Journal of Nutrition Animal Diets/Enrichment Products...

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bosi, P.
Right arrow Articles by Lalatta-Costerbosa, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bosi, P.
Right arrow Articles by Lalatta-Costerbosa, G.
© 2006 American Society for Nutrition J. Nutr. 136:1229-1235, May 2006


Nutrient Physiology, Metabolism, and Nutrient-Nutrient Interactions

A Continuous Dietary Supply of Free Calcium Formate Negatively Affects the Parietal Cell Population and Gastric RNA Expression for H+/K+-ATPase in Weaning Pigs1–3,

Paolo Bosi*,4, Maurizio Mazzoni*, Sara De Filippi*, Paolo Trevisi*, Luisa Casini*, Gregorio Petrosino{dagger} and Giovanna Lalatta-Costerbosa**

* DIPROVAL, University of Bologna, 42100 Reggio Emilia, Italy; {dagger} DISAVA, University of Campobasso, 86100 Campobasso, Italy; and ** DIMORFIPA, University of Bologna, 40064 Ozzano dell'Emilia (BO), Italy

4 To whom correspondence should be addressed: E-mail: paolo.bosi{at}unibo.it.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Baby formula acidification can be used to reduce diarrhea. Calcium formate is a dietary acidifier frequently used in animal weaning diets; it is also a source of available calcium. Gastric acidification reduces gastrin release and hydrochloric acid (HCl) secretion. To study the medium-term effects on fundic gastric mucosa, we fed weaning pigs control diets or diets supplemented with free or fat-protected calcium formate. We evaluated the following: 1) the number of HCl-secreting parietal cells, by immunohistochemistry using an antibody against H+/K+-ATPase; 2) the number of enteroendocrine cells immunohistochemically stained with chromogranin A (CGA), somatostatin, and histamine (HIS); and 3) the expression of the H+/K+-ATPase gene, by real-time RT-PCR in the oxyntic mucosa. Cells co-staining for CGA and HIS were defined as enterochromaffin-like (ECL) cells. Pigs fed calcium formate had fewer parietal cells and a lower expression of the H+/K+-ATPase gene than the controls (P < 0.05). This reduction did not occur in pigs fed fat-protected calcium formate. Somatostatin immune-reactive cells were also more numerous in pigs fed free calcium formate than in controls (P < 0.05). The number of ECL cells was not affected. Using covariance analysis, the number of parietal cells explained part of the differences in the expression of H+/K+-ATPase gene (positive correlation, r = 0.385, P < 0.01), and excluded the statistical significance of the diet. In the future, the effects on the oxyntic mucosa should be checked when the diet supplemented with calcium formate is discontinued. Furthermore, a reduction in the number of parietal cells could impair the absorption of vitamin B-12 due to a reduced secretion of the intrinsic factor by these cells.


KEY WORDS: • pigs • weaning • acidifiers • parietal cells • H+/K+-ATPase

Gastric acid secretion contributes to the gut barrier against pathogens. In breast-fed young mammals, this secretion is reduced in relation to the fermentative activity of milk lactose in the stomach (1). At weaning, the passage of maternal milk into the stomach ceases, but the secretion of hydrochloric acid (HCl) in the stomach remains limited (2,3). The successive intake of solid food/feed will progressively stimulate this HCl secretion.

Carboxylic acids are not only a metabolic fuel originating from gut fermentation, but also a bioregulator of gut microflora (4). These organic acids are frequently added to the diet of weaning pigs to compensate for the insufficient acidification of the stomach due to the reduced production of HCl by gastric parietal cells. Formate is one of the most interesting of these acids in the control of porcine postweaning diarrhea (5). The acidification of human infant formula including fermented products is a similar practice used to reduce the risk of diarrhea (6). The acidification of formula reduced bacterial translocation and gut colonization in a neonatal rabbit model (7), and citric acid supplementation was proposed to reduce the risks of necrotizing enterocolitis in neonates. Compared with controls, feedings acidified by HCl addition reduced gastric colonization of critically ill adults in a multicenter randomized trial (8). Among organic acids and their salts, calcium formate may also offer additional advantages because it is also a dietary calcium supplement; it has higher calcium availability in humans than either calcium carbonate or calcium citrate (9). Pharmacokinetic analysis in women showed that calcium formate has a short plasma half-life, with no risk of progressive accumulation in case of repeated use during the day (10).

In the stomach, HCl is secreted by an ATP-dependent H+/K+ exchanger, an integral membrane protein of parietal cells, present in both membranes of the microvilli of luminal membrane invaginations (secretory canaliculi) and the extensive cytoplasmatic system of membranes (11), often referred to as the tubulovesicular system. In cell cultures, the gene expression of H+/K+-ATPase is strongly related to the activity of parietal cells (12). Acid secretion is related to energy generation through oxidative phosphorylation; parietal cells are, in fact, rich in mitochondria, and enzyme histochemistry of mitochondria has been used in their detection (13).

Gastric acid secretion from parietal cells is under the regulatory control of both the central and the enteric nervous systems, and a complex network of neuroendocrine cells acting in an auto- or paracrine manner (14). Many different specialized endocrine cells staining with antisera to chromogranine A (CGA)5 are present in the oxyntic mucosa (15,16). The enterochromaffin-like (ECL) cells, such as histamine (HIS) endocrine cells, are included in this group; they are intermingled with parietal and chief cells (17) and exert their paracrine effect on parietal cells by secreting HIS. Histamine is a powerful acid secretagogue in the oxyntic mucosa; it is also present in mast cells, which are numerous in most animals, including pigs; they are found scattered throughout the mucosa (18). Mast cells, unlike HIS endocrine cells, are not stained with the antiserum to CGA, but they can be identified by metachromasia upon toluidine staining; however, no acid-related regulation of HIS secretion from mast cells has been described, probably due to the topographic distribution of the gastric mast cells and their low content of the enzyme histidine decarboxylase required for HIS synthesis (19).

