MCR, were designed (primer pair A, forward: GGCCAGACTCAAAAAGGCAC, reverse: CAGAAGCCTGGAGTCGGCT; primer pair B, forward: CAGCCGACTCCAGGCTTCT, reverse: TGGTGGCATGGTCTGCC; primer pair C, forward: CAAGCAGAAGCAAAACCCCTC, reverse: ACCCGTCTGGAGTACTTTCTGTG). The primers for the region associated with ß-catenin degradation are: forward, ACGCGTGTGAGAAAGAATACAGAC, and reverse: GCTTGAGTTTGGTTCTGGGC. The primers for the basic domain are: forward, CAAAGAAGCTGAACCTGCCAAC, and reverse, TGCCACCCACTTTTCTAGGG. To confirm that breaks in the sequence of interest resulted in incremental reductions in amplification, different percentages of restriction-digested DNA (using a combination of HinfI, MboII, and MnlI; New England Biolabs) were added to vary the amount of intact DNA template while keeping the total amount of DNA constant (Fig. 2B). Although we have previously published data demonstrating that this assay quantitatively assesses DNA strand breaks (29), the assay does not possess absolute specificity, because other aberrations such as abasic sites, bulky adducts, and DNA cross-links may also inhibit amplification.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 2  The effect of vitamin depletion on strand breaks within the Apc MCR in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12. (A) Diagram of the Apc protein (30). Apc _(A–C), The 3 primer sets designed to cover the MCR region. (B) The reaction cycle thresholds (Ct) increased incrementally with the percentage of restriction-digested DNA for each primer set, validating the quantitative nature of each assay's ability to reflect breaks in the DNA backbone. (C) The {Delta}Ct values from all 3 primer sets were combined for the analysis of strand breaks in the whole MCR region. Greater strand breaks were observed in the multiple vitamin depletion group when compared with the folate-sufficient group, P < 0.05.

 
    Real-time PCR assay for Apc and cyclin D1 gene expression. Total RNA was isolated from colonic epithelium with Trizol reagent (Invitrogen) and cDNA was synthesized using oligo d(T) and Superscript II reverse transcriptase (Invitrogen). The expressions of the Apc and cyclin D1 genes were quantified using Taqman Gene Expression Assays and an ABI7300 real-time PCR machine (both from Applied Biosystems). Gene expression was normalized to ß-actin ({Delta}Ct = CtApc – Ctß-actin) and statistical analyses were performed using {Delta}Ct. The relative expression values compared with the folate sufficient group are reported here for clarity and were calculated using the following formula: relative expression = 2–{Delta}{Delta}Ct, where {Delta}{Delta}Ct is {Delta}Ct of vitamin depletion groups – {Delta}Ct of folate sufficient group. The cDNA was equally pooled from each mouse for each group and a regular PCR of Apc gene was performed with cycles within the linear amplification range to further confirm the real-time results.

    Immunoblotting for ß-catenin protein expression and immunohistochemistry for detection of nuclear ß-catenin. For immunoblotting, proteins were separated by electrophoresis on a polyacrylamide gel and transferred onto a nitrocellulose membrane. Nonspecific binding was blocked with nonfat dry milk. The membrane was probed with primary anti-ß-catenin antibody (BD Biosciences) followed by horseradish peroxidase conjugated secondary antibody (Bio-Rad). Chemifluorescence detection was achieved using ECL Plus Substrate (Amersham Biosciences). Protein bands were quantified using a Gel-Doc image analysis system and Quantity One software (Bio-Rad).

For immunohistochemistry, paraffin-embedded slides were deparaffinized in xylene followed by rehydration in ethanol. Endogenous peroxidase blocking was performed with H2O2 and the antigen was retrieved by boiling. The slides were incubated with the anti-ß-catenin primary antibody (BD biosciences) followed by biotinylated horse anti-mouse secondary antibody (Vector Laboratories). Slides were then treated with Vectastain Elite ABC reagent (Vector Laboratories) followed by hematoxylin counterstain.

Coded histological slides were viewed in a blinded fashion using light microscopy at 400x. For immunohistochemical scoring, longitudinal sections of crypts were used; only those with the base touching the muscularis mucosa and having an open lumen at the top qualified for use. A modified semiquantitative scoring system (31) was used to evaluate the staining by the antibody. The degree of positive staining was evaluated by scoring 15–20 crypts from each animal on a scale of 1–5 based on the percentage of positive-staining colonocyte nuclei within that crypt.

