![]() |
|
|
3 Vitamins and Carcinogenesis Laboratory, 4 Comparative Biology Unit, Jean Mayer U.S. Department of Agriculture Human Nutrition Research Center on Aging, Tufts University, Boston, MA 02111; 5 Departments of Surgery and of Biochemistry and Molecular Biology, University of Southern California/Norris Comprehensive Cancer Center, Los Angeles, CA 90089; 6 Department of Pathology, Harvard Medical School, Boston, MA 02115; and 7 Divisions of Clinical Nutrition and Gastroenterology, New England Medical Center, Boston, MA 02111
* To whom correspondence should be addressed. E-mail: joel.mason{at}tufts.edu.
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The maintenance of normal patterns of biological methylation and nucleotide synthesis depends not only upon adequate availability of folate but also on the adequate availability of other 1-carbon nutrients, including riboflavin, vitamin B-6, and vitamin B-12 (7). Although folate plays a central role in the synthesis of S-adenosylmethionine (the universal methyl donor for biological methylation) and in the synthesis of nucleotides, the other above-mentioned vitamins also assume critical roles as cofactors in the 1-carbon metabolic network (Fig. 1): riboflavin is a precursor for the cofactor of methylenetetrahydrofolate reductase, which catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate (8); vitamin B-12 is a cofactor for methionine synthase, a reaction in which 5-methyltetrahydrofolate participates as a substrate in the remethylation of homocysteine to form methionine (8); and vitamin B-6 is a necessary cofactor for the inter-conversion of other coenzymatic forms of folate and the metabolism of homocysteine (9). Thus, the metabolic functions of all these 1-carbon vitamins are highly inter-dependent, so depletion of one may lead to biochemical phenotypes characteristic of deficiencies of the others. This study was therefore designed to define biochemical and molecular pathways by which carcinogenesis is modulated when riboflavin, vitamin B-6, and/or vitamin B-12 depletion are superimposed on folate depletion.
|
Flagrant deficiencies of 1-carbon nutrients are rare in the industrialized world. In contrast, marginal status is relatively common. For instance, population-based studies have reported that 18–25% of adults have low vitamin B-6 status (14) and 10–20% of healthy elders are thought to have marginal vitamin B-12 status (15). We hypothesized that biochemical and molecular aberrations in the colon due to folate depletion are magnified in the presence of mild inadequacies of other B vitamins in a manner that would not otherwise be observed with folate depletion alone. We therefore designed a mouse study to examine the proposed synergies between these vitamins in regard to how they might impact on Wnt pathway. We intentionally used very mild levels of vitamin inadequacy that produce no anemia or outward signs of disease to simulate the marginal but not flagrant inadequacies that are common in the general population. In addition, we intentionally chose to study a mouse strain that is not predisposed to colorectal neoplasia, because we wished to examine the molecular and biochemical effects of these states of vitamin restriction in the absence of the confounding effects of a colon that is intrinsically driven toward neoplastic transformation.
| Materials and Methods |
|---|
|
|
|---|
|
Measurement of blood and tissue vitamin status. Plasma folate was measured by radioimmunoassay (Bio-Rad Laboratories); riboflavin was measured by the erythrocyte glutathione reductase activation coefficient assay (19); vitamin B-6 (pyridoxal phosphate) was measured by a radioenzymatic assay (20); and vitamin B-12 was measured by a competitive protein-binding assay (Bio-Rad Laboratories). Plasma homocysteine was measured by HPLC with fluorescence detection (21) and colonic folate was determined by a conventional microbiological microtiter plate assay using Lactobacillus casei assay as previously described (22).
Genomic DNA methylation and uracil misincorporation. Liquid chromatography/electrospray ionization MS was used to analyze genomic DNA methylation. Briefly, DNA was hydrolyzed by sequential digestion with 3 enzymes: nuclease P1, venom phosphodiesterase I, and alkaline phosphatase (23). Identification of cytosine and 5-methylcytosine was obtained by MS analysis of chromatographic peaks. The amount of uracil in DNA was measured by a previously described GC-MS method (24,25).
