Journal of Nutrition EB Program 2010 Early Registration

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemmis, C. M.
Right arrow Articles by Welsh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemmis, C. M.
Right arrow Articles by Welsh, J.
© 2006 American Society for Nutrition J. Nutr. 136:887-892, April 2006


Biochemical, Molecular, and Genetic Mechanisms

Human Mammary Epithelial Cells Express CYP27B1 and Are Growth Inhibited by 25-Hydroxyvitamin D-3, the Major Circulating Form of Vitamin D-31

Carly M. Kemmis, Sally M. Salvador, Kelly M. Smith2 and JoEllen Welsh3

Department of Biological Sciences, University of Notre Dame, Notre Dame, IN 46556

3 To whom correspondence should be addressed. E-mail: jwelsh3{at}nd.edu.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
1{alpha},25-dihydroxycholecalciferol [1{alpha},25(OH)2D3], the active form of cholecalciferol, is a negative growth regulator of breast cancer cells. CYP27B1 is a cytochrome P450-containing hydroxylase expressed in kidney and other tissues that generates 1{alpha},25(OH)2D3 from an inactive vitamin D precursor 25-hydroxycholecalciferol [25(OH)D3]. In these studies, we tested the hypothesis that mammary cells express CYP27B1 and locally produce 1{alpha},25(OH)2D3, which acts in an autocrine manner to regulate cell turnover. Using Western blot and quantitative real-time PCR, CYP27B1 mRNA and protein were detected in immortalized, nontumorigenic human mammary epithelial cell (HMEC) cultures. Furthermore, HMEC cultures were dose dependently growth inhibited by physiological concentrations of 25(OH)D3, suggesting that CYP27B1 converts this precursor cholecalciferol metabolite to 1{alpha},25(OH)2D3, the ligand for the vitamin D receptor (VDR). In support of this suggestion, both 1{alpha},25(OH)2D3 and 25(OH)D3 transactivated VDR in HMEC cultures, as measured by induction of a vitamin D responsive reporter gene and upregulation of CYP24, an endogenous VDR target gene. No induction of CYP24 by 25(OH)D3 was observed in mammary cells derived from CYP27B1 null mice. Similar results were observed in 2 independently derived immortalized HMEC lines as well as in primary cultures derived from human breast epithelium. These are the first studies to demonstrate that nontransformed human mammary cells express CYP27B1, that they are growth inhibited by physiologically relevant concentrations of 25(OH)D3, and that they provide a biological mechanism linking vitamin D status to breast cancer risk.


KEY WORDS: • vitamin D • mammary • breast cancer • CYP27B1

The vitamin D steroids ergocalciferol (D-2) and cholecalciferol (D-3) modulate calcium homeostasis, cell turnover, and immune responses in a variety of tissues. Vitamin D-2 and D-3 can be obtained from natural foods, fortified products, and supplements, and vitamin D-3 can be synthesized from 7-dehydrocholesterol in skin exposed to UVB radiation (sunlight). Regardless of source, vitamins D-2 and D-3 exert biological activity only after a series of hydroxylations catalyzed by cytochrome P450 (CYP)4-containing enzymes. The first of these conversions is catalyzed by CYP27A, a vitamin D 25-hydroxylase, which metabolizes cholecalciferol to 25-hydroxycholecalciferol [25(OH)D3], a circulating metabolite present in the nmol/L range that correlates with vitamin D-3 status (1). Although 25(OH)D3 is the major circulating form of cholecalciferol, its only known function is to serve as a precursor to 1,25-dihydroxycholecalciferol [1,25(OH)2D3], the biologically active metabolite generated by CYP27B1 [25(OH)D3 1{alpha}-hydroxylase], a mitochondrial enzyme present in renal proximal tubules (2). Renal CYP27B1 activity is inversely correlated with calcium status, and serum concentrations of 1,25(OH)2D3 are kept in the pmol/L range through classical negative feedback mechanisms. Thus, under conditions of normocalcemia, renal CYP27B1 activity is inhibited and 25(OH)D3 is instead metabolized by CYP24 (a vitamin D 24-hydroxylase) to 24,25-dihydroxyvitamin D3 [24,25(OH)2D3], a biologically inactive metabolite that is ultimately converted to calcitroic acid and excreted (3).

In addition to its role in calcium homeostasis, epidemiologic studies suggest that optimal vitamin D status has a protective effect against the formation and progression of several common cancers (46). 1,25(OH)2D3 interacts with the vitamin D receptor (VDR) to inhibit directly the growth of prostate, colon, and breast cancer cells (710); however, these growth regulatory effects are observed at concentrations (100 nmol/L) well above the physiologic range that are in fact toxic in vivo. Based on these considerations, it is unlikely that 1,25(OH)2D3 acts at the systemic level to regulate cell growth in vivo. The identification of CYP27B1 in skin, colon, prostate, and breast (1115) suggests that locally generated 1,25(OH)2D3 could act in an autocrine manner to protect cells against transformation. In support of this concept, low circulating levels of the CYP27B1 substrate, 25(OH)D3, are positively (1) correlated with biomarkers and/or risk for prostate, colon, and breast cancer (5,1618). Moreover, extrarenal expression of CYP27B1 appears to be of biological significance because locally generated 1,25(OH)2D3 inhibited growth and induced differentiation of transformed keratinocytes in a xenograft model (19). In addition, loss of CYP27B1 in prostate cancer cells correlated with reduced sensitivity to 25(OH)D3 (14).