    Proliferation cell nuclear antigen and cleaved caspase-3 immunohistochemical assay. Similar immunohistochemical assays were used for proliferation cell nuclear antigen (PCNA) detection (Santa Cruz Biotechnology) and for cleaved caspase-3 detection (Cell Signaling Technology).

For scoring PCNA staining, 10 intact crypts were evaluated for each animal. Each crypt column was divided into 3 compartments from the base to the mouth of the gland. The proliferation index was calculated by determining the number of positive cells per crypt divided by the number of crypt cells; the expansion of the proliferation zone was calculated by determining the number of PCNA-positive cells in the upper two-thirds of the crypt divided by the total number of cells in that crypt. For scoring of caspase-3 staining, any light to heavy staining was considered as positive staining. The total number of apoptotic cells was recorded for all the scorable crypts in each slide. Approximately 50 crypts were counted for each mouse. The quantification of apoptosis was expressed as the number of positive cells per crypt.

In addition, a formalin-fixed 2-cm longitudinal section of the mid-colon of 8 mice in each group was also mounted and stained with hematoxylin and eosin. These segments were read by an expert rodent pathologist (R. Bronson) who was unaware of treatment group assignment.

    Statistical analysis. Data analyses were conducted by 1-way ANOVA for the dietary effect; group comparisons for vitamin status in the blood and tissues as well as genomic DNA methylation were made by Tukey's method, whereas group comparisons for other molecular endpoints were performed with the Dunnett's method in which folate sufficiency or folate depletion served separately as the control. All the analysis was conducted using SAS software v9.1 (SAS Institute). Values in the text are presented as means ± SEM.


   Results
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 LITERATURE CITED
 
    Mild dietary vitamin depletion successfully induced vitamin depletion in blood and tissue. Mild dietary folate depletion resulted in a 30–50% reduction of plasma folate concentration (P < 0.05) in those groups exposed to folate depletion compared with the folate-sufficient group (Table 2). Erythrocyte riboflavin, which was measured in a reciprocal fashion by the activation coefficient, was significantly lower in the groups exposed to depletion of riboflavin compared with the riboflavin-sufficient groups. Plasma pyridoxal 5'-phosphate (vitamin B-6) and vitamin B-12 were ~50% lower (P < 0.05) than in groups replete of these vitamins.


View this table:
[in this window]
[in a new window]

  		TABLE 2 Vitamin status in blood and tissue and genomic DNA methylation in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-121

 
The mild degree of these depletion states was further underscored by the plasma homocysteine concentrations: in the multiple vitamin depletion group, the concentration of homocysteine (a sensitive indicator of folate, riboflavin, vitamin B-6, and vitamin B-12 status) rose by only 40%. The mild degree of depletion was also confirmed by colonic folate: colonic folate concentrations in the folate-deplete groups were ~30–50% lower than that in folate-sufficient group (Table 2).

    Mild depletion of multiple vitamins causes genomic DNA hypomethylation but no changes in uracil incorporation. Ten wk of multiple vitamin depletion produced nearly a 45% drop in genomic DNA methylation of the colon compared with the folate-sufficient state (1.60 ± 0.28 ng/µg vs. 0.90 ± 0.18 ng/µg; P < 0.05) (Table 2). Further, the results replicate earlier findings that isolated folate depletion is insufficient to create genomic hypomethylation in the colon (32) and this inability to induce hypomethylation was true of the doublet deficiencies as well. In contrast, uracil misincorporation was not significantly increased (P = 0.12–0.78) in this experiment by singlet, doublet, or multiple vitamin depletion (data not shown), but the folate-sufficient group (6.20 ± 0.58 pg/µg) had the lowest level of uracil incorporation of any group.

