![]() |
|
|
Division of Nutritional Sciences, University of Illinois at Urbana-Champaign, Urbana, IL 61801
* To whom correspondence should be addressed. E-mail: jwerdman{at}uiuc.edu.
| ABSTRACT |
|---|
|
|
|---|
0.7 mg/d) or fed a 10% tomato powder supplemented diet (AIN 93G) for 4 d. Sham-operated rats provided with either phytofluene, lycopene, or tomato powder had
4050% lower serum testosterone concentrations than the sham-operated, control-fed group. Tissue and serum phytofluene and lycopene concentrations were greater in castrated rats than in sham-operated rats, which may have been due in part to a decrease of hepatic CYP 3A1 mRNA expression and benzyloxyresorufin-O-dealkylase activity. Some changes in prostatic and testicular steroidogenic enzyme mRNA expression were found; in particular, prostate 17ß-hydroxysteroid dehydrogenase 4 mRNA expression in castrated rats fed lycopene or tomato powder was 1.7-fold that of the sham-operated, control-fed group. Modest changes in mRNA expression of steroidogenic enzymes with short-term carotenoid intake may alter the flux of androgen synthesis to less potent compounds. Overall, results illustrate that short-term intake of tomato carotenoids significantly alters androgen status, which may partially be a mechanism by which tomato intake reduces prostate cancer risk.
| Introduction |
|---|
|
|
|---|
Prostate cancer is the third leading cause of cancer death in American men (13). The prostate requires androgens for normal growth and function, yet prostate cancer can develop under enhanced androgen signaling (14). Serum levels of testosterone, dihydrotestosterone (DHT), and testosterone metabolites are directly associated with prostate cancer risk (1518). In men, the major circulating androgen is testosterone. The testes are the primary sources of androgens, and androgen levels are determined in part by the steroidogenic enzymes cytochrome P450c17
-hydroxylase (CYP 17) and 17ß-hydroxysteroid dehydrogenases (17ß-HSDs) (14). In androgen synthesis, 17ß-HSDs catalyze the conversions between the active 17ß-hydroxysteroids and less-active 17ß-ketosteroids (19). 17ß-HSD isozymes 1, 3, 5, and 7 are reductive enzymes, converting substrates to more potent testosterone metabolites, whereas isozymes 2, 4, 8, 10, and 11 are oxidative enzymes synthesizing less-active testosterone substrates (19). Within the prostate, testosterone is converted to the more potent and primary nuclear androgen, DHT, primarily by 5
-reductase type II.
Dietary intervention studies have recently evaluated a possible diet-endocrine interaction in prostate cancer prevention (2023). Results from animal studies collectively illustrate that LYC supplementation may interfere with androgen activation and signaling in prostate tumors (22) and prostate tissues (23), thereby potentially having a protective role against prostate carcinogenesis. Previous studies from our laboratory showed that castrated rats accumulated twice as much liver LYC concentrations than intact controls, despite consuming less of the LYC-containing diet (20,21), which suggests that LYC metabolism is altered in response to androgen ablation.
The purpose of this study was to evaluate the interrelations between short-term carotenoid intake and androgen status. Our first objective was to evaluate whether 4 d of feeding PF (
0.7 mg/d), LYC (
0.7 mg/d), or a 10% tomato powder diet (TP) would alter serum androgen concentrations in castrated or sham-operated male F344 rats. Our second objective was to determine whether androgen ablation would enhance serum and tissue carotenoid concentrations in rats consuming carotenoids for 4 d. To evaluate the mechanisms by which carotenoids and androgen status might be interrelated, the modulations in mRNA expression of select testicular and prostatic steroidogenic enzymes, as well as hepatic cytochrome P450 3A1 mRNA expression and benzyloxyresorufin-O-dealkylase (BROD) activity, were determined in tissues from sham-operated and castrated rats following 4 d feeding of PF, LYC, or TP. Additionally, testicular and prostatic peroxisomal proliferator activated receptor-
(PPAR-
) and a PPAR-
target gene, fatty acid binding protein 3 (FABP3), mRNA expressions were also measured.
| Materials and Methods |
|---|
|
|
|---|
max = 348 nm, E1%1cm = 1350; LYC
max = 472 nm, E1%1cm = 3450). HPLC-photodiode array (HPLC-PDA) analyses determined the purity of the standards to be
98%. All other chemicals, unless otherwise noted, were purchased from Fisher Scientific.