The hypothesis that CYP27B1 in extrarenal tissues may generate sufficient 1,25(OH)2D3 to affect cell transformation predicts that normal epithelial cells would express both VDR and CYP27B1, a prediction that has already held true for normal keratinocytes, colonocytes, and prostate epithelial cells (12,14). Although CYP27B1 is expressed in human and murine mammary tissue and breast cancer cell lines (20,21), little is known about vitamin D metabolism in nontumorigenic mammary epithelial cells. In this study, we demonstrate that both immortalized and primary cells derived from human breast express CYP27B1, and that 25(OH)D3 regulates expression of VDR target genes and inhibits cell growth at physiologic concentrations. These data suggest that the concentration of circulating 25(OH)D3 may dictate the ability of mammary cells to synthesize 1,25(OH)2D3, which could affect cell turnover, thus providing a biological basis for the epidemiologic data linking vitamin D status to breast cancer risk.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Cell culture. Primary human mammary epithelial cells (PHMEC) and a telomerase-immortalized, nontumorigenic human mammary epithelial cell (HMEC) line were obtained from Cambrex. The data obtained in the HMEC cultures were confirmed in an independently derived telomerase-immortalized HMEC line donated by Dr. Robert Weinberg (MIT, Cambridge, MA) (22); however, for simplicity, only data from the commercially available cells are shown. Although capable of infinite population doublings in vitro, telomerase-immortalized HMEC cultures retain morphology and growth characteristics of normal mammary epithelial cells, and are not tumorigenic in the absence of additional genetic mutations (22). MCF-7 breast cancer cells were obtained from the American Type Culture Collection, and HKC-8 SV-40 immortalized human proximal kidney cells were provided by Dr. Lorraine Racusen (Johns Hopkins University, Baltimore, MD). All cell lines were grown at 37C° and 5% CO2 in a humidified incubator. HMEC and PHMEC were cultured in Medium171 (Cascade Biologics) supplemented with 0.4% v:v bovine pituitary extract, 5 mg/L bovine insulin, 0.5 mg/L hydrocortisone, and 3 µg/L human epidermal growth factor (MEGS, Cascade Biologics). MCF-7 cells were cultured in {alpha}MEM containing 5% fetal bovine serum. HKC-8 cells were cultured in DMEM/F-12 containing 5% fetal bovine serum. Primary mammary cells from CYP27B1 knockout mice (23) were isolated by collagenase digestion as described (8) and cultured in Medium171 supplemented with MEGS.

    Growth assay. Exponentially growing HMEC, PHMEC, and MCF-7 cultures were treated 1 d after plating with ethanol vehicle, 1,25(OH)2D3 or 25(OH)D3, at the concentrations indicated in the figure legends. For time-course studies, cells were harvested before treatment and after 24, 48, 72, and 96 h with no media changes; for all other studies, media were replenished after 72 h. Cultures were fixed with 1% glutaraldehyde and stained with 0.1% crystal violet. After solubilization of the stain in 0.1% Triton X-100, absorbance was measured at 590 nm as an indicator of cell density.

    Immunoblotting. Subconfluent cultures of HMEC, PHMEC, MCF-7, HKC-8, and primary murine cells were treated with ethanol vehicle, 1,25(OH)2D3, or 25(OH)D3 for 48 h. Monolayers were scraped into laemmli buffer containing protease and phosphatase inhibitors (10 mmol/L benzamidine, 10 mmol/L sodium fluoride, 100 mmol/L sodium vanadate, 25 µg/µL aprotinin, 25 µg/µL pepstatin, 25 µg/µL leupeptin, and 1 mmol/L phenylmethylsulfonyl fluoride) and sonicated. After separation on 10% SDS-PAGE, transfer to nitrocellulose, and blocking with 20% skim milk, primary antibodies were applied at 1:40 (VDR Clone 9A7, NeoMarkers), 1:200 (CYP24, donated by Cytochroma) or 1:500 (CYP27B1, The Binding Site) dilutions. After being washed in PBS/0.1% Tween, horseradish peroxidase conjugated anti-rat (Santa Cruz Biotechnology), anti-mouse (Amersham Biosciences) or anti-sheep (Jackson ImmunoResearch) secondary antibodies were applied and VDR, CYP24, and CYP27B1 abundance was detected by chemiluminescence. Specific bands were detected at 52 kDa (VDR), 50 kDa (CYP24), and 56 kDa (CYP 27B1). Ponceau staining was used to confirm equal loading, and in some cases, blots were stripped and reprobed with anti-GAPDH.