    Strand breaks in the MCR of the Apc gene are induced by mild depletion of multiple B vitamins. We previously observed that the MCR region of the colonic Apc gene of the rodent is particularly susceptible to strand breakage in response to severe folate deficiency (4). Therefore, in this study, strand breaks in MCR of Apc gene were determined. The results demonstrate that strand breaks in the multiple vitamin depletion group were greater than what was observed in the folate-sufficient group (P < 0.05); the other 4 deficiency groups demonstrated numerically greater degrees of strand breaks compared with the control but in none of those instances was the difference statistically significant (P = 0.10–0.56) (Fig. 2C). The induction of strand breaks within the MCR appears to be site-specific, because neither the examination of the region associated with ß-catenin degradation nor examination of the basic domain region demonstrated any increase in strand breaks as a result of the depletion conditions (data not shown).

A standard curve ({Delta}Ct = 2.4607 x DNA(%) + 0.0135) generated from the restriction digest experiment by pooling amplicons Apc_A, B, and C (Fig. 2B) indicates that a 1% reduction in the template DNA will produce a 0.0246 decrease in the {Delta}Ct value. Therefore, the increase of 0.65 cycles observed in Ct in the multiple vitamin depletion vs. the control diet corresponds to a 25.9% increase in breakage within the Apc gene.

    Region-specific methylation of the Apc gene was not altered by B vitamin depletion. Promoter hypermethylation has been observed to be a means of repressing the expression of tumor suppressor genes in human colorectal cancer (33). The methylation status of 3 CpG islands of the Apc gene, including 1 in the promoter region and the other 2 in the first intron, were assessed by MethyLight, a bisulfite modification-dependent, fluorescence-based real-time PCR technique (26). The levels of methylation of those 3 CpG islands did not differ among the 6 groups (data not shown), indicating that the various depletion conditions did not induce a significant degree of hypermethylation within the Apc promoter.

    Apc gene transcript was decreased by mild folate combined with other B vitamin depletion. Although Apc gene expression in the group with isolated folate depletion was ~40% lower than that observed in the folate-sufficient group, it was only diminished to a significant degree (P < 0.05) in groups where 2 or more vitamins were depleted. The multiple vitamin depletion as well as the doublet depletion of folate and vitamin B-6 resulted in greater decreases in Apc expression compared with folate depletion alone (P < 0.05) (Fig. 3A). The electrophoresis results, which represent pooled RT-PCR products from the 8 mice in each group that were analyzed, confirm the real-time results (Fig. 3B).


Figure 3
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 3  The effect of vitamin depletion on colonic Apc gene expression in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12. (A) Real-time RT-PCR for Apc gene expression. The data analysis is based on the Apc {Delta}Ct values after normalization to ß-actin. The insert graph displays the {Delta}Ct value for each mouse and the mean {Delta}Ct value for each group. The bar graph expresses the same data in terms of relative expression. The top line above the bar graph indicates significance compared with the folate-sufficient group and the second line indicates the significance compared with the folate-deficient group. *P < 0.05; ** P <0.01. (B) Pooled RT-PCR products of the Apc mRNA in an agarose gel. These RT-PCR results represent the mean Apc gene expression in each group, because cDNA was equally pooled from 8 mice from each group.

 
    Upregulated expression and increased nuclear localization of ß-catenin were induced by multiple vitamin depletion. Impaired expression of Apc protein or defective Apc protein leads to diminished proteosomal destruction of ß-catenin, producing increased total cellular concentrations of the ß-catenin and increased nuclear import of the protein (34). Cellular levels of ß-catenin protein in the colonic mucosa increased (P < 0.05) by all of the depletion states other than isolated folate depletion (Fig. 4A). Accumulation of ß-catenin affects downstream gene expression in the Wnt pathway only when it is translocated into nuclei. The trend was toward greater nuclear localization of ß-catenin protein in all of the vitamin depletion groups (Fig. 4B); significant increases, however, were only observed in the folate and B12 depletion as well as multiple vitamin depletion groups (P < 0.05).


Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 4  Immunoblotting for ß-catenin protein expression, immunohistochemistry for nuclear localization of ß-catenin, and gene expression for cyclin D1 in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12. (A) Western blotting for ß-catenin protein expression. The ratio is the intensity of the ß-catenin protein signal in each sample normalized to the signal of GAPDH. The top line above the bar graph indicates significance compared with the folate-sufficient group and the second line indicates the significance compared with the folate-deficient group. *P < 0.05; **P < 0.01. (B) Immunostaining score for ß-catenin nuclear localization. Compared with the folate-sufficient group, significantly higher ß-catenin nuclear staining was observed in the multiple vitamin depletion and folate combined with vitamin B-12 depletion groups, P < 0.05. (C) Results of quantitative RT-PCR for cyclin D1 mRNA expression using real-time PCR. The data analysis is based on cyclin D1 {Delta}Ct value after normalization to ß-actin. The insert graph displays the {Delta}Ct value for each mouse and the mean {Delta}Ct value for each group. The bar graph expresses the same data in terms of relative expression. The expression of cyclin D1 in the multiple vitamin depletion group is significantly greater than that in the folate sufficient as well as folate depletion group, P < 0.05s.

 
    Upregulated expression of cyclin D1 gene was induced by multiple vitamin depletion. Stabilized ß-catenin binds to lymphoid-enhancing factor-1 in the nucleus and results in increased transcriptional activation of several target genes. The cyclin D1 proto-oncogene is an important regulator of G1 to S-phase transition and it is directly regulated by ß-catenin (35,36). Therefore, cyclin D1 gene expression was examined to determine whether the increased expression and nuclear localization of ß-catenin effected changes further down the Wnt cascade. The results (Fig. 4C) demonstrate a 3-fold increase in cyclin D1 gene expression in the multiple vitamin depletion group.

    Apoptosis, but not proliferation, was suppressed by mild dietary vitamin depletion. Proliferation was assessed by evaluating the expression of PCNA (Fig. 5A, a,b). As other authors have stressed (37), both the proliferation labeling index (LI) and the distribution of the proliferation zone were measured, because it is unclear which is more closely linked to neoplastic transformation. The 6 groups did not differ in either LI or the expansion of the proliferation zone (data not shown).


Figure 5
View larger version (63K):
[in this window]
[in a new window]

  		FIGURE 5  The effect of B vitamin depletion on colonocyte proliferation and apoptosis in mice with mild depletion of folate combined with depletion of riboflavin, vitamin B-6, and vitamin B-12. Proliferation and apoptosis were studied by observing the expression of PCNA and cleaved caspase-3 by immunohistochemistry. (A) Representative sections from folate-sufficient and multiple vitamin depletion groups for proliferation (a and b) and apoptosis (c and d). PCNA and caspase-3 positive cells are shown by the arrows. (B) Apoptosis was measured as the mean number of cleaved caspase-3 positive cells per crypt. Compared with the folate-sufficient group, multiple vitamin depletion significantly decreases apoptosis in the epithelium cells, P < 0.05 (neither PCNA LI nor the expansion of the proliferation zone was significant among the groups, data not shown).

 
Apoptosis was evaluated by measuring the expression of cleaved caspase-3, an integral component of the caspase cascade that occurs in apoptosis (Fig. 5A, c,d). The apoptotic index was defined as the number of the positive cells per crypt. Numerically lower apoptotic indices were observed in the singlet (P = 0.17) and doublet (P = 0.08–0.13) states of depletion compared with the control group. However, only in the multiple vitamin depletion group was the decreased apoptosis substantial (~35%) and significant (Fig. 5B).

In addition, a blinded examination of a 2-cm segment from the mid-colon of 8 members from each group was conducted by a single observer; no significant pathology was noted. More specifically, no megaloblastic changes or any dysplastic features were noted in the colonic mucosa.


   Discussion
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
LITERATURE CITED
 
In this study, we present evidence that a very mild dietary depletion of folate and riboflavin, vitamin B-6, and B-12 alters Wnt-signaling in the colon of the mouse in a manner that may promote neoplastic transformation. Perturbations in the Wnt-signaling cascade induced by the combined depletion of all 4 vitamins were consistently greater than those in the isolated folate depletion group and in most instances were greater than the doublet states of depletion. This emphasizes the concept that diets that are inadequate in multiple 1-carbon micronutrients may have important functional ramifications that do not exist with singlet or doublet states of depletion.