Intragastric acidification causes a sudden reduction in the gastric secretion of gastrin (2022). This peptide hormone is released by G cells and contributes to the stimulation of the secretion of HCl primarily through the activation of cholecystokinin (CCK)2 receptors on ECL cells through the release of HIS. On the contrary, somatostatin (SST) inhibits HCl secretion through ECL or G cells (23). However, little is known about the effect of a time-extended supply of organic acids on gastric acid secretion and on the presence of HCl-secreting cells.

The aim of the present study was to assess the effect of calcium formate on the number of both parietal and endocrine cells that act on the acid secretion in the oxyntic mucosa of weaning pigs, and to correlate the number of parietal cells to the RNA expression for H+/K+-ATPase. A dietary treatment with fat-protected calcium formate was used to test whether the eventual effect of this additive on the stomach is related to actions in other parts of the digestive tract or whether it can be prevented by gastric protection.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Animals, diet and oral challenge with enterotoxigenic Escherichia coli (ETEC). Large White pigs (n = 60), purchased from Suidea (Reggio Emilia, Italy) and weaned at 21 d (d 0), were used in 4 experimental cycles. For each cycle, the pigs were divided into 3 groups, n = 5/group, balanced for litter and live weight. For the entire experimental period, a control group (Group C) was fed a standard balanced diet for weaning pigs, whereas the other 2 groups were fed the same solid diet adjusted with 1.2% of free calcium formate (Group F) or with 1.2% of fat-protected calcium formate (Group P). The compositions of the base diet and of the different supplementations are presented in Table 1. The calcium formate used for the P diet was microencapsulated by fat protection consisting of hydrogenated vegetal triglycerides. To compensate for the presence of calcium from calcium formate, the control diet was supplemented with dicalcium phosphate and calcium sulfate, whereas the experimental diets contained monosodium phosphate in addition to calcium formate. The pigs were housed individually in pens with a mesh floor in a temperature-controlled room; tap water was freely available. The pigs were orally challenged with 1.5 mL of a 1010 cfu Escherichia coli (ETEC) K88 O148 (F4) suspension on d 2, and killed on d 7 or 8, equally distributed by treatment and on a random basis within each treatment. ETEC is currently an important agent of infection and diarrhea in weaning pigs (24), and the presence of intestinal receptors for its fimbriae is required for its pathogenicity (25).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Diet composition (as-fed basis)

 
The procedures followed were conducted according to the Italian law pertaining to experimental animals and were approved by the Ethic-Scientific Committee for Experiments on Animals of the University of Bologna.

    Kill and samplings. On the day of killing, the pigs had access to their meal for 1 h. Then, for the last hour before killing, their access to the trough was excluded. They were then deeply anaesthetized with sodium thiopental (10 mg/kg body weight, Zoletil 100, Virbac) and killed by an intracardiac injection of Tanax® (0.5 mL/kg BW; Intervet Italia).

For each pig, the stomach was removed, opened along the greater curvature and rinsed with bidistilled water. Tissue specimens of ~1 cm2 were removed throughout the whole thickness of the oxyntic gland area near the greater curvature and pinned tautly on balsa wood; they were then immersed in 10% buffered formalin for 24 h. At the end of 24 h, the samples were removed from the fixative and washed in 5.14 mol/L ethanol. The specimens were then dehydrated in a graded series of ethanol and embedded in paraffin. For each pig, an additional sample of the entire oxyntic wall was collected, flash frozen in liquid nitrogen, and stored at –80°C for quantification of the expression of the H+/K+-ATPase gene and for histochemical staining.

    Immunohistochemistry. Formalin-fixed, paraffin-embedded specimens were serially sectioned (5µm), mounted on gelatin-coated slides, and then deparaffinized in xylene. To unmask the antigenic sites, the slides were heated in 10 mmol/L sodium citrate buffer (pH 6.0) for 2 periods of 5 min each in a microwave oven at 750 W. After microwave irradiation, the sections were allowed to cool to room temperature for 20 min. After cooling, the sections were washed in bidistilled water and adjacent sections underwent immunohistochemical staining to detect parietal and endocrine cells as described in detail previously (26). Supplemental Table 1 summarizes the antibodies used in this study and their dilutions in 1 mmol/L PBS, pH 7,4.

    Immunostaining of parietal cells. Immunostaining was performed to detect parietal cells using a mouse monoclonal antibody against an {alpha}-subunit of H+/K+-ATPase. All samples were immunostained with the avidin-biotin-peroxidase complex (ABC) method and examined under a conventional microscope for morphometric analyses; 2 randomly selected samples per diet were also stained using the indirect immunofluorescent method (IF) and examined under the confocal laser scanning microscope (CLSM).

For the ABC method, the sections were treated with 90 mmol/L H2O2 and then incubated at 4°C overnight in the primary antibody. Sections were then coated with biotin-conjugated goat anti-mouse IgG and treated with the ABC complex (Vector elite kit, Vector Laboratories) according to the directions provided by the manufacturer. The sections were then counterstained with Mayer's hematoxylin.