    Quantitative real-time PCR. Subconfluent HMEC, MCF-7, and HKC-8 cells were treated with ethanol vehicle, 100 nmol/L 1,25(OH)2D3, or 100 nmol/L 25(OH)D3 for 24h, and total RNA was extracted with RNeasy Mini Kit (Qiagen). cDNA synthesized with TaqMan Reverse Transcription Reagents (Applied Biosystems) was analyzed by real-time PCR using TaqMan PCR Core Reagent Kit (Applied Biosystems) and primers and probes specific for CYP27B1 (forward: AGTTGCTATTGGCGGGAGTG; reverse: GTGCCGGGAGAGCTCATACA, probe: ACTACCGCAAAGAAGGCTACGGGCTG) and CYP24 (forward: CAAACCGTGGAAGGCCTATC, reverse: AGTCTTCCCCTTCCAGGATCA, probe: ACTACCGCAAAGAAGGCTACGGGCTG). CYP27B1 and CYP24 expression was normalized against 18S RNA (forward: AGTCCCTGCCCTTTGTACACA, reverse: GATCCGAGGGCCTCACTAAAC, probe: CGCCCGTCGCTACTACCGATTGG) expression, which was analyzed in parallel.

    Transient transfections. Subconfluent HMEC, PHMEC, MCF-7, and HKC-8 cells were co-transfected in serum-free medium with a 300-bp vitamin D–responsive region of the CYP24 promoter driving the firefly luciferase reporter gene (pGL3–24OH, 0.64 µg, obtained from the late Dr. Jack Omdahl) and the thymidine kinase promoter driving the renilla luciferase reporter gene (pRL-TK, 0.16µg, Promega) using a 3:2 (v:wt) ratio of FUGENE:DNA. After 4 h, the cells were treated with ethanol vehicle, 100 nmol/L 1,25(OH)2D3, or 100 nmol/L 25(OH)D3 in complete media conditions for 24h. Dual luciferase assays were performed using reagents from Promega, and pGL3-24OH values were normalized to pRL-TK. Data are presented as relative luciferase units (RLU) where control values were set to 1 for each cell line.

    Statistical analyses. Data are expressed as means ± SE, with the number of replicates indicated in each figure legend. Student's t test and 1-way ANOVA followed by Tukey's multiple comparison test were used [Instat Software (GraphPad)]. Differences were considered significant at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    VDR is expressed and functional in non-transformed mammary cells. The growth inhibitory effects of 1,25(OH)2D3, the VDR ligand, in breast cancer cells are well recognized; however, little is known about vitamin D signaling in nontumorigenic mammary cells. Therefore, we compared VDR expression and function in HMEC, MCF-7, and HKC-8 cells (Fig, 1). VDR was detected in all cell lines, but was highest in the noncancerous HMEC cultures and lowest in HKC-8 renal cells (Fig. 1A). In all cell lines, 100 nmol/L 1,25(OH)2D3 significantly (P < 0.05) induced the vitamin D responsive reporter gene containing the CYP24 promoter (Fig. 1B). Similarly, 100 nmol/L 1,25(OH)2D3 significantly (P < 0.05) enhanced CYP24 mRNA and protein expression in HMEC, MCF-7 and HKC-8 cells (Fig. 1C,D). Based on the magnitude of CYP24 induction, MCF-7 cells were more sensitive to 1,25(OH)2D3 than HMEC and HKC-8 cultures. Collectively, these data indicate that the VDR is expressed and functional in HMEC cultures, and that this signaling pathway remains intact in MCF-7 breast cancer cells.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1  Expression and function of VDR in HMEC, MCF-7 and HKC-8 cells. (A) Lysates from HMEC, MCF-7, and HKC-8 cells were immunoblotted with an antibody against VDR. (B) HMEC, MCF-7, and HKC-8 cells were co-transfected with a CYP24 reporter gene and a normalization gene and treated for 24 h with vehicle or 100 nmol/L 1,25(OH)2D3. For each cell line, the RLU for vehicle-treated cells were set to 1 and fold induction by 1,25(OH)2D3 is shown. Values are means ± SEM, n = 4. (C) CYP24 mRNA expression in cells treated with vehicle or 100 nmol/L 1,25(OH)2D3 for 24 h was assessed by real-time PCR and normalized against 18S RNA. For each cell line, data are expressed as fold of the control cells. Values are means ± SEM, n = 3. (D) Lysates from cells treated with 100 nmol/L 1,25(OH)2D3 for 24 h were immunoblotted with antibodies against CYP24 (top panel) and GAPDH (bottom panel). *Different from the control, P < 0.01.

 
    Comparative effects of 1,25(OH)2D3 on growth of HMEC and MCF-7 cultures. Because 1,25(OH)2D3 induces differentiation, cell cycle arrest, and apoptosis in VDR positive breast cancer cells, we next compared the effects of 1,25(OH)2D3 on HMEC and MCF-7 cell growth (Fig. 2). HMEC cultures were dose dependently growth inhibited by 1–100 nmol/L 1,25(OH)2D3 over 96 h of treatment (P < 0.05). In agreement with previous reports (24), MCF-7 cells were also growth inhibited by 10–100 nmol/L 1,25(OH)2D3 after 96 h (P < 0.05). These data indicate that 1,25(OH)2D3 induces growth inhibition in both immortalized and transformed mammary epithelial cell types.