Region-specific methylation and strand break assays of the Apc gene. The state of methylation within 3 CpG islands located in upstream portions of the Apc gene, 1 in the promoter region and the other 2 in the first intron, was analyzed by MethyLight as described previously (26). Mouse genomic DNA, treated with the DNA methyltransferase M.SssI, was used to generate standard curves representing log-transformed DNA quantities vs. the Ct value. Methylation-independent reactions for Lhx1 and Guca2a were used to control for input DNA amounts. Apc DNA methylation was reported as a percentage of methylated reference as described (27).
Strand breaks in the mutation cluster region (MCR),8 a region associated with ß-catenin degradation, and the basic domain region (28) of the Apc gene were each measured by real-time PCR. This method is based on the principle that strand breaks inhibit PCR amplification and is a method that has been used by several investigators for over a decade (4,29). The MCR in exon 15 of Apc gene in the mouse extends approximately from base 3750 to 4500 (Fig. 2A) (30). Because the optimal amplicon size for real-time PCR is <300 bp, 3 primer sets, collectively covering >90% of the MCR, were designed (primer pair A, forward: GGCCAGACTCAAAAAGGCAC, reverse: CAGAAGCCTGGAGTCGGCT; primer pair B, forward: CAGCCGACTCCAGGCTTCT, reverse: TGGTGGCATGGTCTGCC; primer pair C, forward: CAAGCAGAAGCAAAACCCCTC, reverse: ACCCGTCTGGAGTACTTTCTGTG). The primers for the region associated with ß-catenin degradation are: forward, ACGCGTGTGAGAAAGAATACAGAC, and reverse: GCTTGAGTTTGGTTCTGGGC. The primers for the basic domain are: forward, CAAAGAAGCTGAACCTGCCAAC, and reverse, TGCCACCCACTTTTCTAGGG. To confirm that breaks in the sequence of interest resulted in incremental reductions in amplification, different percentages of restriction-digested DNA (using a combination of HinfI, MboII, and MnlI; New England Biolabs) were added to vary the amount of intact DNA template while keeping the total amount of DNA constant (Fig. 2B). Although we have previously published data demonstrating that this assay quantitatively assesses DNA strand breaks (29), the assay does not possess absolute specificity, because other aberrations such as abasic sites, bulky adducts, and DNA cross-links may also inhibit amplification.
|
Ct = CtApc – Ctß-actin) and statistical analyses were performed using
Ct. The relative expression values compared with the folate sufficient group are reported here for clarity and were calculated using the following formula: relative expression = 2–
Ct, where 
Ct is
Ct of vitamin depletion groups –
Ct of folate sufficient group. The cDNA was equally pooled from each mouse for each group and a regular PCR of Apc gene was performed with cycles within the linear amplification range to further confirm the real-time results. Immunoblotting for ß-catenin protein expression and immunohistochemistry for detection of nuclear ß-catenin. For immunoblotting, proteins were separated by electrophoresis on a polyacrylamide gel and transferred onto a nitrocellulose membrane. Nonspecific binding was blocked with nonfat dry milk. The membrane was probed with primary anti-ß-catenin antibody (BD Biosciences) followed by horseradish peroxidase conjugated secondary antibody (Bio-Rad). Chemifluorescence detection was achieved using ECL Plus Substrate (Amersham Biosciences). Protein bands were quantified using a Gel-Doc image analysis system and Quantity One software (Bio-Rad).
For immunohistochemistry, paraffin-embedded slides were deparaffinized in xylene followed by rehydration in ethanol. Endogenous peroxidase blocking was performed with H2O2 and the antigen was retrieved by boiling. The slides were incubated with the anti-ß-catenin primary antibody (BD biosciences) followed by biotinylated horse anti-mouse secondary antibody (Vector Laboratories). Slides were then treated with Vectastain Elite ABC reagent (Vector Laboratories) followed by hematoxylin counterstain.
Coded histological slides were viewed in a blinded fashion using light microscopy at 400x. For immunohistochemical scoring, longitudinal sections of crypts were used; only those with the base touching the muscularis mucosa and having an open lumen at the top qualified for use. A modified semiquantitative scoring system (31) was used to evaluate the staining by the antibody. The degree of positive staining was evaluated by scoring 15–20 crypts from each animal on a scale of 1–5 based on the percentage of positive-staining colonocyte nuclei within that crypt.
Proliferation cell nuclear antigen and cleaved caspase-3 immunohistochemical assay. Similar immunohistochemical assays were used for proliferation cell nuclear antigen (PCNA) detection (Santa Cruz Biotechnology) and for cleaved caspase-3 detection (Cell Signaling Technology).