For the IF method, the sections were incubated at 4°C overnight in the primary antibody and then incubated in the dark for 1 h in the donkey anti-mouse FITC-labeled secondary antibody. The sections were examined and the images were acquired on a laser confocal scanning microscope, Olympus Fluo View 500 equipped with an appropriate Argon (488 nm) filter. Single- and multiplane scanning were used as 0.1-µm "optical sections" of stained cells.

Negative controls to prove the specificity of the secondary antisera were obtained by incubating the sections without the primary antibody or with nonimmune appropriate {gamma}-globulins.

    Immunostaining of endocrine cells. The sections were processed for double staining with CGA and HIS to identify HIS endocrine cells and with CGA and SST to identify SST endocrine cells, using the IF method as described above. Adjacent sections were incubated at 4°C overnight in a solution containing a mixture of the primary antibodies: mouse anti CGA/rabbit anti-HIS and mouse anti-CGA/rabbit anti-SST. The sections were then incubated in a mixture of the secondary antibodies: donkey anti-mouse-fluorescein isothiocyanate (FITC)-labeled and donkey anti-rabbit-tetramethylrhodamine isothiocyanate (TRITC)-labeled. The specimens were examined under a Zeiss Axioplan microscope equipped with the appropriate filter cubes to discriminate between FITC and TRITC.

    Histochemical staining. Histochemical staining of reduced NADH-tetrazolium reductase (NADH-TR) according to Novikoff et al. (27) was used to detect oxidative enzymes, rich in parietal cells. Histochemical staining was performed on frozen sections cut at 6 µm on a cryostat microtome at –20°C.

    Metachromasia. This staining was used on paraffin-embedded sections for the detection of mast cells by toluidine blue according to Mc Manus and Mowry (28).

    Morphometric analyses. Morphometric analyses were undertaken with a 40X objective lens using a Zeiss Axioplan microscope connected to KS 300 image analysis software (Kontron Elektronic). For each rat, 8 randomly selected regions of the mucosa, in which oxyntic glands were observed perpendicularly to the mucosa surface, were examined. In each region, all cells with intracellular reactivity, both cells with or without a nucleus, were counted. Of the 8 regions, 4 included the bottom and the middle part of the gland and 4 included the adjacent middle part and the superficial part of the gland; in this way the glands were screened for their entire length. A total area of 0.24 mm2 was examined for each rat. Results are expressed as the mean number of positive cells in the total area examined. In the selected regions, the cell areas (µm2) of 100 parietal cells were measured by outlining their profile on the monitor screen using a computer mouse; only cells with prominent nuclei were evaluated. Serially adjacent sections were used for counting CGA cells, HIS cells, doubly labeled CGA/HIS cells, and doubly labeled CGA/SST cells; only doubly labeled CGA/HIS cells were considered ECL cells. Results are expressed as the mean number of positive cells in the total area of 0.24 mm2. In 8 randomly selected areas, the depth of the lamina propria, from the pits to the muscularis mucosae, was measured for each rat.

    H+/K+-ATPase gene quantification. For each rat, 600 mg of tissue was immediately frozen in liquid nitrogen and stored at –80°C until use. Total RNA was isolated according to TRIzol Reagent (Invitrogen Life Technologies) protocol, and then treated with Deoxyribonuclease I, Amplification Grade (Invitrogen Life Technologies). From each sample, 1 µg of RNA was reverse transcribed using the ImProm-II Reverse Transcription System (Promega).

Two pairs of primers were designed on the nucleic acid sequence of pig H+/K+-ATPase (GenBank M22724) using OLIGO Primer Analysis Software, version 5.0 (NBI). The sequence (5'-3') and the length of the primers (pb) were as follows: external, AGCGAGACAGTGGAGGACATT, 1183 (FW); TGTGGTGTATGCAAGGATGGC (RV), internal, GCATATGAGAAGGCCGAGAG, 151 (FW); RV, TGGCCGTGAAGTAGTCAGTG (RV). External primers amplified a product that served as external homologous DNA standards of known copy number. This product was purified using the QIAquick PCR Purification Kit (QIAGEN). DNA quality and concentration were evaluated by a spectrophotometer. To overcome the problems related to the use of internal controls, such as "house-keeping genes" (29), we performed an absolute quantitative analysis; the external fragment was serially diluted in 1:10 steps and an external standard curve was created. The quantification reactions were performed in a LightCycler instrument (Roche Mannheim). Amplification was carried out in a 10-µL volume containing 2 µL of cDNA, 0.5 µmol/L of each internal primer and 5 µL of QuantiTect SYBR Green PCR Master Mix (QIAGEN). The protocol was as follows: 45 cycles of 94°C for 15 s, 57°C for 20 s, and 72°C for 12 s; the detection of the fluorescent product was set at the last step of each cycle. The specificity of each amplification was checked by a melting curve analysis. Data were expressed as gene copies/µg RNA.

    Individual susceptibility to E. coli adhesion. The individual susceptibility to E. coli K88 adhesion was assessed in vitro on villi collected from the small intestines of the pigs using the procedure of Van den Broeck et al. (25).