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 2  Effect of 1,25(OH)2D3 on growth of HMEC and MCF-7 cells. HMEC (upper panel) and MCF-7 (lower panel) cells were treated for 96 h with ethanol vehicle or increasing concentrations of 1,25(OH)2D3. Cell density was assessed by crystal violet assay and expressed as a percentage of the control. Values are means ± SEM, n = 3. Means not sharing a common letter differ, P < 0.05.

 
    CYP27B1 expression and regulation in HMEC, MCF-7, and HKC-8 cultures. The presence of CYP24 (Fig. 1) indicates that HMEC cultures have the potential to convert 25(OH)D3 to 24,25(OH)2D3, an inactive metabolite that does not bind VDR. To determine whether mammary cells also have the potential for bioactivation of vitamin D to 1,25(OH)2D3, we measured CYP27B1 expression by quantitative real-time PCR and immunoblotting (Fig. 3A, B). CYP27B1 mRNA was detected in all 3 cell lines, but expression was higher in HMEC and MCF-7 cultures compared with HKC-8 renal cells, which were characterized previously as an in vitro model of vitamin D metabolism (25). CYP27B1 protein was detected at 56 kDa in all cell lines, with the highest relative expression in MCF-7 cells. Consistent with known negative feedback of 1,25(OH)2D3 on its own synthesis (3), CYP27B1 mRNA expression in HMEC cultures was inhibited by 24 h of treatment with 100 nmol/L 1,25(OH)2D3 (P < 0.1, Fig. 3C). In contrast, 1,25(OH)2D3 did not reduce CYP27B1 mRNA expression in MCF-7 or HKC-8 cells (Fig. 3C).


Figure 3
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3  Comparative gene expression of CYP27B1 in HMEC, MCF-7, and HKC-8 cells. (A) CYP27B1 mRNA expression was determined by real-time PCR and expressed as relative gene expression after normalization to 18S RNA. Bars not sharing a common letter differ, P < 0.05. (B) Lysates from HMEC and MCF-7 cells were immunoblotted with an antibody against CYP27B1. (C) CYP27B1 mRNA expression in HMEC, MCF-7, and HKC-8 cultures treated with vehicle or 100 nmol/L 1,25(OH)2D3 for 24 h was assessed by real-time PCR as described in (A). For each cell line, data are expressed as fold of the control cells. Values are means ± SEM, n = 3. *Different from the control, P < 0.01.

 
    Effects of 25(OH)D3 on VDR target genes and growth in HMEC cultures. We hypothesized that the presence of CYP27B1 would enable mammary cells to metabolize 25(OH)D3 to 1,25(OH)2D3, which could activate VDR in an autocrine fashion. This hypothesis predicts that 25(OH)D3 would exert similar effects on growth and VDR-mediated gene expression in HMEC cultures as 1,25(OH)2D3. HMEC cultures were dose dependently growth inhibited by 25(OH)D3 at concentrations ≥ 10 nmol/L (Fig. 4A). As would be predicted if metabolic conversion is a prerequisite for activity, HMEC were 10-fold less sensitive to 25(OH)D3 than 1,25(OH)2D3 (compare Figs 2A and 4A). In addition, 100 nmol/L 25(OH)D3 mimicked the effects of 1,25(OH)2D3 on the VDR target genes CYP24 (induction) and CYP27B1 (inhibition) (Fig. 4B). To exclude the possibility that 25(OH)D3 could directly activate VDR in the absence of metabolism, the effects of 25(OH)D3 and 1,25(OH)2D3 on CYP24 protein expression were measured in cells isolated from the mammary gland of CYP27B1 knockout mice (Fig. 4C). In these cells, 1,25(OH)2D3 clearly induced CYP24 (indicating the presence of functional VDR) but 25(OH)D3 did not, indicating that functional CYP27B1 is required for VDR target gene induction by 25(OH)D3. Collectively, these data strongly suggest that CYP27B1 in mammary cells is capable of bioactivating 25(OH)D3 to 1,25(OH)2D3 which in turn activates VDR and inhibits cell proliferation.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4  Effect of 25(OH)D3 on growth and regulation of VDR target genes in mammary cell cultures. (A) Cell density of HMEC cultures treated for 96 h with ethanol vehicle or increasing concentrations of 25(OH)D3. Data were obtained by crystal violet staining and are expressed as a percentage of the control. Values are means ± SEM, n = 3. Means not sharing a common letter differ, P < 0.05. (B) CYP24 (left) and CYP27B1 (right) mRNA expression in HMEC cultures treated with ethanol vehicle or 100 nmol/L 25(OH)D3 for 24 h was assessed by real-time PCR and normalized against 18S RNA. Data are expressed as fold of the control cells. Values are means ± SEM, n = 3. *Different from the control, P < 0.01. (C) Mammary cells isolated by collagenase digestion from mice with targeted deletion of CYP27B1 were treated with ethanol vehicle, 100 nmol/L 1,25(OH)2D3 or 100 nmol/L 25(OH)D3 for 48 h prior to determination of CYP24 expression by immunoblotting.