Animals and experimental design.
The study was approved by the University of Illinois Laboratory Animal Care and Use Committee and followed all necessary protocols to ensure the humane treatment of the animals. Male F344 rats (30 d of age; n = 80) were purchased from Harlan and were acclimated to their new environment. The rats were kept under conditions of uniform humidity and temperature on a 12-h light-dark cycle and individually housed in hanging wire-bottom cages to reduce coprophagy. Rats were weighed every other day throughout the study. Beginning at 35 d of age, all rats were provided with a powdered AIN-93G diet throughout the study (24). The composition of the mineral and vitamin mixes has been described previously (24). At 45 d of age, rats were randomly assigned to 8 treatment groups and body weights were
122 g. Treatment groups were assigned as follows: 1) sham-operated, control-fed (n = 8); 2) sham-operated, PF dosed (n = 8); 3) sham-operated, LYC dosed (n = 8); 4) sham-operated, TP-fed (n = 8); 5) castrated, control-fed (n = 12); 6) castrated, PF dosed (n = 12); 7) castrated, LYC dosed (n = 12); and 8) castrated, TP-fed (n = 12). At 57 d of age, rats were either castrated or sham-operated, and rats were allowed to recover from surgery for 2 d. At 59 d of age, dietary treatments began in the morning and included: oral intubation with cottonseed oil (control), a dose of PF (0.7 mg/d), or a dose of LYC (0.7 mg/d) in 0.5 mL cottonseed oil, or free intake of a TP diet. All treatments lasted for 4 d.
Rats were anesthetized with CO2 and blood was taken via cardiac puncture. They were then killed by CO2 asphyxiation, and the liver, adrenal, adipose, spleen, lung, testes, and prostate-seminal vesicle complex were collected. The prostate-seminal vesicle complex was dissected on ice into the seminal vesicles and prostate lobes. Due to the small amount of prostate tissue obtained from each rat, it was necessary to pool prostate lobes within each group to obtain accurate analysis of carotenoid accumulation. All harvested tissues were weighed, immersed in liquid nitrogen, and subsequently stored at 80°C.
Diet and carotenoid doses.
Rats that were switched to a 4 d dietary treatment of 10% TP consumed a powdered AIN-93G semipurified diet enriched with 10% freeze-dried, whole tomato powder (0.014 g phytoene/kg, 0.015 g PF/kg, 0.011 g LYC/kg, and 0.001 g
-carotene/kg diet; Gilroy Foods, ad libitum). Total intake was estimated as 0.66 mg phytoene, 0.68 mg PF, 0.53 mg LYC, and 0.05 mg
-carotene, which was approximately equivalent to 2.0 mg of total carotenoids over the 4-d dietary treatment period. The control and 10% TP diets were isocaloric and balanced for macronutrient and fiber content. The diets were stored in the dark at 4°C.
PF and LYC (
98% pure; BASF) were used for the carotenoid doses. PF was composed of various cis-isomers, whereas LYC consisted primarily of all-trans LYC (
97%). On the days of dosing, new standard vials were opened. PF and LYC were reconstituted in chloroform and individually added to cottonseed oil. Chloroform was evaporated before dosing to make final concentrations of 1.4 g PF/L and 1.4 g LYC/L. The total amount of PF or LYC administered to each rat was
0.7 mg/d for 4 d, or
2.8 mg of total carotenoids. Carotenoid solubility in oil was ensured by observations under a light microscope. Carotenoids are susceptible to isomerization and oxidation, therefore precautions were taken, including preparation of the carotenoid doses under yellow lights, keeping carotenoid-chloroform solutions on ice before addition to oil, and purging the carotenoid oil doses with argon.
Tissue and serum carotenoid extraction and quantification.
Tissue and serum extraction and analysis was performed as previously described (25). Briefly, tissue or serum samples were combined with a KOH/ethanol solution (1:5) containing 0.1% BHT. Tissues were saponified at 60°C for 30 min (serum was not saponified). Samples were then placed on ice, and deionized water was added. Tissue and serum carotenoids were extracted 4 times with addition of hexane. Hexane extracts were dried in a Speedvac concentrator (model AS160; Savant), flushed with argon, and stored at 20°C for
24 h before HPLC-PDA analysis. All carotenoid extracts were kept on ice and under yellow lights throughout the extraction process.