For scoring PCNA staining, 10 intact crypts were evaluated for each animal. Each crypt column was divided into 3 compartments from the base to the mouth of the gland. The proliferation index was calculated by determining the number of positive cells per crypt divided by the number of crypt cells; the expansion of the proliferation zone was calculated by determining the number of PCNA-positive cells in the upper two-thirds of the crypt divided by the total number of cells in that crypt. For scoring of caspase-3 staining, any light to heavy staining was considered as positive staining. The total number of apoptotic cells was recorded for all the scorable crypts in each slide. Approximately 50 crypts were counted for each mouse. The quantification of apoptosis was expressed as the number of positive cells per crypt.
In addition, a formalin-fixed 2-cm longitudinal section of the mid-colon of 8 mice in each group was also mounted and stained with hematoxylin and eosin. These segments were read by an expert rodent pathologist (R. Bronson) who was unaware of treatment group assignment.
Statistical analysis. Data analyses were conducted by 1-way ANOVA for the dietary effect; group comparisons for vitamin status in the blood and tissues as well as genomic DNA methylation were made by Tukey's method, whereas group comparisons for other molecular endpoints were performed with the Dunnett's method in which folate sufficiency or folate depletion served separately as the control. All the analysis was conducted using SAS software v9.1 (SAS Institute). Values in the text are presented as means ± SEM.
| Results |
|---|
|
|
|---|
50% lower (P < 0.05) than in groups replete of these vitamins.
|
30–50% lower than that in folate-sufficient group (Table 2). Mild depletion of multiple vitamins causes genomic DNA hypomethylation but no changes in uracil incorporation. Ten wk of multiple vitamin depletion produced nearly a 45% drop in genomic DNA methylation of the colon compared with the folate-sufficient state (1.60 ± 0.28 ng/µg vs. 0.90 ± 0.18 ng/µg; P < 0.05) (Table 2). Further, the results replicate earlier findings that isolated folate depletion is insufficient to create genomic hypomethylation in the colon (32) and this inability to induce hypomethylation was true of the doublet deficiencies as well. In contrast, uracil misincorporation was not significantly increased (P = 0.12–0.78) in this experiment by singlet, doublet, or multiple vitamin depletion (data not shown), but the folate-sufficient group (6.20 ± 0.58 pg/µg) had the lowest level of uracil incorporation of any group.
Strand breaks in the MCR of the Apc gene are induced by mild depletion of multiple B vitamins. We previously observed that the MCR region of the colonic Apc gene of the rodent is particularly susceptible to strand breakage in response to severe folate deficiency (4). Therefore, in this study, strand breaks in MCR of Apc gene were determined. The results demonstrate that strand breaks in the multiple vitamin depletion group were greater than what was observed in the folate-sufficient group (P < 0.05); the other 4 deficiency groups demonstrated numerically greater degrees of strand breaks compared with the control but in none of those instances was the difference statistically significant (P = 0.10–0.56) (Fig. 2C). The induction of strand breaks within the MCR appears to be site-specific, because neither the examination of the region associated with ß-catenin degradation nor examination of the basic domain region demonstrated any increase in strand breaks as a result of the depletion conditions (data not shown).
A standard curve (
Ct = 2.4607 x DNA(%) + 0.0135) generated from the restriction digest experiment by pooling amplicons Apc_A, B, and C (Fig. 2B) indicates that a 1% reduction in the template DNA will produce a 0.0246 decrease in the
Ct value. Therefore, the increase of 0.65 cycles observed in Ct in the multiple vitamin depletion vs. the control diet corresponds to a 25.9% increase in breakage within the Apc gene.
Region-specific methylation of the Apc gene was not altered by B vitamin depletion. Promoter hypermethylation has been observed to be a means of repressing the expression of tumor suppressor genes in human colorectal cancer (33). The methylation status of 3 CpG islands of the Apc gene, including 1 in the promoter region and the other 2 in the first intron, were assessed by MethyLight, a bisulfite modification-dependent, fluorescence-based real-time PCR technique (26). The levels of methylation of those 3 CpG islands did not differ among the 6 groups (data not shown), indicating that the various depletion conditions did not induce a significant degree of hypermethylation within the Apc promoter.