We show that alterations in components of the Wnt-signaling cascade extend as far upstream as the Apc gene, where diminished steady-state level of messenger RNA (mRNA) was observed. Although the study design did not offer a means to conclusively prove the mechanism by which Apc expression was reduced, our results nevertheless imply that the reduction in expression was due at least in part to the induction of strand breaks within the Apc gene. Our previous work demonstrated that excess strand breaks within coding regions of a tumor suppressor gene are closely paralleled by reductions in steady-state transcript for that gene (4). This is consistent with recent studies that have shown that the induction of strand breaks arrests the procession of DNA and RNA polymerases at the site of breakage, impairing expression of affected genes (38). Genomic DNA hypomethylation feasibly may have contributed to the down-regulation of Apc gene expression as well, as was observed in a recent study where mice defective in DNA methyltransferase 1 experienced loss of heterozygosity of Apc, resulting in stabilization and accumulation of ß-catenin (39). Although Apc promoter hypermethylation has been observed as a means of repressing Apc expression in human colorectal cancer (33), none of the 3 CpG islands in the upstream untranslated portion of the gene were found to be significantly hypermethylated by the vitamin inadequacies, discounting this as the means by which Apc expression was suppressed. A significant decrease in colonocyte apoptosis of ~35% was also demonstrated in the combined depletion group. This effect is consistent with the 3-fold increase in cyclin D1 that was observed in the combined depletion group, because cyclin D1 is thought to be an important regulator of apoptosis (40). In colorectal cancer, a large component of the tumor suppressor activity of the Apc protein is thought to be mediated through an increase in colonocyte apoptosis (41). Thus, alterations in normal levels of apoptosis, as an important downstream readout of Wnt pathway, recapitulated observations on several upstream members of the pathway in which a combined depletion produced the most dramatic perturbations of the system. This study does not definitively demonstrate that the attenuation of apoptosis arises from increased activation of the Wnt cascade, although the fact that the pattern of reduction shadows changes upstream is consistent with a causative relationship. Nevertheless, our observations clearly demonstrate an upregulation of several elements in the canonical Wnt-signaling pathway in a manner that would facilitate pro-transformational events.

No micro- or macroscopic neoplasms were found in the experimental mice at the end of this study despite a systematic search for these lesions. This was entirely consistent with our expectations; epidemiological as well as animal studies have established that folate depletion merely enhances an underlying predisposition toward tumorigenesis and is an insufficient factor by itself to initiate the development of neoplasms (42,43). Thus, we are currently conducting animal studies to confirm the synergy of combined B vitamin depletion as a risk factor for tumorigenesis by examining these diets in an animal model that is predisposed to colon cancer.

In this study, no molecular endpoints were observed to be significantly altered by a mild degree of folate restriction alone. However, most of the molecular endpoints were changed by the depletion of folate combined with the other 3 B vitamins and in some instances, such as the expression of Apc mRNA and ß-catenin protein, were changed by the depletion of folate combined with 1 of the other B vitamins. These findings indicate that pro-transformational events that occur at a mild level with folate depletion alone can be magnified by the depletion of folate combined with several other nutritional cofactors that are integral to 1-carbon metabolism.

It is noteworthy that only mild dietary vitamin depletion was used in this study. The very mild systemic vitamin depletion in this study (Table 2) was different from our previous studies (32,44), in which moderate or severe depletion diets were used. In this study, plasma folate decreased only 30–50% and colon folate decreased only ~40%, whereas plasma and colon folate were decreased ~10 and 2 times, respectively, by moderate dietary folate depletion in rats (32). Plasma homocysteine, which can be perceived as a measure of the integrated capability for methylation by 1-carbon metabolism, increased only slightly (~30%) in all the vitamin-deplete groups compared with the vitamin-sufficient group, whereas it increased ~4-fold in rats on a diet moderately deficient in folate (32). Also, when compared with earlier rodent studies (44–46), the magnitude of the riboflavin, vitamin B-6, and vitamin B-12 deficiencies imposed in this study were of a considerably milder degree. We therefore argue that the nature of the vitamin inadequacies in this study mimic the levels of inadequacy commonly observed in industrialized societies. This underscores the potential impact that subclinical B vitamin depletion may have when several act in concert with one another.

The fact that depletion of these vitamins has a substantial impact on Apc expression and its downstream effectors is of considerable potential importance in defining the dietary risk factors for colorectal cancer. Indeed, it is widely accepted that altered Wnt signaling due to anomalies in Apc expression are the initiating event in >85% of sporadic colorectal cancers (10). Further, observations in subjects with familial adenomatosis polyposis suggest that as little as a 50% reduction in Apc expression in 1 allele is a sufficient perturbation to incite tumorigenesis (47) and this is well within the range of reduced Apc expression that we observed due to multiple vitamin depletion. Such observations indicate that the magnitude of reduced Apc expression that we observed is functionally relevant to the process of colorectal carcinogenesis.