 
    Expression and function of VDR and CYP27B1 in primary mammary cell cultures. To exclude the possibility that the expression of CYP27B1 and VDR in telomerase-immortalized mammary cells could be secondary to the immortalization process, we utilized PHMEC. PHMEC cultures, derived from normal breast, are telomerase negative, have a finite lifespan, and express markers of mammary cell differentiation. Immunoblotting indicated that PHMEC cultures also express VDR, CYP27B1, and CYP24 proteins (Fig. 5A, top panels). For these cells, both 100 nmol/L 1,25(OH)2D3 and 100 nmol/L 25(OH)D3 induced CYP24 protein (Fig. 5A, bottom panels) and activated the VDR responsive reporter gene (Fig. 5B). As for HMEC cultures, 25(OH)D3 was less effective than 1,25(OH)2D3 in inducing the vitamin D responsive reporter gene and CYP24 protein expression. Time-course studies indicated that the growth of PHMEC cultures was significantly reduced within 72 h of treatment with either 1,25(OH)2D3 or 25(OH)D3 (Figure 5C). These data indicate that, like HMEC cultures, PHMEC cultures express functional VDR and CYP27B1, allowing cellular responses to both precursor (25(OH)D3) and active (1,25(OH)2D3) metabolites of vitamin D3.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5  Expression and regulation of vitamin D hydroxylases in relation to growth in primary cultures derived from human breast. (A) Lysates from PHMEC were immunoblotted with antibodies against VDR or CYP27B1; lysates from PHMEC cultures treated for 24 h with 100 nmol/L 1,25(OH)2D3 or 25(OH)D3 were immunoblotted with antibody against CYP24 or GAPDH (loading control). (B) PHMEC cultures transfected with a CYP24 reporter gene and a normalization gene were treated for 24 h with vehicle, 100 nmol/L 1,25(OH)2D3 or 100 nmol/L 25(OH)D3. RLU for vehicle-treated cells were set to 1 and fold induction by 1,25(OH)2D3 and 25(OH)D3 are shown. Values are means ± SEM, n = 4. Means not sharing a common letter differ, P < 0.05. (C) PHMEC cultures were harvested before and after treatment with vehicle, 100 nmol/L 1,25(OH)2D3 or 100 nmol/L 25(OH)D3 for up to 96 h and cell density was assessed by crystal violet assay. Values are means ± SEM, n = 4, of absorbance at 590 nm, which is proportional to cell density. *Different from the control, P < 0.01.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In these studies we demonstrated that nontumorigenic human mammary epithelial cells express transcriptionally active VDR and are growth inhibited by its ligand, 1,25(OH)2D3. Furthermore, these cells express the vitamin D metabolizing enzymes CYP27B1 and CYP24, which act on the same substrate, 25(OH)D3, to generate either 1,25(OH)2D3 or 24,25(OH)2D3 respectively. Treatment of mammary cells with 25(OH)D3 activates VDR transcription, regulates VDR target genes, and inhibits growth, effects that mimic those of 1,25(OH)2D3. These observations suggest that, under basal conditions, CYP27B1 activity predominates over CYP24 activity, resulting in net conversion of 25(OH)D3 to 1,25(OH)2D3. Although confirmatory studies are required to measure CYP27B1 and CYP24 activity in HMEC cultures with accuracy, our data suggest that normal mammary cells are capable of 1,25(OH)2D3 biosynthesis from 25(OH)D3. This suggestion is consistent with reports of 1,25(OH)2D3 production in homogenates of human breast tumors and adjacent normal breast tissue (20). Furthermore, CYP27B1 mRNA and protein are present and developmentally regulated in normal murine mammary gland (21).

These are the first studies to demonstrate that concentrations of 25(OH)D3 within the range found in the human circulation (35–100nmol/L) are growth inhibitory to nontransformed mammary cells. Further work will be necessary to define how 25(OH)D3, the majority of which circulates bound to vitamin D binding protein (DBP), gains access to mammary cells. In particular, the relative contributions of free 25(OH)D3 (which enters cells via diffusion) and DBP-bound 25(OH)D3 (which enters cells via receptor mediated endocytosis) to the intracellular 25(OH)D3 pool require clarification. Regardless of the specific mechanism, it is likely that low circulating 25(OH)D3 subsequent to vitamin D deficiency would reduce substrate availability to CYP27B1 and limit 1,25(OH)2D3 production in the mammary gland. A suboptimal supply of 1,25(OH)2D3 could result in deregulation of both VDR-mediated gene expression and growth control, a concept supported by data from VDR knockout mice, which exhibit accelerated mammary gland development during puberty and pregnancy (21,26). Furthermore, inhibitory effects of dietary vitamin D and VDR agonists were reported in animal models of breast cancer (2729). Collectively, these observations provide a potential biological basis for the epidemiologic observations linking vitamin D status in general, and 25(OH)D3 in particular, to breast cancer risk (17,30).