Carotenoid concentrations in tissue and serum samples were measured by a previously described HPLC-PDA system (21,25,26). The HPLC mobile phases and gradient procedure utilized in this study have been previously described (27). Carotenoid isomers were qualitatively identified through comparison to UV spectra and retention times of analytical standards. Serum and tissue carotenoid concentrations were quantified for total PF and total LYC isomer concentrations.
Serum testosterone and DHT measurements. Serum testosterone and DHT were quantified with radioimmunoassay kits (DSL-4000 ACTIVE Testosterone and DSL-9600 ACTIVE DHT Coated-Tube Radioimmunoassay Kits; Diagnostic Systems Laboratories).
Total RNA extraction and cDNA synthesis. Total RNA from rat liver, testes, and prostate tissues was extracted using an RNA isolation kit (PureLink Micro-to Midi Total RNA Purification System, Invitrogen) according to the manufacturer's instructions. The RNA concentration and quality were assessed by spectrophotometry (260 nm) and agarose gel electrophoresis. The RNA samples were reverse-transcribed into complementary DNA by Superscript II Reverse Transcriptase (Invitrogen) using random hexamers (Applied Biosystems). Reverse transcription was carried out at 25°C for 10 min, followed by 50 min at 42°C, and finally 70°C for 15 min.
Real-time quantitative PCR.
The mRNA expression of selected genes was measured using a real-time quantitative PCR method with SYBR green fluorescence dye. Primer Express software (Applied Biosystems) was utilized to select primer pairs for each gene of interest. The primer pairs were selected to measure CYP 3A1 (NM_173144): Forward-5'- GAGGAGTAATTTGCTGACAGACCTGC and Reverse-5'- CCAGGAATCCCCTGTTTCTTGAA (amplicon length 149 bp); 17ß-HSD 2 (NM_024391): Forward-5'- CCTCCCGGTCATGAGAGAGA and Reverse-5'- CAAATGGCGTGCTGGATGT (amplicon length 72 bp); 17ß-HSD 3 (NM_054007): Forward-5'- GCTTGTGTGCCTCGTTTGC and Reverse-5'- CTTGCAGAAGCTCAGAAAAAGGT (amplicon length 70 bp); 17ß-HSD 4 (NM_024392): Forward-5'-AGGGAGTGCTGACTTCTCCTGTT and Reverse-5'- TGAGCGACAATGACTCCAAATG (amplicon length 51 bp); 5
-Reductase II (NM_022711): Forward-5'- GGTCATGCCTGCTTAGCCTATAC and Reverse-5'- TCTGTGAAGCTCCAAAAGGAAAT (amplicon length 73 bp); CYP 17 (NM_): Forward-5'- TGGCTTTCCTGGTGCACAATC and Reverse-5'- TGAAAGTTGGTGTTCGGCTGAAG (amplicon length 90 bp). Forward and reverse primers for fatty acid binding protein 3 (FABP3; AF144090.2), PPAR-
(NM_013124), and 18S (x00686) were utilized as previously reported by Zaripheh et al. (28). Primer sets (MWG) were validated through real-time PCR to confirm amplification of a single amplicon and primer efficiency. The rRNA 18S was used as the housekeeping gene.
The cDNA from each tissue sample was subsequently used in the SYBR Green assay. The PCR mixture contained 5.011.25 ng of liver, testes, or prostate cDNA, 500 nmol/L forward and reverse primers of selected genes, and 1x SYBR Green PCR Master Mix (Applied Biosystems). Tissue mRNA expression was measured using a 7900HT Fast Real-Time PCR detection system (Applied Biosystems; method followed as described in the manufacturer's instructions). The mRNA abundance relative to 18S rRNA was determined using the comparative critical threshold method according to manufacturer's instructions (29). The relative mRNA abundance was further converted to a fold of the control group (sham-operated, control-fed).
Phase I detoxification enzyme analysis. Chytochrome P450 3A1 activity was estimated by BROD activity in hepatic tissue through a fluorometric method as described by Pohl and Fouts (30) and later modified by Breinholt et al. (31). This method estimates primarily CYP 3A activity, but also CYP 2A activity. Resorufin, the end-point product, was measured using an excitation wavelength of 550 nm and an emission wavelength of 585 nm and quantified with a standard curve of resorufin (Sigma-Aldrich).