   ACKNOWLEDGMENTS
 
We thank Dr. Anthony Brown for his very helpful suggestions regarding the analysis.


   FOOTNOTES
 
1 Supported in part by NIH grants U54 CA10097 and K05 CA100048 (J.B.M), R21 AA016681 (S.W.C.), Agricultural Research Service, Agreement no.58-1950-4-401, and the Cancer Research and Prevention Foundation (J.W.C.). Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the USDA. Back

2 Author disclosures: J. B. Mason has served as a consultant to Wyeth Consumer Healthcare, a manufacturer of multivitamins; Z. Liu, S.-W. Choi, J. W. Crott, M. K. Keyes, H. Jang, D. E. Smith, M. Kim, P. W. Laird, and R. Bronson, no conflicts of interest. Back

8 Abbreviations used: LI, labeling index; MCR, mutation cluster region; mRNA, messenger RNA; PCNA, proliferation cell nuclear antigen. Back

Manuscript received 8 August 2007. Initial review completed 30 August 2007. Revision accepted 24 September 2007.


   LITERATURE CITED
TOP
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 LITERATURE CITED
 

1. Giovannucci E. Epidemiologic studies of folate and colorectal neoplasia: a review. J Nutr. 2002;132:S2350–5.[Abstract/Free Full Text]

2. Choi SW, Mason JB. Folate and carcinogenesis: an integrated scheme. J Nutr. 2000;130:129–32.[Abstract/Free Full Text]

3. Pufulete M, Al-Ghnaniem R, Leather AJ, Appleby P, Gout S, Terry C, Emery PW, Sanders TA. Folate status, genomic DNA hypomethylation, and risk of colorectal adenoma and cancer: a case control study. Gastroenterology. 2003;124:1240–8.[Medline]

4. Kim YI, Shirwadkar S, Choi SW, Puchyr M, Wang Y, Mason JB. Effects of dietary folate on DNA strand breaks within mutation-prone exons of the p53 gene in rat colon. Gastroenterology. 2000;119:151–61.[Medline]

5. Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–28.[Medline]

6. Duthie SJ, Hawdon A. DNA instability (strand breakage, uracil misincorporation, and defective repair) is increased by folic acid depletion in human lymphocytes in vitro. FASEB J. 1998;12:1491–7.[Abstract/Free Full Text]

7. Ulrey CL, Liu L, Andrews LG, Tollefsbol, TO. The impact of metabolism on DNA methylation. Hum Mol Genet. 2005;14(Spec No 1):R139–47.[Abstract/Free Full Text]

8. Van den Veyver IB. Genetic effects of methylation diets. Annu Rev Nutr. 2002;22:255–82.[Medline]

9. Davis CD, Uthus EO. DNA methylation, cancer susceptibility, and nutrient interactions. Exp Biol Med (Maywood). 2004;229:988–95.[Abstract/Free Full Text]

10. Fodde R, Smits R, Clevers H. APC, signal transduction and genetic instability in colorectal cancer. Nat Rev Cancer. 2001;1:55–67.[Medline]

11. Moser AR, Pitot HC, Dove WF. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 1990;247:322–4.[Abstract/Free Full Text]

12. Suzuki H, Watkins DN, Jair KW, Schuebel KE, Markowitz SD, Chen WD, Pretlow TP, Yang B, Akiyama Y, et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet. 2004;36:417–22.[Medline]

13. Arnold CN, Goel A, Niedzwiecki D, Dowell JM, Wasserman L, Compton C, Mayer RJ, Bertagnolli MM, Boland CR. APC promoter hypermethylation contributes to the loss of APC expression in colorectal cancers with allelic loss on 5q. Cancer Biol Ther. 2004;3:960–4.[Medline]

14. Planells E, Sanchez C, Montellano MA, Mataix J, Llopis J. Vitamins B6 and B12 and folate status in an adult Mediterranean population. Eur J Clin Nutr. 2003;57:777–85.[Medline]