    Statistics. Data were analyzed by ANOVA using the General Linear Model (GLM) procedure (SAS version 8.1, SAS Institute) with a 3-factor design, including diet, cycle, sensitivity of intestinal villus to ETEC adhesion, and 1st level interactions. Sensitivity of intestinal villus to ETEC adhesion has relevance for growth, and for intestinal health and microbial and immune variables, in E. coli k88–challenged pigs (30). We decided to include this variable in the model to exclude the side effects of this challenge on gastric variables. The interactions, never statistically significant, were removed from the model and only the main effects were tested. The values presented are least square means ± SEM. Pair-wise comparisons between diets were done using Tukey's test (Adjust procedure in SAS). Differences were considered significant when P < 0.05. The expression values of the H+/K+-ATPase gene did not fulfill the assumptions of normality of residue distribution and a logarithmic transformation of the data was used. These last values were also processed by intraclass covariance analysis (GLM procedure), considering the 3 class factors of the general design, the number of cells (obtained with different stainings), and the number of cells within each diet. This analysis also revealed the correlations between H+/K+-ATPase and cell counts.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Preliminary considerations on challenge and on sensitivity of intestinal villus to ETEC adhesion. The factors "sensitivity of intestinal villus to ETEC adhesion" and cycle of the experiment in general did not affect the variables assessed and did not interact with the diet. However, in pigs that were susceptible to ETEC adhesion, there tended to be more parietal cells in NADH-TR counting (P = 0.078), but not in H/KATPase counting, and increased gene expression for H+/K+-ATPase in the oxyntic wall (P = 0.13) compared with nonsusceptible pigs (data not shown). Four pigs (2 consuming diet C and 1 from each experimental diet) died after the challenge with colibacillosis (data concerning the sensitivity of intestinal villi to ETEC adhesion not shown).

    General description of the oxyntic mucosa of piglets. The oxyntic mucosa was packed with relatively straight, unbranched glands opened in the foveolae (Fig. 1A). Because a strict division of the gland regions in isthmus, neck, and base linked to the distribution of cell types is somewhat difficult and arbitrary, we divided the glands into deep, middle, and superficial thirds. Parietal cells were scattered throughout the oxyntic glands, but were more numerous in the middle and superficial thirds. A different pattern of immunoreactivity was observed with the H+/K+-ATPase antibody in the majority of the parietal cells. Ring-like structures formed a network throughout the cytoplasm or surrounded the nucleus (reticular pattern) in the deep and middle thirds, and a few cells showed small granules filling the entire cytoplasm (diffuse pattern) (Fig. 1c). When parietal cells were examined in CLSM, the ring-like structures appeared as a network of hollow tubular formations throughout the cytoplasm (Fig. 1D). In all experimental groups, the cells showing the reticular pattern were prominent throughout the gland, whereas few cells with a diffuse pattern were scattered in the deep and middle thirds. Only in a few pigs did the diffuse pattern predominate throughout the gland. The cell areas varied greatly; small cells were intermingled with large round or typical polyhedral parietal cells. Round or oval endocrine cells stained by CGA were detected; they were intermingled with secretory exocrine cells throughout the oxyntic mucosa (Fig. 1E) and were most numerous in the deep and middle thirds of the gland. In the selected area of 0.24 mm2, from 35 to 37 ECL cells (CGA+/HIS+) were counted. Very few HIS+/CGA– cells were found in the lamina propria (Figs. 1F, and 2); they were identified as mast cells when adjacent sections were stained with toluidine blue. In the selected area of 0.24 mm2, from 10 to 12 SST cells (CGA+/SST+) were counted.


Figure 1
View larger version (140K):
[in this window]
[in a new window]
 
FIGURE 1  Effect of the diet on parietal cells in weaning pigs fed C (A, D, E, F) or F (B, C) diets. The oxyntic mucosa was immunostained with antibody to the {alpha}-subunit of H+/K+-ATPase (AD) and ECL cells double immunostained with antibody to HIS and CGA (E, F). Antibody binding was detected by the ABC method (AC) and by the IF method (DF). In the C group (A), parietal cells were more numerous than in the F group (B). The majority of the cells showed a reticular pattern; a few cells (arrows) showed a diffuse pattern (C). Multiple plane scanning showed hollow tubular structures (D); corresponding to the reticular pattern of the parietal cell shown at higher magnification in the small insert, ECL-like cells, CGA (E) and HIS (F) immune-reactive cells were spread throughout the gland (short arrows); few mast cells (arrows) were detectable.

 

Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2  Effect of the dietary addition of the F or P (12 g/kg feed) on the number of parietal cells in weaning pigs. The number of parietal cells was evaluated by staining with NADH-TR and H+-K+-ATPase; values are expressed for an area of 0.24 mm2. Values are Ismeans ± SEM, n = 13–14. Means without a common letter differ, P < 0.05.

 
    Dietary effect on the number and area of parietal cells. Glands from pigs fed the F diet had fewer parietal cells than the controls (Figs. 1A, B). Indeed, the number of parietal cells was significantly reduced in pigs fed the F diet for both H+/K+-ATPase and NADH-TR counting (P < 0.05, Fig. 2). In the P group, the number of parietal cells did not differ from that of the C group. The area of parietal cells and the depth of the lamina propria (data not shown) were not affected by the diet.

    Effect on the number of enteroendocrine cells. The numbers of endocrine cells secreting SST in an area of 0.24 mm2 were 9.15 ± 0.55 for C, 11.20 ± 0.51 for F, and 10.71 ± 0.52 for P. Compared with the controls, the number of endocrine cells secreting SST was higher in the stomachs of pigs fed the F diet (P < 0.05). On the contrary, the number of ECL cells (CGA+/HIS+), the number of remaining enteroendocrine cells (only CGA+), and the number of mast cells (CGA-/HIS+) were not affected by the diets. However, in pigs fed the F diet, the number of ECL cells in the superficial part of the gland was increased (P < 0.05, Fig. 3).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3  Effect of the dietary addition of free formate or fat-protected formate (12 g/kg feed) on the number of ECL cells in the deep and superficial parts of the oxyntic mucosa in weaning pigs. The F diet increased the number of ECL cells in the superficial part of the gland. Values are expressed for an area of 0.24 mm2. Values are lsmeans ± SEM, n = 13–14. Means without a common letter differ, P < 0.05.