Statistical analysis.
The experiment was conducted as a 2 x 4 factorial design of treatments with 2 androgen states (sham-operated or castrated) and 4 dietary treatments (control, PF, LYC, or 10% TP). Differences among all treatment groups were first analyzed by 1-way ANOVA, and group mean comparisons were further analyzed by the post-hoc least significant difference test with
= 0.05. If the assumptions of normality of the residuals, heterogeneity of residual variance, or spatial correlation among residuals were violated, the data were log10 transformed.
In addition, data were further analyzed through multiple linear regression to determine if there was a significant effect of androgen status, carotenoid intake, and/or an interaction between androgen status and carotenoid intake (32) on study endpoints, including serum testosterone, serum DHT, hepatic CYP 3A1 expression and BROD activity, and prostate mRNA expression of 17ß-HSD 2 and 17ß-HSD 4. The full regression models included the 2 treatment main effect factors: androgen status (sham and castrated; dummy coded) and carotenoid intake (control, PF, LYC, and 10% TP; orthogonal contrasts coded); and their three 2-way interaction terms (32). The model, main effects, and interactions were considered significant when P
0.05. The data were log10 transformed if the assumptions of normality of the residuals, heterogeneity of residual variance, or spatial correlation among residuals were violated. All statistical analyses were conducted with SAS (version 8.1, SAS Institute). For carotenoid analysis, prostate and seminal vesicle tissues were pooled within groups, resulting in 1 data point, thus statistical analyses were not performed for these tissues. Results were expressed as means ± SEM, unless otherwise indicated.
| Results |
|---|
|
|
|---|
|
, and FABP3 mRNA expressions in prostate and testes.
In the prostate, 17ß-HSD 2 mRNA expression was upregulated in castrated rats (Table 2), and regression analysis indicated that castration had an overall effect on prostate 17ß-HSD 2 expression (P = 0.004). Prostate 17ß-HSD 4 mRNA expression was greater in castrated rats provided with either LYC or TP than in the sham-operated, control-fed rats (P < 0.05). Multiple linear regression analyses also indicated that castration had an overall effect on prostate 17ß-HSD 4 expression (P = 0.002), and LYC intake had an overall effect on prostate 17ß-HSD 4 expression compared with PF intake (P = 0.003). Consumption of PF, LYC, or TP and castration did not affect prostate 17ß-HSD 3 or 5
-reductase II mRNA expression (Table 2).
|
and FABP3 mRNA expression was upregulated in castrated rats, and regression analyses indicated that castration had overall effects on both prostate PPAR-
(P = 0.002) and FABP3 expression (P = 0.005; Table 2). In addition, castrated rats consuming LYC or TP had greater PPAR-
or FABP3 mRNA expression, respectively, in the prostate than castrated control-fed rats (P < 0.05). Furthermore, multiple linear regression analysis demonstrated that LYC intake had an overall effect on prostate FABP3 mRNA expression, compared with PF intake (P = 0.023). Although not significant, there was a modest decrease in testicular 17ß-HSD 3 mRNA expression in sham-operated rats provided with PF or TP compared with castrated, control-fed rats (data not shown, P < 0.10). There also were minor, nonsignificant increases in testes mRNA expression of 17ß-HSD 2 (P < 0.10) and 17ß-HSD 4 (P < 0.10) due to PF consumption compared with castrated, control-fed rats (data not shown).
Serum and tissue PF and LYC concentrations. Castrated rats provided with PF or TP had greater (P < 0.05) or tended to have greater (P < 0.10) hepatic and serum PF concentrations than the sham-operated rats provided with the same dietary treatments (Table 3). In addition, the hepatic LYC concentration tended to be greater (P < 0.10) in castrated rats provided with either 4 d LYC or TP than the sham-operated rats provided with the same carotenoid treatments (Table 3). The TP-fed castrated rats also tended to have greater (P < 0.10) serum LYC concentrations than the TP-fed sham-operated rats. Interestingly, castrated rats fed TP or provided with either PF or LYC had 50100% greater PF and LYC concentrations in the pooled (n = 1) prostate and seminal vesicles than the sham-operated rats (Table 3). Rats provided with PF had greater hepatic and serum PF concentrations than those fed TP (P < 0.05). TP-fed rats had greater liver and serum LYC concentrations than those provided with LYC (P < 0.05).