15. Lindenbaum J, Rosenberg IH, Wilson PW, Stabler SP, Allen RH. Prevalence of cobalamin deficiency in the Framingham elderly population. Am J Clin Nutr. 1994;60:2–11.[Abstract/Free Full Text]

16. Clifford AJ, Wilson DS, Bills ND. Repletion of folate-depleted rats with an amino acid-based diet supplemented with folic acid. J Nutr. 1989;119:1956–61.[Abstract/Free Full Text]

17. Horwitz W. Official methods of analysis of AOAC International. 17th ed. Arlington (VA): AOAC; 2000.

18. Bjerknes M, Cheng H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 1981;199:565–74.[Medline]

19. Nichoalds GE. Assessment of status riboflavin nutriture by assay of erythrocyte glutathione reductase activity. Clin Chem. 1974;20:624–8.[Medline]

20. Camp VM, Chipponi J, Faraj BA. Radioenzymatic assay for direct measurement of plasma pyridoxal 5'-phosphate. Clin Chem. 1983;29:642–4.[Abstract/Free Full Text]

21. Araki A, Sako Y. Determination of free and total homocysteine in human plasma by high-performance liquid chromatography with fluorescence detection. J Chromatogr. 1987;422:43–52.[Medline]

22. O'Broin S, Kelleher B. Microbiological assay on microtitre plates of folate in serum and red cells. J Clin Pathol. 1992;45:344–7.[Abstract/Free Full Text]

23. Crain PF. Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Methods Enzymol. 1990;193:782–90.[Medline]

24. Friso S, Choi SW, Dolnikowski GG, Selhub J. A method to assess genomic DNA methylation using high-performance liquid chromatography/electrospray ionization mass spectrometry. Anal Chem. 2002;74:4526–31.[Medline]

25. Blount BC, Ames BN. Analysis of uracil in DNA by gas chromatography-mass spectrometry. Anal Biochem. 1994;219:195–200.[Medline]

26. Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, Danenberg PV, Laird PW. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000;28:E32.[Medline]

27. Eads CA, Nickel AE, Laird PW. Complete genetic suppression of polyp formation and reduction of CpG-island hypermethylation in Apc(Min/+) Dnmt1-hypomorphic mice. Cancer Res. 2002;62:1296–9.[Abstract/Free Full Text]

28. Goss KH, Groden J. Biology of the adenomatous polyposis coli tumor suppressor. J Clin Oncol. 2000;18:1967–79.[Abstract/Free Full Text]

29. Crott JW, Liu Z, Choi SW, Mason JB. Folate depletion in human lymphocytes up-regulates p53 expression despite marked induction of strand breaks in exons 5–8 of the gene. Mutat Res. 2007;626:171–9.[Medline]

30. Polakis P. Wnt signaling and cancer. Genes Dev. 2000;14:1837–51.[Free Full Text]

31. Rajnakova A, Goh PM, Chan ST, Ngoi SS, Alponat A, Moochhala S. Expression of differential nitric oxide synthase isoforms in human normal gastric mucosa and gastric cancer tissue. Carcinogenesis. 1997;18:1841–5.[Abstract/Free Full Text]

32. Choi SW, Friso S, Dolnikowski GG, Bagley PJ, Edmondson AN, Smith DE, Mason JB. Biochemical and molecular aberrations in the rat colon due to folate depletion are age-specific. J Nutr. 2003;133:1206–12.[Abstract/Free Full Text]

33. Lind GE, Thorstensen L, Lovig T, Meling GI, Hamelin R, Rognum TO, Esteller M, Lothe RA. A CpG island hypermethylation profile of primary colorectal carcinomas and colon cancer cell lines. Mol Cancer. 2004;3:28.[Medline]

34. Munemitsu S, Albert I, Souza B, Rubinfeld B, Polakis P. Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc Natl Acad Sci USA. 1995;92:3046–50.[Abstract/Free Full Text]

35. Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–6.[Medline]

36. Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico M, Pestell R, Ben-Ze'ev A. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci USA. 1999;96:5522–7.[Abstract/Free Full Text]

37. Bostick RM, Fosdick L, Lillemoe TJ, Overn P, Wood JR, Grambsch P, Elmer P, Potter JD. Methodological findings and considerations in measuring colorectal epithelial cell proliferation in humans. Cancer Epidemiol Biomarkers Prev. 1997;6:931–42.[Abstract]