Particularly relevant to the potential role of vitamin D in breast cancer, both aging and estrogen deficiency are associated with low vitamin D status. Aging reduces vitamin D production in the skin; therefore, elderly individuals are more dependent on dietary and supplemental vitamin D than younger individuals. Estrogen stimulates renal CYP27B1 activity, and estrogen deficiency is associated with low circulating 1,25(OH)2D3 (31). Thus, postmenopausal women, the population most at risk for breast cancer, have a high prevalence of marginal vitamin D status (32). Furthermore, it should be noted that the definitions of "adequate," "low," and "deficient" circulating levels of 25(OH)D3, as well as the intake necessary to sustain appropriate vitamin D status, are currently being reevaluated (1,33).

Our studies also examined the regulation of CYP27B1 and CYP24 gene expression by 1,25(OH)2D3 in mammary cells. In all breast-derived cell lines studied, 1,25(OH)2D3 induced CYP24, an expected finding because this gene promoter contains a well-characterized VDR responsive region. Consistent with the known negative feedback regulation of 1,25(OH)2D3 on its own production, 1,25(OH)2D3 downregulated CYP27B1 in nontumorigenic HMEC cultures (Fig. 3C). Surprisingly, 1,25(OH)2D3 did not inhibit CYP27B1 gene expression in MCF-7 cells despite the ability of this metabolite to activate VDR and inhibit growth in these cells. This finding suggests that CYP27B1 may be deregulated during transformation, a suggestion that is consistent with data indicating elevated expression of vitamin D–metabolizing enzymes in human breast tumors compared with adjacent normal tissue (20). Follow-up studies on the molecular regulation of CYP27B1 in a defined model of mammary cell transformation are currently in progress to test this hypothesis.


    ACKNOWLEDGMENTS
 
The authors gratefully acknowledge Cytochroma for the CYP24 antibody and Dr. Loraine Racusen (Johns Hopkins University) for the HKC-8 cells. We thank Dr. Glendon Zinser for technical advice on transfections and real-time PCR and Dr. Matthew Rowling for assistance with mammary cell isolation.


    FOOTNOTES
 
1 Supported by National Institutes of Health CA103018 and CA96700 to J.W. Back

2 Present address: School of Medicine, University of Pennsylvania, Philadelphia, PA. Back

4 Abbreviations used: [1{alpha},25(OH)2D3], 1{alpha},25-dihydroxycholecalciferol; CYP 450, cytochrome P; HMEC, human mammary epithelial cells [24,25(OH)2D3], 24,25-dihydroxyvitamin D3; [25(OH)D3], 25-hydroxycholecalciferol; PHMEC, primary HMEC; RLU, relative luciferase units; VDR, vitamin D receptor. Back

Manuscript received 30 September 2005. Initial review completed 19 October 2005. Revision accepted 13 January 2006.


    LITERATURE CITED
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Hollis BW. Circulating 25-hydroxyvitamin D levels indicative of vitamin D sufficiency: implications for establishing a new effective dietary intake recommendation for vitamin D. J Nutr. 2005;135:317–22.[Abstract/Free Full Text]

2. Gray RW, Omdahl JL, Ghazarian JG, DeLuca HF. 25-Hydroxycholecalciferol-1-hydroxylase. Subcellular location and properties. J Biol Chem. 1972;247:7528–32.[Abstract/Free Full Text]

3. Omdahl JL, Morris HA, May BK. Hydroxylase enzymes of the vitamin D pathway: expression, function, and regulation. Annu Rev Nutr. 2002;22:139–66.[Medline]

4. Holick MF. Sunlight and vitamin D for bone health and prevention of autoimmune diseases, cancers, and cardiovascular disease. Am J Clin Nutr. 2004;80:1678S–88.[Abstract/Free Full Text]

5. Garland CF, Comstock GW, Garland FC, Helsing KJ, Shaw EK, Gorham ED. Serum 25-hydroxyvitamin D and colon cancer: eight-year prospective study. Lancet. 1989;2:1176–8.[Medline]

6. Hanchette CL, Schwartz GG. Geographic patterns of prostate cancer mortality. Evidence for a protective effect of ultraviolet radiation. Cancer. 1992;70:2861–9.[Medline]

7. VanWeelden K, Flanagan L, Binderup L, Tenniswood M, Welsh J. Apoptotic regression of MCF-7 xenografts in nude mice treated with the vitamin D3 analog, EB1089. Endocrinology. 1998;139:2102–10.[Abstract/Free Full Text]

8. Zinser GM, McEleney K, Welsh J. Characterization of mammary tumor cell lines from wild type and vitamin D3 receptor knockout mice. Mol Cell Endocrinol. 2003;200:67–80.[Medline]

9. Palmer HG, Gonzalez-Sancho J M, Espada J, Berciano MT, Puig I, Baulida J, Quintanilla M. Cano A, de Herreros AG, Lafarga M, Munoz A. Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of beta-catenin signaling. J Cell Biol. 2001;154:369–87.[Abstract/Free Full Text]

10. Skowronski RJ, Peehl DM, Feldman D. Vitamin D and prostate cancer: 1,25 dihydroxyvitamin D3 receptors and actions in human prostate cancer cell lines. Endocrinology. 1993;132:1952–60.[Abstract/Free Full Text]

11. Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM, Hewison M. Extrarenal expression of 25-hydroxyvitamin D(3)-1 alpha-hydroxylase. J Clin Endocrinol Metab. 2001;86:888–94.[Abstract/Free Full Text]

12. Tangpricha V, Flanagan JN, Whitlatch LW, Tseng CC, Chen TC, Holt PR, Lipkin MS, Holick MF. 25-Hydroxyvitamin D-1alpha-hydroxylase in normal and malignant colon tissue. Lancet. 2001;357:1673–4.[Medline]

13. Bareis P, Bises G, Bischof MG, Cross HS, Peterlik M. 25-Hydroxyvitamin D metabolism in human colon cancer cells during tumor progression. Biochem Biophys Res Commun. 2001;285:1012–7.[Medline]

14. Hsu JY, Feldman D, McNeal JE, Peehl DM. Reduced 1alpha-hydroxylase activity in human prostate cancer cells correlates with decreased susceptibility to 25-hydroxyvitamin D3-induced growth inhibition. Cancer Res. 2001;61:2852–6.[Abstract/Free Full Text]

15. Fu GK, Lin D, Zhang MY, Bikle DD, Shackleton CH, Miller WL, Portale AA. Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations causing vitamin D-dependent rickets type 1. Mol Endocrinol. 1997;11:1961–70.[Abstract/Free Full Text]

16. Lowe LC, Guy M, Mansi JL, Peckitt C, Bliss J, Wilson RG, Colston KW. Plasma 25-hydroxy vitamin D concentrations, vitamin D receptor genotype and breast cancer risk in a UK Caucasian population. Eur J Cancer. 2005;41:1164–9.[Medline]

17. Berube S, Diorio C, Verhoek-Oftedahl W, Brisson J. Vitamin D, calcium and mammographic breast densities. Cancer Epidemiol Biomarkers Prev. 2004;13:1466–72.[Abstract/Free Full Text]

18. Holt PR, Arber N, Halmos B, Forde K, Kissileff H, McGlynn KA, Moss SF, Kurihara N, Fan K, et al. Colonic epithelial cell proliferation decreases with increasing levels of serum 25-hydroxy vitamin D. Cancer Epidemiol Biomarkers Prev. 2002;11:113–9.[Abstract/Free Full Text]

19. Huang DC, Papavasiliou V, Rhim JS, Horst RL, Kremer R. Targeted disruption of the 25-hydroxyvitamin D3 1alpha-hydroxylase gene in ras-transformed keratinocytes demonstrates that locally produced 1alpha,25-dihydroxyvitamin D3 suppresses growth and induces differentiation in an autocrine fashion. Mol Cancer Res. 2002;1:56–67.[Abstract/Free Full Text]

20. Townsend K, Banwell CM, Guy M, Colston KW, Mansi JL, Stewart PM, Campbell MJ, Hewison M. Autocrine metabolism of vitamin D in normal and malignant breast tissue. Clin Cancer Res. 2005;11:3579–86.[Abstract/Free Full Text]

21. Zinser GM, Welsh JE. Accelerated mammary gland development during pregnancy and delayed post-lactational involution in vitamin D3 receptor null mice. Mol Endocrinol. 2004;18:2208–23.[Abstract/Free Full Text]

22. Elenbaas B, Spirio L, Koerner F, Fleming MD, Zimonjic DB, Donaher JL, Popescu NC, Hahn WC, Weinberg RA. Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev. 2001;15:50–65.[Abstract/Free Full Text]

23. St-Arnaud R, Dardenne O, Prud'homme J, Hacking SA, Glorieux FH. Conventional and tissue-specific inactivation of the 25-hydroxyvitamin D-1alpha-hydroxylase (CYP27B1). J Cell Biochem. 2003;88:245–51.[Medline]

24. Simboli-Campbell M, Narvaez CJ, vanWeelden K, Tenniswood M, Welsh J. Comparative effects of 1,25(OH)2D3 and EB1089 on cell cycle kinetics and apoptosis in MCF-7 breast cancer cells. Breast Cancer Res Treat. 1997;42:31–41.[Medline]

25. Bland R, Walker EA, Hughes SV, Stewart PM, Hewison M. Constitutive expression of 25-hydroxyvitamin D3–1alpha-hydroxylase in a transformed human proximal tubule cell line: evidence for direct regulation of vitamin D metabolism by calcium. Endocrinology. 1999;140:2027–34.[Abstract/Free Full Text]

26. Zinser G, Packman K, Welsh J. Vitamin D(3) receptor ablation alters mammary gland morphogenesis. Development. 2002;129:3067–76.[Abstract/Free Full Text]

27. Jacobson E, James K, Newmark HL, Carroll K. Effects of dietary fat, calcium, and vitamin D on growth and mammary tumorigenesis induced by 7,12-dimethylbenz(a)anthracene in female Sprague-Dawley rats. Cancer Res. 1989;49:6300–3.[Abstract/Free Full Text]

28. Mehta RG, Hussain EA, Mehta RR, Das-Gupta TK. Chemoprevention of mammary carcinogenesis by 1alpha-hydroxyvitamin D5, a synthetic analog of vitamin D. Mutat Res. 2003;523–524:253–64.