Apc gene transcript was decreased by mild folate combined with other B vitamin depletion.
Although Apc gene expression in the group with isolated folate depletion was
40% lower than that observed in the folate-sufficient group, it was only diminished to a significant degree (P < 0.05) in groups where 2 or more vitamins were depleted. The multiple vitamin depletion as well as the doublet depletion of folate and vitamin B-6 resulted in greater decreases in Apc expression compared with folate depletion alone (P < 0.05) (Fig. 3A). The electrophoresis results, which represent pooled RT-PCR products from the 8 mice in each group that were analyzed, confirm the real-time results (Fig. 3B).
|
|
Apoptosis, but not proliferation, was suppressed by mild dietary vitamin depletion. Proliferation was assessed by evaluating the expression of PCNA (Fig. 5A, a,b). As other authors have stressed (37), both the proliferation labeling index (LI) and the distribution of the proliferation zone were measured, because it is unclear which is more closely linked to neoplastic transformation. The 6 groups did not differ in either LI or the expansion of the proliferation zone (data not shown).
|
35%) and significant (Fig. 5B). In addition, a blinded examination of a 2-cm segment from the mid-colon of 8 members from each group was conducted by a single observer; no significant pathology was noted. More specifically, no megaloblastic changes or any dysplastic features were noted in the colonic mucosa.
| Discussion |
|---|
|
|
|---|
We show that alterations in components of the Wnt-signaling cascade extend as far upstream as the Apc gene, where diminished steady-state level of messenger RNA (mRNA) was observed. Although the study design did not offer a means to conclusively prove the mechanism by which Apc expression was reduced, our results nevertheless imply that the reduction in expression was due at least in part to the induction of strand breaks within the Apc gene. Our previous work demonstrated that excess strand breaks within coding regions of a tumor suppressor gene are closely paralleled by reductions in steady-state transcript for that gene (4). This is consistent with recent studies that have shown that the induction of strand breaks arrests the procession of DNA and RNA polymerases at the site of breakage, impairing expression of affected genes (38). Genomic DNA hypomethylation feasibly may have contributed to the down-regulation of Apc gene expression as well, as was observed in a recent study where mice defective in DNA methyltransferase 1 experienced loss of heterozygosity of Apc, resulting in stabilization and accumulation of ß-catenin (39). Although Apc promoter hypermethylation has been observed as a means of repressing Apc expression in human colorectal cancer (33), none of the 3 CpG islands in the upstream untranslated portion of the gene were found to be significantly hypermethylated by the vitamin inadequacies, discounting this as the means by which Apc expression was suppressed. A significant decrease in colonocyte apoptosis of
35% was also demonstrated in the combined depletion group. This effect is consistent with the 3-fold increase in cyclin D1 that was observed in the combined depletion group, because cyclin D1 is thought to be an important regulator of apoptosis (40). In colorectal cancer, a large component of the tumor suppressor activity of the Apc protein is thought to be mediated through an increase in colonocyte apoptosis (41). Thus, alterations in normal levels of apoptosis, as an important downstream readout of Wnt pathway, recapitulated observations on several upstream members of the pathway in which a combined depletion produced the most dramatic perturbations of the system. This study does not definitively demonstrate that the attenuation of apoptosis arises from increased activation of the Wnt cascade, although the fact that the pattern of reduction shadows changes upstream is consistent with a causative relationship. Nevertheless, our observations clearly demonstrate an upregulation of several elements in the canonical Wnt-signaling pathway in a manner that would facilitate pro-transformational events.
No micro- or macroscopic neoplasms were found in the experimental mice at the end of this study despite a systematic search for these lesions. This was entirely consistent with our expectations; epidemiological as well as animal studies have established that folate depletion merely enhances an underlying predisposition toward tumorigenesis and is an insufficient factor by itself to initiate the development of neoplasms (42,43). Thus, we are currently conducting animal studies to confirm the synergy of combined B vitamin depletion as a risk factor for tumorigenesis by examining these diets in an animal model that is predisposed to colon cancer.
In this study, no molecular endpoints were observed to be significantly altered by a mild degree of folate restriction alone. However, most of the molecular endpoints were changed by the depletion of folate combined with the other 3 B vitamins and in some instances, such as the expression of Apc mRNA and ß-catenin protein, were changed by the depletion of folate combined with 1 of the other B vitamins. These findings indicate that pro-transformational events that occur at a mild level with folate depletion alone can be magnified by the depletion of folate combined with several other nutritional cofactors that are integral to 1-carbon metabolism.