 
    Expression of the gastric H+/K+-ATPase gene. This measure varied greatly among the groups as follows: Log10 (gene copies/µg RNA) 3.60 ± 0.27 for C; 2.83 ± 0.23 for F; and 3.08 ± 0.28, for P. The oxyntic wall of pigs fed the P diet had a reduced expression for H+/K+-ATPase compared with tissue from those fed the C diet (P < 0.05). With the addition of fat-protected formate in the diet, the expression for H+/K+-ATPase did not differ from that of either the C or F group.

The gene expression of H+/K+-ATPase in the oxyntic wall was positively correlated with the number of parietal cells, as identified by H+/K+-ATPase staining (r = 0.385; P < 0.01, Table 2). The correlation between the gene expression of H+/K+-ATPase and the number of parietal cells was not affected by the diet as shown by the absence of interaction between the covariate and the diet. The effect of the diet, which was significant in the original ANOVA, was not significant when the number of parietal cells was included as a covariate. These data indicate that the difference between the F and the C groups in H+/K+-ATPase gene expression was due in part to a different number of cells capable of secreting HCl. However, the percentage of total variability explained by the number of cells was not high, indicating that other factors affect the short-term activation of parietal cells.


View this table:
[in this window]
[in a new window]
 
TABLE 2 Percentage of total deviance and statistical significance of factors in the intraclass covariance analysis of the expression of H+/K+-ATPase gene in pigs supplemented or not with free or fat-protected calcium formate1

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The immunostaining of pig parietal cells was remarkably similar to the labeling pattern observed in both mice (31) and rats (32). When these species are stimulated by HIS or gastrin, a reticular pattern predominates in a majority of cells that are in an active secreting stage, whereas a diffuse pattern predominates in the resting stage. Thus, it was suggested that the activity in acid secretion of individual parietal cells can be evaluated morphologically by the immunostaining of H+/K+-ATPase and that the reticular pattern corresponds to the active stage characterized by the developed tubulovesicular network, whereas the diffuse pattern corresponds to the resting state (31,32). Consequently, we hypothesize that, in the pigs in the present study, the majority of the cells were stimulated by acid secretion, probably due to the meal that the pigs consumed 1 h before they were killed.

Using the weaning pig as a model, we demonstrated that the constant supply of an organic acid for 8 d strongly affects the structure of the oxyntic mucosa. The trend does not change substantially if the number of parietal cells is evaluated by immunostaining with H+/K+-ATPase antibody or by immunohistochemical stain with NADH-TR. However, with NADH-TR, the cell number was higher; this is not surprising because this stain is not a specific marker of parietal cells but is the expression of oxidative enzymes.

What led to the observed reduction in parietal cell number? It is thought that the endocrine cells, which constitute only a small percentage of the total number of cells in the mammalian oxyntic mucosa (33), are important factors for the maturation and development of the oxyntic mucosa. The reduction of parietal cell number in calcium formate–fed pigs could be consistent with the hypothesis of a negative effect of the acidifier on gastrin secretion. It is interesting to observe that, in mice, the blockade of gastrin-inducible CCK2 receptors of parietal cells and ECL cells determines long-term hypotrophy and hypoplasia of this mucosa (34). Moreover, in gastrin gene knock-out mice, a reduction in the number of parietal cells was observed, whereas the ECL cell number is not affected by gene deletion (3537). In the present experiment, the antral mucosa was not sampled; thus, we cannot say whether the number of gastrin-secreting G cells was also affected, although that is likely. In our trial, the free formate–induced reduction in parietal cells is concomitant with the increase in SST positive cells, but not with variations in total ECL numbers. Somatostatin acts as a potent inhibitor of gastric acid secretion. In mice, type 2 receptors for SST are found on both parietal and ECL cells (38). This suggests that SST may act to reduce acid secretion by directly affecting parietal cells or by attenuating HIS release from ECL cells. A third mode of action for SST is its inhibition of the release of the acid secretagogue hormone gastrin (39,40). Gastric SST-producing cells (D cells) are regulated by CCK through the activation of CCK1 receptors (23); more acidic meals strongly stimulate the release of CCK (41); this could explain the increased number of SST positive cells in the oxyntic mucosa after the addition of free calcium formate. ECL cells can also be involved in gastric morphology regulation; in fact, mice lacking histidine decarboxylase (the enzyme required for the synthesis of HIS) had an increased number of parietal cells, as demonstrated by Nakamura et al. (42). In our trial, the entire number of ECL cells was not changed by the diet; thus, it is not likely that HIS could have affected the numerical reduction of the parietal cells that occurred. It is not clear whether gastrin has some relevance for the growth of ECL cells in pigs. In gastrin gene knock-out mice, no effect of gene deletion was reported on the number of ECL cells (34,35). This observation is in accord with the absence of any effect of the organic salt on the total number of ECL cells. However, Chen et al. (35) observed that the distribution of ECL cells along the glands was affected, and this is considered an indicator of impaired activity. In our trial, the ratio between ECL cells in the deep part and cells in the superficial part of the glands was also changed, but in favor of more superficial cells. Data on ECL cells could have been integrated by histidine decarboxylase gene expression and by the concentration of circulating pancreastatin, which is a measure of ECL cell function (43).