29. Mehta RG, Moriarty RM, Mehta RR, Penmasta R, Lazzaro G, Constantinou A, Guo L. Prevention of preneoplastic mammary lesion development by a novel vitamin D analogue, 1alpha-hydroxyvitamin D5. J Natl Cancer Inst. 1997;89:212–8.[Abstract/Free Full Text]

30. John EM, Schwartz GG, Dreon DM, Koo J. Vitamin D and breast cancer risk: the NHANES I epidemiologic follow up study, 1971–1975 to 1992. Cancer Epidemiol Biomarkers Prev. 1999;8:399–406.[Abstract/Free Full Text]

31. Sowers MR, Wallace RB, Hollis BW, Lemke JH. Parameters related to 25-OH-D levels in a population-based study of women. Am J Clin Nutr. 1986;43:621–8.[Abstract/Free Full Text]

32. Holick MF, Siris ES, Binkley N, Beard MK, Khan A, Katzer JT, Petruschke RA, Chen E, de Papp AE. Prevalence of Vitamin D inadequacy among postmenopausal North American women receiving osteoporosis therapy. J Clin Endocrinol Metab. 2005;90:3215–24.[Abstract/Free Full Text]

33. Gross MD. Vitamin D and calcium in the prevention of prostate and colon cancer: new approaches for the identification of needs. J Nutr. 2005;135:326–31.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
L. Rejnmark, A. Tietze, P. Vestergaard, L. Buhl, M. Lehbrink, L. Heickendorff, and L. Mosekilde
Reduced Prediagnostic 25-Hydroxyvitamin D Levels in Women with Breast Cancer: A Nested Case-Control Study
Cancer Epidemiol. Biomarkers Prev., October 1, 2009; 18(10): 2655 - 2660.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
M. THILL, D. FISCHER, S. BECKER, T. CORDES, C. DITTMER, K. DIEDRICH, D. SALEHIN, and M. FRIEDRICH
Prostaglandin Metabolizing Enzymes in Correlation with Vitamin D Receptor in Benign and Malignant Breast Cell Lines
Anticancer Res, September 1, 2009; 29(9): 3619 - 3625.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
F. R. Perez-Lopez, P. Chedraui, and J. Haya
Review Article: Vitamin D Acquisition and Breast Cancer Risk
Reproductive Sciences, January 1, 2009; 16(1): 7 - 19.
[Abstract] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
C. J. Fabian
If Vitamin D Prevents Breast Cancer, How Does It Do It, and How Much Does It Take?
ASCO Educational Book, January 1, 2009; 2009(1): 71 - 74.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Hansdottir, M. M. Monick, S. L. Hinde, N. Lovan, D. C. Look, and G. W. Hunninghake
Respiratory Epithelial Cells Convert Inactive Vitamin D to Its Active Form: Potential Effects on Host Defense
J. Immunol., November 15, 2008; 181(10): 7090 - 7099.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Diorio, M. Sinotte, J. Brisson, S. Berube, and M. Pollak
Vitamin D Pathway Polymorphisms in Relation to Mammographic Breast Density
Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2505 - 2508.
[Full Text] [PDF]


Home page
J. Nutr.Home page
T. M. Chlon, D. A. Taffany, J. Welsh, and M. J. Rowling
Retinoids Modulate Expression of the Endocytic Partners Megalin, Cubilin, and Disabled-2 and Uptake of Vitamin D-Binding Protein in Human Mammary Cells
J. Nutr., July 1, 2008; 138(7): 1323 - 1328.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Abbas, J. Linseisen, T. Slanger, S. Kropp, E. J. Mutschelknauss, D. Flesch-Janys, and J. Chang-Claude
Serum 25-hydroxyvitamin D and risk of post-menopausal breast cancer--results of a large case-control study
Carcinogenesis, January 1, 2008; 29(1): 93 - 99.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. M. Turunen, T. W. Dunlop, C. Carlberg, and S. Vaisanen
Selective use of multiple vitamin D response elements underlies the 1 {alpha} ,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
Nucleic Acids Res., April 10, 2007; (2007) gkm179v1.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. S. Tworoger, I-M. Lee, J. E. Buring, B. Rosner, B. W. Hollis, and S. E. Hankinson
Plasma 25-Hydroxyvitamin D and 1,25-Dihydroxyvitamin D and Risk of Incident Ovarian Cancer
Cancer Epidemiol. Biomarkers Prev., April 1, 2007; 16(4): 783 - 788.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. J. Rowling, C. M. Kemmis, D. A. Taffany, and J. Welsh
Megalin-Mediated Endocytosis of Vitamin D Binding Protein Correlates with 25-Hydroxycholecalciferol Actions in Human Mammary Cells
J. Nutr., November 1, 2006; 136(11): 2754 - 2759.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemmis, C. M.
Right arrow Articles by Welsh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemmis, C. M.
Right arrow Articles by Welsh, J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2006 by American Society for Nutrition