|
|
| Discussion |
|---|
|
|
|---|
Significant decrease in serum testosterone concentrations. In this experiment, there were significant decreases of both serum testosterone and DHT concentrations in the castrated rats, which was expected, as the primary source of androgen synthesis in these rats, the testes, were removed. More interestingly, short-term consumption of PF, LYC, or TP also resulted in significant decreases in serum testosterone concentrations in the sham-operated rats compared with the sham-operated, control-fed rats. Furthermore, regression analysis indicated a significant interaction between castration and 4 d carotenoid intake in the reduction of serum testosterone concentrations, suggesting synergistic effects between these 2 treatment main effects. The decrease in serum testosterone levels in sham-operated rats with short-term carotenoid intake is likely a transient effect, as we have previously reported that longer carotenoid feeding did not significantly alter serum testosterone concentrations (12). This transient decrease in serum testosterone levels with short-term carotenoid intake can be considered beneficial, as excessive androgen status can ultimately give rise to prostate cancer (14).
Alterations in steroidogenic enzyme mRNA expression. To evaluate the mechanisms by which serum testosterone concentrations were reduced, we determined whether castration and/or short-term carotenoid intake modulated the mRNA expression of select prostate and testicular steroidogenic enzymes that are involved in the biosynthesis of androgens. Our results showed that short-term androgen ablation had a significant effect, resulting in the upregulation of both prostatic 17ß-HSD 2 and 17ß-HSD 4 mRNA expression, which to our knowledge, has not been previously reported. 17ß-HSD 2 and 17ß-HSD 4 catalyze the oxidative reactions of testosterone and androstenediol to less potent androgens, androstenedione, and dihydroepiandrosterone (DHEA), respectively (19). Higher expression of 17ß-HSD 2 has been detected in prostates of men with benign prostatic hyperplasia compared with human prostatic carcinoma specimens (33,34). 17ß-HSDs, particularly 17ß-HSD 2, also convert estradiol to estrone, a weaker estrogen (19), which is of interest because estrogen has also been implicated in prostate cancer development. As reviewed by Härkönen and Mäkelä (35), prolonged treatment of adult rodents with estrogens, in addition to androgens, leads to epithelial metaplasia, prostatic intraepithelial neoplasia-like lesions, and adenocarcinoma of the prostate. Estrogen stimulates DNA synthesis and induces metaplastic epithelial morphology in rodent and human prostate cells in culture (35). The upregulation of 17ß-HSD 2 and 17ß-HSD 4 prostate mRNA in castrated rats in the current study may be a result of an effort to maintain a balance between local prostatic androgen and estrogen signaling, thereby potentially protecting the prostate from excessive estrogen and/or androgen influence.
Castrated rats with short-term intake of LYC or TP had significantly greater prostatic 17ß-HSD 4 mRNA expression than the sham-operated, control-fed rats. Herzog et al. (23) previously reported that long-term LYC consumption increases the expression of 17ß-HSD 4 in the normal prostate of Copenhagen rats. In the current experiment, regression analysis also indicated that short-term LYC intake resulted in greater prostate 17ß-HSD 4 expression compared with PF intake. Both animal and human studies show that prostate LYC concentrations are greater than concentrations of PF (57). Results from the current work suggest that consumption of LYC has a differential effect on prostate 17ß-HSD 4 mRNA expression, to potentially reduce local prostatic androgen signaling.
There was a modest, nonsignificant (P < 0.10) downregulation of testicular 17ß-HSD 3 mRNA expression in rats provided with PF or TP. 17ß-HSD 3 preferentially catalyzes the conversion of androstenedione and DHEA to more potent androgens, testosterone and androstenediol, respectively (19), and is highly expressed in the testes (36). Human studies show significantly greater expression of this isozyme in prostate cancer tissues than in noncancerous tissue (34), suggesting the importance of this enzyme in the etiology of prostate cancer. The modest changes in a variety of testicular and prostatic steroidogenic enzymes in this study could collectively contribute to an increased flux of androgens to less potent compounds, which in part may explain the significant decrease of serum testosterone concentrations in sham-operated rats provided with short-term carotenoid intake.