To our knowledge, this is the first time that the gene expression for H+/K+-ATPase has been assessed in the oxyntic gastric mucosa of swine. We showed that the number of parietal cells is correlated with gene expression for H+/K+-ATPase but independent of the diet, as revealed by the analysis of covariance; this agrees with the observations done on cell culture (12). However, thee was a large individual variation for the gene expression for H+/K+-ATPase and other undetermined factors presumably affected by the quantity of specific mRNA. We standardized the time for the final meal (1 h) and the period of food deprivation before killing (1 h), but we could not take into account individual variations in the distribution of feed intake within the allotted time. Furthermore, the pigs had free access to water, and this could have diluted the gastric content to varying degrees. Finally we cannot exclude that H+/K+-ATPase protein abundance within the luminal facing membrane that is observed in parietal cells is more correlated with functional capacity.

The oxyntic mucosa from rats fed the P diet showed an intermediate pattern for the number of the different types of cells considered. Concerning the parietal cells, the data show that the protection of the acidifier could alleviate the depressive effect compared with the formate salt. On the other hand, the outcome for ECL cells and SST-positive cells is less clear. The protection of calcium formate was obtained by means of a triglyceride external layer. The release of formate from the globules was not tested, and we cannot exclude the fact that the fats were partially digested by salivary and gastric lipases. The use of protected acidifiers as supplements in infant diets could also be a tool for reducing the risk of acute lung injury, which is often observed in the case of the instillation of acidified diets into the lungs (44). Another reason for reducing the gastric availability of calcium formate is that the reduction of parietal cells can impair the production of the intrinsic factor required for vitamin B-12 absorption from the vitamin in the gastrointestinal tract (45). Indeed, a link between long-term gastric acid suppressive therapy and significant decreases in serum vitamin B-12 was demonstrated (46).

In our experiment, all of the pigs were challenged with an enterotoxigenic E. coli (a K88+ strain). A phenotypic test on jejunal villi showed that half of the pigs were susceptible to ETEC adhesion to the jejunum, whereas the others were not. The stomach is not a typical site of action for ETEC; however, our pigs that were susceptible to ETEC intestinal adhesion had a reduced daily live weight gain, a worse fecal score, and more days of diarrhea (Bosi et al., unpublished data), and we speculate that a general more inflammatory condition could have affected the stomach morphology of these pigs. Indeed, local inflammation related to a greater bacterial load in the stomach leads to an increase in the number of parietal cells and of gastrin output (47). Because the number of parietal cells in NADH-TR counting tended to increase, as did the gene expression for H+/K+-ATPase in K88 susceptible pigs, it might be possible to extend previous observations for stomach infection to intestinal infection. However in H+/K+-ATPase counting, the number of parietal cells was not affected; thus, we cannot definitively conclude that pigs that are more affected by ETEC infection respond with an increased stimulus for acid secretion.

In conclusion, supplementation with the salt of an organic acid and any change from a diet containing a relevant portion of these additives, such as calcium formate, to a diet without them should be carefully considered.


    ACKNOWLEDGMENTS
 
We are grateful to Prof. Laura Calzà for her valuable assistance with the laser confocal scanning microscope.


    FOOTNOTES
 
1 Presented in part at the LVIII Meeting of the Italian Society for Veterinary Sciences, September 2004, Grado, Italy [Mazzoni, M., Lalatta Costerbosa, G., Casini, L., Petrosino, G., Trevisi, P., De Filippi, S., Bosi, P. La morfologia dello stomaco come parametro di valutazione dell'impiego di acidificanti nella dieta del suino in svezzamento (Gastric morphology as a parameter to evaluate the use of acidifiers in the diet of the weaning pig) (abstract). Atti SISVET. 56: 240]. Back

2 Financial support for this project was provided by HEALTHYPIGUT (contract no. QLK5-CT 2000-00522) from the European Union. The authors are solely responsible for this text, which does not represent the opinion of the EC and the EC is not responsible for the information contained herein. Back

3 Supplemental Table 1 is available with the online posting of this paper at www.nutrition.org. Back

5 Abbreviations used: ABC, avidin-biotin-peroxidase complex; C, control diet; CCK, cholecystokinin; CGA, chromogranin A; CLSM, confocal laser scanning microscope; ECL, enterochromaffin-like cell; ETEC, enterotoxigenic Escherichia coli; F, free calcium formate die; FITC, fluorescein isothiocyanate; HIS; histamine; IF, immunofluorescent method; P, fat-protected calcium formate diet; SST, somatostatin; TRITC, tetramethylrhodamine isothiocyanate. Back

Manuscript received 12 September 2005. Initial review completed 9 November 2005. Revision accepted 30 January 2006.


    LITERATURE CITED
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Cranwell PD, Noakes DE, Hill KJ. Gastric secretion and fermentation in the suckling pig. Br J Nutr. 1976;36:71–86.[Medline]

2. Tudor EM, Schofield GC, Titchen DA. Structural and functional development of the gastric parietal cell population in the newborn pig. Ann Rech Vet. 1977;8:450–9.[Medline]

3. Cranwell PD. The development of acid and pepsin (EC 3.4.23.1) secretory capacity in the pig; the effects of age and weaning. 1. Studies in anaesthetized pigs. Br J Nutr. 1985;54:305–20.[Medline]

4. Partanen KH, Mroz Z. Organic acids for performance enhancement in pig diets. Nutr Res Rev. 1999;12:117–45.

5. Tsiloyiannis VK, Kyriakis SC, Vlemmas J, Sarris K. The effect of organic acids on the control of porcine post-weaning diarrhoea. Res Vet Sci. 2001;70:287–93.[Medline]