It is noteworthy that only mild dietary vitamin depletion was used in this study. The very mild systemic vitamin depletion in this study (Table 2) was different from our previous studies (32,44), in which moderate or severe depletion diets were used. In this study, plasma folate decreased only 30–50% and colon folate decreased only
40%, whereas plasma and colon folate were decreased
10 and 2 times, respectively, by moderate dietary folate depletion in rats (32). Plasma homocysteine, which can be perceived as a measure of the integrated capability for methylation by 1-carbon metabolism, increased only slightly (
30%) in all the vitamin-deplete groups compared with the vitamin-sufficient group, whereas it increased
4-fold in rats on a diet moderately deficient in folate (32). Also, when compared with earlier rodent studies (44–46), the magnitude of the riboflavin, vitamin B-6, and vitamin B-12 deficiencies imposed in this study were of a considerably milder degree. We therefore argue that the nature of the vitamin inadequacies in this study mimic the levels of inadequacy commonly observed in industrialized societies. This underscores the potential impact that subclinical B vitamin depletion may have when several act in concert with one another.
The fact that depletion of these vitamins has a substantial impact on Apc expression and its downstream effectors is of considerable potential importance in defining the dietary risk factors for colorectal cancer. Indeed, it is widely accepted that altered Wnt signaling due to anomalies in Apc expression are the initiating event in >85% of sporadic colorectal cancers (10). Further, observations in subjects with familial adenomatosis polyposis suggest that as little as a 50% reduction in Apc expression in 1 allele is a sufficient perturbation to incite tumorigenesis (47) and this is well within the range of reduced Apc expression that we observed due to multiple vitamin depletion. Such observations indicate that the magnitude of reduced Apc expression that we observed is functionally relevant to the process of colorectal carcinogenesis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Author disclosures: J. B. Mason has served as a consultant to Wyeth Consumer Healthcare, a manufacturer of multivitamins; Z. Liu, S.-W. Choi, J. W. Crott, M. K. Keyes, H. Jang, D. E. Smith, M. Kim, P. W. Laird, and R. Bronson, no conflicts of interest. ![]()
8 Abbreviations used: LI, labeling index; MCR, mutation cluster region; mRNA, messenger RNA; PCNA, proliferation cell nuclear antigen. ![]()
Manuscript received 8 August 2007. Initial review completed 30 August 2007. Revision accepted 24 September 2007.
| LITERATURE CITED |
|---|
|
|
|---|
1. Giovannucci E. Epidemiologic studies of folate and colorectal neoplasia: a review. J Nutr. 2002;132:S2350–5.
2. Choi SW, Mason JB. Folate and carcinogenesis: an integrated scheme. J Nutr. 2000;130:129–32.
3. Pufulete M, Al-Ghnaniem R, Leather AJ, Appleby P, Gout S, Terry C, Emery PW, Sanders TA. Folate status, genomic DNA hypomethylation, and risk of colorectal adenoma and cancer: a case control study. Gastroenterology. 2003;124:1240–8.[Medline]
4. Kim YI, Shirwadkar S, Choi SW, Puchyr M, Wang Y, Mason JB. Effects of dietary folate on DNA strand breaks within mutation-prone exons of the p53 gene in rat colon. Gastroenterology. 2000;119:151–61.[Medline]
5. Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–28.[Medline]
6. Duthie SJ, Hawdon A. DNA instability (strand breakage, uracil misincorporation, and defective repair) is increased by folic acid depletion in human lymphocytes in vitro. FASEB J. 1998;12:1491–7.
7. Ulrey CL, Liu L, Andrews LG, Tollefsbol, TO. The impact of metabolism on DNA methylation. Hum Mol Genet. 2005;14(Spec No 1):R139–47.
8. Van den Veyver IB. Genetic effects of methylation diets. Annu Rev Nutr. 2002;22:255–82.[Medline]
9. Davis CD, Uthus EO. DNA methylation, cancer susceptibility, and nutrient interactions. Exp Biol Med (Maywood). 2004;229:988–95.