Increased tissue and serum carotenoid concentrations in castrated rats. Castrated rats provided with 4 d of PF or LYC (0.7 mg/d) or fed TP had greater hepatic and serum PF or LYC concentrations than the sham-operated rats provided with the same dietary treatments. Although some of these increases in hepatic and serum carotenoid concentrations with castration were not significant, the results from this short-term carotenoid intake study are in line with 3- and 8-wk LYC long-term feeding trials where castrated rats accumulated twice as much liver LYC than intact controls (20,21).
A novel finding in the current study was that castrated rats also had 50100% greater prostate and seminal vesicle carotenoid concentrations than the sham-operated rats provided with the same carotenoid treatments. In vitro studies show that androgens increase oxidative stress in androgen-dependent prostate cancer cells (37). Carotenoids are antioxidants and are effective singlet oxygen quenchers (38) able to protect the prostate from testosterone-induced oxidative stress through their own subsequent degradation. We speculate that, with castration, testosterone-induced reactive oxygen species were diminished, resulting in less degradation of carotenoids, and thus yielding greater prostate carotenoid accumulations.
Decreased hepatic CYP 3A1 mRNA expression and BROD activity. Castrated rats had significantly less liver CYP 3A1 mRNA expression and BROD activity than sham-operated rats. Cytochrome P450-dependent monooxygenases (P450s) are a multigene family of oxidative phase I detoxification enzymes that transform many xenobiotics, including exogenous and endogenous compounds (3941). Degradation of testosterone is due in part to enzymes of the phase I detoxification CYP 3A family, which oxidizes testosterone in the liver to several less active metabolites (42). Previous animal studies have concluded that a decline in free testosterone levels is related to decreased clearance of xenobiotics by CYP 3A1, through modulation of CYP 3A1 mRNA expression and activity (4347). Other studies (20,21,48) suggest that circulating androgens may stimulate hepatic xenobiotic enzymes that metabolize or degrade carotenoids and other compounds in the liver. As observed in this study, greater hepatic and serum carotenoid concentrations in castrated rats may be due in part to decreased hepatic carotenoid metabolism by CYP 3A1.
Alterations in PPAR-
and FABP3 mRNA expression.
Our laboratory has a recent interest in the role of PPAR-
in prostate carcinogenesis (4951) and carotenoid metabolism (28). PPAR-
is a member of the nuclear hormone receptor family and serves as a transcription factor for the gene expression of adipocyte differentiation and glucose homeostasis (52). PPAR-
is expressed at low levels in normal prostate tissue, yet is highly expressed in malignant prostate tissue. Studies show prostate cancer growth inhibition by PPAR-
agonists (4951), and transcriptional regulation of PPAR-
may be a novel approach to prostate cancer therapy (53). PPAR-
agonists were reported to increase PPAR-
mRNA expression in androgen-dependent prostate tumor cells, and these results were paralleled by a suppression of cancer cell growth (54).
Multiple linear regression analyses in this experiment indicated that castration had significant overall treatment effects on the upregulation of prostate mRNA expression of both PPAR-
and FABP3. Furthermore, castrated rats consuming either 4 d LYC or 10% TP had significantly greater prostate PPAR-
and FABP3 mRNA expression than sham-operated, control-fed rats. It is of interest to note that the significant changes of prostate PPAR-
and FABP3 mRNA expression paralleled the changes of prostate 17ß-HSD 2 and 17ß-HSD 4 mRNA expression, respectively, yet the relevance of these findings in relation to prostate cancer risk remains unclear.