6. Brunser O, Araya M, Espinoza J, Guesry PR, Secretin MC, Pacheco I. Effect of an acidified milk on diarrhoea and the carrier state in infants of low socio-economic stratum. Acta Paediatr Scand. 1989;78:259–64.[Medline]

7. Mehall JR, Northrop R, Saltzman DA, Jackson RJ, Smith SD. Acidification of formula reduces bacterial translocation and gut colonization in a neonatal rabbit model. J Pediatr Surg. 2001;36:56–62.[Medline]

8. Heyland DK, Cook DJ, Schoenfeld PS, Frietag A, Varon J, Wood G. The effect of acidified enteral feeds on gastric colonization in critically ill patients: results of a multicenter randomized trial. Canadian Critical Care Trials Group. Crit Care Med. 1999;27:2399–406.[Medline]

9. Hanzlik RP, Fowler SC, Fisher DH. Relative bioavailability of calcium from calcium formate, calcium citrate, and calcium carbonate. J Pharmacol Exp Ther. 2005;313:1217–22.[Abstract/Free Full Text]

10. Hanzlik RP, Fowler SC, Eells JT. Absorption and elimination of formate following oral administration of calcium formate in female human subjects. Drug Metab Dispos. 2005;33:282–6.[Abstract/Free Full Text]

11. Pettitt JM, Humphris DC, Barrett SP, Toh BH, van Driel IR, Gleeson PA. Fast freeze-fixation/freeze-substitution reveals the secretory membranes of the gastric parietal cell as a network of helically coiled tubule. A new model for parietal cell transformation. J Cell Sci. 1995;108:1127–41.[Abstract]

12. Campbell VW, Yamada T. Regulation of CA II and H+,K(+)-ATPase gene expression in canine gastric parietal cells. Ann N Y Acad Sci. 1989;574:159–64.[Abstract]

13. Beinborn M, Giebel J, Linck M, Cetin Y, Schwenk M, Sewing KF. Isolation, identification and quantitative evaluation of specific cell types from the mammalian gastric mucosa. Cell Tissue Res. 1993;274:229–40.[Medline]

14. Schubert ML. Gastric secretion. Curr Opin Gastroenterol. 2003;19:519–25.[Medline]

15. Tzaneva MA. Electron microscopic immunohistochemical investigation of chromogranin A in endocrine cells in human oxyntic gastric mucosa. Acta Histochem. 2001;103:179–94.[Medline]

16. Portela-Gomes GM, Stridsberg M. Chromogranin A in the human gastrointestinal tract: an immunocytochemical study with region-specific antibodies. J Histochem Cytochem. 2002;50:1487–92.[Abstract/Free Full Text]

17. Kamoshida S, Saito E, Fukuda S, Kato K, Iwasaki A, Arakawa Y. Anatomical location of enterochromaffin-like (ECL) cells, parietal cells, and chief cells in the stomach demonstrated by immunocytochemistry and electron microscopy. J Gastroenterol. 1999;34:315–20.[Medline]

18. Hakanson R, Böttcher G, Ekblad E, Panula P, Simonsson M, Dohlsten M, Hallbergh T, Sundler F. Histamine in endocrine cells in the stomach. A survey of several species using a panel of histamine antibodies. Histochemistry. 1986;86:5–17.[Medline]

19. Lindström E, Chen D, Norlén P, Andersson K, Hakanson R. Control of gastric acid secretion: the gastrin-ECL cell-parietal cell axis. Comp Biochem Physiol A Mol Integr Physiol. 2001;128:505–14.[Medline]

20. Walsh JH, Richardson CT, Fortran JS. pH dependence of acid secretion and gastrin release in normal and ulcer subjects. J Clin Invest. 1975;55:462–8.[Medline]

21. Fahrenkrug J, Schaffalitzky de Muckadell OB, Hornum I, Rehfeld JF. The mechanism of hypergastrinemia in achlorhydria. Effect of food, acid, and calcitonin on serum gastrin concentrations and component pattern in pernicious anemia, with correlation to endogenous secretin concentrations in plasma. Gastroenterology. 1976;71:33–7.[Medline]

22. Konturek SJ, Rayford PL, Thompson JC. Effect of pH of gastric and intestinal meals on gastric acid and plasma gastrin and secretin responses in the dog. Am J Physiol. 1977;233:E537–43.[Medline]

23. Schmidt WE, Schmitz F. Genetic dissection of the secretory machinery in the stomach. Gastroenterology. 2004;126:606–9.[Medline]

24. Osek J. Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy piglets after weaning. Vet Microbiol. 1999;68:209–17.[Medline]

25. Van den Broeck W, Cox E, Goddeeris BM. Receptor-dependent immune responses in pigs after oral immunization with F4 fimbriae. Infect Immun. 1999;67:520–6.[Abstract/Free Full Text]

26. Chiocchetti R, Grandis AM, Bombardi C, Clavenzani P, Lalatta-Costerbosa G, Lucchi ML, Furness JB. Characterisation of neurons expressing calbindin immunoreactivity in the ileum of unweaned and mature sheep. Cell Tissue Res. 2004;318:289–303.[Medline]

27. Novikoff AB, Shin WY, Drucker J. Mitochondrial localization of oxidative enzymes: staining results with two tetrazolium salts. J Biophys Biochem Cytol. 1961;9:47–61.[Medline]

28. McManus JFA, Mowry RW. Staining methods. Histologic and histochemical. New York: Hoeber, 1960.

29. Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol. 2002;29:23–39.[Abstract]

30. Bosi P, Gremokolini C, Trevisi P, Mazzoni M, Bonilauri P, Sarli G, Casini L. La stimulation orale par E. coli K88 comme méthode d‘évaluation des performances de croissance et de l’état de santé des porcelets sevrés dans les études expérimentales d'alimentation. [Oral challenge with E. coli K88 as a tool to assess growth and health performance in feeding trials of weaned pigs]. Journées Recherche Porcine. 2004;36:125–32.