10. Fodde R, Smits R, Clevers H. APC, signal transduction and genetic instability in colorectal cancer. Nat Rev Cancer. 2001;1:55–67.[Medline]
11. Moser AR, Pitot HC, Dove WF. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 1990;247:322–4.
12. Suzuki H, Watkins DN, Jair KW, Schuebel KE, Markowitz SD, Chen WD, Pretlow TP, Yang B, Akiyama Y, et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet. 2004;36:417–22.[Medline]
13. Arnold CN, Goel A, Niedzwiecki D, Dowell JM, Wasserman L, Compton C, Mayer RJ, Bertagnolli MM, Boland CR. APC promoter hypermethylation contributes to the loss of APC expression in colorectal cancers with allelic loss on 5q. Cancer Biol Ther. 2004;3:960–4.[Medline]
14. Planells E, Sanchez C, Montellano MA, Mataix J, Llopis J. Vitamins B6 and B12 and folate status in an adult Mediterranean population. Eur J Clin Nutr. 2003;57:777–85.[Medline]
15. Lindenbaum J, Rosenberg IH, Wilson PW, Stabler SP, Allen RH. Prevalence of cobalamin deficiency in the Framingham elderly population. Am J Clin Nutr. 1994;60:2–11.
16. Clifford AJ, Wilson DS, Bills ND. Repletion of folate-depleted rats with an amino acid-based diet supplemented with folic acid. J Nutr. 1989;119:1956–61.
17. Horwitz W. Official methods of analysis of AOAC International. 17th ed. Arlington (VA): AOAC; 2000.
18. Bjerknes M, Cheng H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 1981;199:565–74.[Medline]
19. Nichoalds GE. Assessment of status riboflavin nutriture by assay of erythrocyte glutathione reductase activity. Clin Chem. 1974;20:624–8.[Medline]
20. Camp VM, Chipponi J, Faraj BA. Radioenzymatic assay for direct measurement of plasma pyridoxal 5'-phosphate. Clin Chem. 1983;29:642–4.
21. Araki A, Sako Y. Determination of free and total homocysteine in human plasma by high-performance liquid chromatography with fluorescence detection. J Chromatogr. 1987;422:43–52.[Medline]
22. O'Broin S, Kelleher B. Microbiological assay on microtitre plates of folate in serum and red cells. J Clin Pathol. 1992;45:344–7.
23. Crain PF. Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Methods Enzymol. 1990;193:782–90.[Medline]
24. Friso S, Choi SW, Dolnikowski GG, Selhub J. A method to assess genomic DNA methylation using high-performance liquid chromatography/electrospray ionization mass spectrometry. Anal Chem. 2002;74:4526–31.[Medline]
25. Blount BC, Ames BN. Analysis of uracil in DNA by gas chromatography-mass spectrometry. Anal Biochem. 1994;219:195–200.[Medline]
26. Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, Danenberg PV, Laird PW. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000;28:E32.[Medline]
27. Eads CA, Nickel AE, Laird PW. Complete genetic suppression of polyp formation and reduction of CpG-island hypermethylation in Apc(Min/+) Dnmt1-hypomorphic mice. Cancer Res. 2002;62:1296–9.
28. Goss KH, Groden J. Biology of the adenomatous polyposis coli tumor suppressor. J Clin Oncol. 2000;18:1967–79.
29. Crott JW, Liu Z, Choi SW, Mason JB. Folate depletion in human lymphocytes up-regulates p53 expression despite marked induction of strand breaks in exons 5–8 of the gene. Mutat Res. 2007;626:171–9.[Medline]
30. Polakis P. Wnt signaling and cancer. Genes Dev. 2000;14:1837–51.
31. Rajnakova A, Goh PM, Chan ST, Ngoi SS, Alponat A, Moochhala S. Expression of differential nitric oxide synthase isoforms in human normal gastric mucosa and gastric cancer tissue. Carcinogenesis. 1997;18:1841–5.
32. Choi SW, Friso S, Dolnikowski GG, Bagley PJ, Edmondson AN, Smith DE, Mason JB. Biochemical and molecular aberrations in the rat colon due to folate depletion are age-specific. J Nutr. 2003;133:1206–12.
33. Lind GE, Thorstensen L, Lovig T, Meling GI, Hamelin R, Rognum TO, Esteller M, Lothe RA. A CpG island hypermethylation profile of primary colorectal carcinomas and colon cancer cell lines. Mol Cancer. 2004;3:28.[Medline]
34. Munemitsu S, Albert I, Souza B, Rubinfeld B, Polakis P. Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc Natl Acad Sci USA. 1995;92:3046–50.
35. Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–6.[Medline]
36. Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico M, Pestell R, Ben-Ze'ev A. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci USA. 1999;96:5522–7.
37. Bostick RM, Fosdick L, Lillemoe TJ, Overn P, Wood JR, Grambsch P, Elmer P, Potter JD. Methodological findings and considerations in measuring colorectal epithelial cell proliferation in humans. Cancer Epidemiol Biomarkers Prev. 1997;6:931–42.[Abstract]
38. Courtemanche C, Huang AC, Elson-Schwab I, Kerry N, Ng BY, Ames BN. Folate deficiency and ionizing radiation cause DNA breaks in primary human lymphocytes: a comparison. FASEB J. 2004;18:209–11.
39. Yamada Y, Jackson-Grusby L, Linhart H, Meissner A, Eden A, Lin H, Jaenisch R. Opposing effects of DNA hypomethylation on intestinal and liver carcinogenesis. Proc Natl Acad Sci USA. 2005;102:13580–5.
40. Alao JP, Gamble SC, Stavropoulou AV, Pomeranz KM, Lam EW, Coombes RC, Vigushin DM. The cyclin D1 proto-oncogene is sequestered in the cytoplasm of mammalian cancer cell lines. Mol Cancer. 2006;5:7.[Medline]
41. Morin PJ, Vogelstein B, Kinzler KW. Apoptosis and APC in colorectal tumorigenesis. Proc Natl Acad Sci USA. 1996;93:7950–4.
42. Cravo ML, Mason JB, Dayal Y, Hutchinson M, Smith D, Selhub J, Rosenberg IH. Folate deficiency enhances the development of colonic neoplasia in dimethylhydrazine-treated rats. Cancer Res. 1992;52:5002–6.
43. Fuchs CS, Willett WC, Colditz GA, Hunter DJ, Stampfer MJ, Speizer FE, Giovannucci EL. The influence of folate and multivitamin use on the familial risk of colon cancer in women. Cancer Epidemiol Biomarkers Prev. 2002;11:227–34.
44. Choi SW, Friso S, Ghandour H, Bagley PJ, Selhub J, Mason JB. Vitamin B-12 deficiency induces anomalies of base substitution and methylation in the DNA of rat colonic epithelium. J Nutr. 2004;134:750–5.
45. Yates CA, Evans GS, Powers HJ. Riboflavin deficiency: early effects on post-weaning development of the duodenum in rats. Br J Nutr. 2001;86:593–9.[Medline]
46. Mackey AD, Lieu SO, Carman C, Gregory JF III. Hydrolytic activity toward pyridoxine-5'-beta-D-glucoside in rat intestinal mucosa is not increased by vitamin B-6 deficiency: effect of basal diet composition and pyridoxine intake. J Nutr. 2003;133:1362–7.
47. Yan H, Dobbie Z, Gruber SB, Markowitz S, Romans K, Giardiello FM, Kinzler KW, Vogelstein B. Small changes in expression affect predisposition to tumorigenesis. Nat Genet. 2002;30:25–6.[Medline]
This article has been cited by other articles:
![]() |
M. Han, M. C. Serrano, R. Lastra-Vicente, P. Brinez, G. Acharya, J. C. Huhta, R. Chen, and K. K. Linask Folate rescues lithium-, homocysteine- and Wnt3A-induced vertebrate cardiac anomalies Dis. Model. Mech., September 1, 2009; 2(9-10): 467 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chanson, L. D Parnell, E. D Ciappio, Z. Liu, J. W Crott, K. L Tucker, and J. B Mason Polymorphisms in uracil-processing genes, but not one-carbon nutrients, are associated with altered DNA uracil concentrations in an urban Puerto Rican population Am. J. Clinical Nutrition, June 1, 2009; 89(6): 1927 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Garcia-Crespo, E. Knock, N. Jabado, and R. Rozen Intestinal Neoplasia Induced by Low Dietary Folate Is Associated with Altered Tumor Expression Profiles and Decreased Apoptosis in Mouse Normal Intestine J. Nutr., March 1, 2009; 139(3): 488 - 494. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||