38. Courtemanche C, Huang AC, Elson-Schwab I, Kerry N, Ng BY, Ames BN. Folate deficiency and ionizing radiation cause DNA breaks in primary human lymphocytes: a comparison. FASEB J. 2004;18:209–11.[Abstract/Free Full Text]

39. Yamada Y, Jackson-Grusby L, Linhart H, Meissner A, Eden A, Lin H, Jaenisch R. Opposing effects of DNA hypomethylation on intestinal and liver carcinogenesis. Proc Natl Acad Sci USA. 2005;102:13580–5.[Abstract/Free Full Text]

40. Alao JP, Gamble SC, Stavropoulou AV, Pomeranz KM, Lam EW, Coombes RC, Vigushin DM. The cyclin D1 proto-oncogene is sequestered in the cytoplasm of mammalian cancer cell lines. Mol Cancer. 2006;5:7.[Medline]

41. Morin PJ, Vogelstein B, Kinzler KW. Apoptosis and APC in colorectal tumorigenesis. Proc Natl Acad Sci USA. 1996;93:7950–4.[Abstract/Free Full Text]

42. Cravo ML, Mason JB, Dayal Y, Hutchinson M, Smith D, Selhub J, Rosenberg IH. Folate deficiency enhances the development of colonic neoplasia in dimethylhydrazine-treated rats. Cancer Res. 1992;52:5002–6.[Abstract/Free Full Text]

43. Fuchs CS, Willett WC, Colditz GA, Hunter DJ, Stampfer MJ, Speizer FE, Giovannucci EL. The influence of folate and multivitamin use on the familial risk of colon cancer in women. Cancer Epidemiol Biomarkers Prev. 2002;11:227–34.[Abstract/Free Full Text]

44. Choi SW, Friso S, Ghandour H, Bagley PJ, Selhub J, Mason JB. Vitamin B-12 deficiency induces anomalies of base substitution and methylation in the DNA of rat colonic epithelium. J Nutr. 2004;134:750–5.[Abstract/Free Full Text]

45. Yates CA, Evans GS, Powers HJ. Riboflavin deficiency: early effects on post-weaning development of the duodenum in rats. Br J Nutr. 2001;86:593–9.[Medline]

46. Mackey AD, Lieu SO, Carman C, Gregory JF III. Hydrolytic activity toward pyridoxine-5'-beta-D-glucoside in rat intestinal mucosa is not increased by vitamin B-6 deficiency: effect of basal diet composition and pyridoxine intake. J Nutr. 2003;133:1362–7.[Abstract/Free Full Text]

47. Yan H, Dobbie Z, Gruber SB, Markowitz S, Romans K, Giardiello FM, Kinzler KW, Vogelstein B. Small changes in expression affect predisposition to tumorigenesis. Nat Genet. 2002;30:25–6.[Medline]




This article has been cited by other articles:


Home page
 DMMHome page
M. Han, M. C. Serrano, R. Lastra-Vicente, P. Brinez, G. Acharya, J. C. Huhta, R. Chen, and K. K. Linask
Folate rescues lithium-, homocysteine- and Wnt3A-induced vertebrate cardiac anomalies
Dis. Model. Mech., September 1, 2009; 2(9-10): 467 - 478.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Clin. Nutr.Home page
A. Chanson, L. D Parnell, E. D Ciappio, Z. Liu, J. W Crott, K. L Tucker, and J. B Mason
Polymorphisms in uracil-processing genes, but not one-carbon nutrients, are associated with altered DNA uracil concentrations in an urban Puerto Rican population
Am. J. Clinical Nutrition, June 1, 2009; 89(6): 1927 - 1936.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
D. Garcia-Crespo, E. Knock, N. Jabado, and R. Rozen
Intestinal Neoplasia Induced by Low Dietary Folate Is Associated with Altered Tumor Expression Profiles and Decreased Apoptosis in Mouse Normal Intestine
J. Nutr., March 1, 2009; 139(3): 488 - 494.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Z.
Right arrow Articles by Mason, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Z.
Right arrow Articles by Mason, J. B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diets
Hazardous Substances DB
*FOLIC ACID

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by American Society for Nutrition