31. Petrovic S, Wang Z, Ma L, Seidler U, Forte JG, Shull GE, Soleimani M. Colocalization of the apical Cl-/HCO3 exchanger PAT 1 and gastric H-K-ATPase in stomach parietal cells. Am J Physiol Gastrointest Liver Physiol. 2002;283:G1207–16.[Abstract/Free Full Text]

32. Jiang X, Suzaki E, Kataoka K. Immunofluorescence detection of gastric H+/K+-ATPase and its alterations as related to acid secretion. Histochem Cell Biol. 2002;117:21–7.[Medline]

33. Helander HF. The cells of the gastric mucosa. Int Rev Cytol. 1981;70:217–89.[Medline]

34. Bjorkqvist M, Norlen P, Kitano M, Chen D, Zhao CM, de la Cour CD, Gagnemo-Persson C, Hakanson R. Effects of CCK2 receptor blockade on growth parameters in gastrointestinal tract and pancreas in rats. Pharmacol Toxicol. 2001;89:208–13.[Medline]

35. Friis-Hansen L. Gastric functions in gastrin gene knock-out mice. Pharmacol Toxicol. 2002;91:363–7.[Medline]

36. Zhao CM, Wang X, Friis-Hansen L, Waldum HL, Halgunset J, Wadstrom T, Chen D. Chronic Helicobacter pylori infection results in gastric hypoacidity and hypergastrinemia in wild-type mice but vagally induced hypersecretion in gastrin-deficient mice. Regul Pept. 2003;115:161–70.[Medline]

37. Chen D, Zhao CM, Hakanson R, Samuelson LC, Rehfeld JF, Friis-Hansen L. Altered control of gastric acid secretion in gastrin-cholecystokinin double mutant mice. Gastroenterology. 2004;126:476–87.[Medline]

38. Allen JP, Canty AJ, Schulz S, Humphrey PP, Emson PC, Young HM. Identification of cells expressing somatostatin receptor 2 in the gastrointestinal tract of Sstr2 knockout/lacZ knockin mice. J Comp Neurol. 2002;454:329–40.[Medline]

39. Bloom SR, Mortimer CH, Thorner MO, Besser GM, Hall R, Gomez-Pan A, Roy VM, Russell RC, Coy DH, et al. Inhibition of gastrin and gastric-acid secretion by growth-hormone release-inhibiting hormone. Lancet 1974:2(7889):1106–1109.[Medline]

40. Fykse V, Coy DH, Waldum HL, Sandvik AK. Somatostatin-receptor 2 (sst2)-mediated effects of endogenous somatostatin on exocrine and endocrine secretion of the rat stomach. Br J Pharmacol. 2005;144:416–21.[Medline]

41. Konturek JW, Konturek SJ, Domschke W. Cholecystokinin in the control of gastric acid secretion and gastrin release in response to a meal at low and high pH in healthy subjects and duodenal ulcer patients. Scand J Gastroenterol. 1995;30:738–44.[Medline]

42. Nakamura E, Kataoka T, Furutani K, Jimbo K, Aihara T, Tanaka S, Ichikawa A, Ohtsu H, Okabe S. Lack of histamine alters gastric mucosal morphology: comparison of histidine decarboxylase-deficient and mast cell-deficient mice. Am J Physiol Gastrointest Liver Physiol. 2004;287:G1053–61.[Abstract/Free Full Text]

43. Chen D, Monstein HJ, Nylander AG, Zhao CM, Sundler F, Hakanson R. Acute responses of rat stomach enterochromaffinlike cells to gastrin: secretory activation and adaptation. Gastroenterology. 1994;107:18–27.[Medline]

44. Chin C, Lerman J, Endo J. Acute lung injury after tracheal instillation of acidified soya-based or Enfalac formula or human breast milk in rabbits. Can J Anaesth. 1999;46:282–6.[Abstract/Free Full Text]

45. Doscherholmen A, Ripley D, Chang S, Silvis SE. Influence of age and stomach function on serum vitamin B12 concentration. Scand J Gastroenterol. 1977;12:313–9.[Medline]

46. Termanini B, Gibril F, Sutliff VE, Yu F, Venzon DJ, Jensen RT. Effect of long-term gastric acid suppressive therapy on serum vitamin B12 levels in patients with Zollinger-Ellison syndrome. Am J Med. 1998;104:422–30.[Medline]

47. Zavros Y, Rieder G, Ferguson A, Samuelson LC, Merchant JL. Genetic or chemical hypochlorhydria is associated with inflammation that modulates parietal and G-cell populations in mice. Gastroenterology. 2002;122:119–33.[Medline]




This article has been cited by other articles:


Home page
J. Nutr.Home page
M. Mazzoni, M. Le Gall, S. De Filippi, L. Minieri, P. Trevisi, J. Wolinski, G. Lalatta-Costerbosa, J.-P. Lalles, P. Guilloteau, and P. Bosi
Supplemental Sodium Butyrate Stimulates Different Gastric Cells in Weaned Pigs
J. Nutr., August 1, 2008; 138(8): 1426 - 1431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supporting Material
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bosi, P.
Right arrow Articles by Lalatta-Costerbosa, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bosi, P.
Right arrow Articles by Lalatta-Costerbosa, G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]