Overall, results from this study suggest an interrelation between short-term carotenoid intake and androgen status. Castration and short-term carotenoid intake were each found to significantly decrease serum testosterone concentrations, and a significant interaction between these 2 main treatments was revealed. Castrated rats had greater tissue and serum carotenoid concentrations, as well as a decrease in hepatic CYP 3A1 expression and activity, suggesting that androgen ablation can potentially alter the hepatic metabolism of carotenoids through modulation of this phase I detoxification enzyme. Future studies focusing on androgenic effects on other carotenoid metabolizing enzymes, such as carotenoid 15,15'-monoxygenase I and II, are currently under way. Short-term intakes of PF, LYC and 10% TP also exhibited modest alterations in some testicular and prostate steroidogenic enzymes mRNA expression. Although modest, changes in a variety of steroidogenic enzymes with carotenoid intake could collectively contribute to an increased flux of androgen synthesis to less potent compounds, thereby decreasing local and systemic androgen concentrations. Continued research, including both long- and short-term carotenoid feeding trials, are needed to further assess a diet-endocrine relation between tomato consumption and prostate cancer risk. Overall, results from the current work reveal that short-term intakes of PF, LYC, and TP significantly alter androgen status, thereby providing a potential mechanism by which tomato intake reduces prostate cancer risk (4,55).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Abbreviations used: 17ß-HSD, 17ß-hydroxysteroid dehydrogenase; BROD, benzyloxyresorufin-O-dealkylase; Control, control AIN 93 G diet; CYP 3A1, cytochrome P450 3A1; CYP 17, cytochrome P450c17
-hydroxylase; DHEA, dihydroepiandrosterone; DHT, 5
-dihydrotestosterone; FABP3, fatty acid binding protein 3; HPLC-PDA, HPLC-photodiode array; LYC, lycopene; PF, phytofluene; PPAR-
, peroxisomal proliferator-activated receptor-
; TP, tomato powder. ![]()
Manuscript received 22 June 2006. Initial review completed 13 July 2006. Revision accepted 10 September 2006.
| LITERATURE CITED |
|---|
|
|
|---|
1. Giovannucci E, Ascherio A, Rimm EB, Stampfer MJ, Colditz GA, Willett WC. Intake of carotenoids and retinol in relation to risk of prostate cancer. J Natl Cancer Inst. 1995;87:176776.
2. Giovannucci E, Rimm EB, Liu Y, Stampfer MJ, Willett WC. A prospective study of tomato products, lycopene, and prostate cancer risk. J Natl Cancer Inst. 2002;94:3918.
3. Etminan M, Takkouche B, Caamano-Isorna F. The role of tomato products and lycopene in the prevention of prostate cancer: a meta-analysis of observational studies. Cancer Epidemiol Biomarkers Prev. 2004;13:3405.
4. Miller EC, Giovannucci E, Erdman JW, Jr., Bahnson R, Schwartz SJ, Clinton SK. Tomato products, lycopene, and prostate cancer risk. Urol Clin North Am. 2002;29:8393.[Medline]
5. Khachik F, Carvalho L, Bernstein PS, Muir GJ, Zhao DY, Katz NB. Chemistry, distribution, and metabolism of tomato carotenoids and their impact on human health. Exp Biol Med. 2002;227:84551.
6. Clinton SK, Emenhiser C, Schwartz SJ, Bostwick DG, Williams AW, Moore BJ, Erdman JW, Jr. Cis-trans lycopene isomers, carotenoids, and retinol in the human prostate. Cancer Epidemiol Biomarkers Prev. 1996;5:82333.[Abstract]
7. Campbell JK, Zaripheh S, Lila MA, Erdman JW, Jr. Relative bioavailability of phytoene and phytofluene in male fisher 344 rats. FASEB J. 2005;19:A472.
8. Beecher GR. Nutrient content of tomatoes and tomato products. Proc Soc Exp Biol Med. 1998;218:98100.[Medline]
9. Chen L, Stacewicz-Sapuntzakis M, Duncan C, Sharifi R, Ghosh L, van Breemen R, Ashton D, Bowen PE. Oxidative DNA damage in prostate cancer patients consuming tomato sauce-based entrees as a whole-food intervention. J Natl Cancer Inst. 2001;93:18729.
10. Kucuk O, Sarkar FH, Sakr W, Djuric Z, Pollak MN, Khachik F, Li YW, Banerjee M, Grignon D, et al. Phase II randomized clinical trial of lycopene supplementation before radical prostatectomy. Cancer Epidemiol Biomarkers Prev. 2001;10:8618.
11. Boileau TW, Liao Z, Kim S, Lemeshow S, Erdman JW, Jr., Clinton SK. Prostate carcinogenesis in N-methyl-N-nitrosourea (NMU)-testosterone-treated rats fed tomato powder, lycopene, or energy-restricted diets. J Natl Cancer Inst. 2003;95:157886.
12. Canene-Adams K, Clinton SK, Erdman JW, Jr. Effects of dietary lycopene, tomato, and broccoli powders on the growth of Dunning R3327-H prostatic adenocarcinoma tumors. FASEB J. 2005;19:A79.
13. Cancer facts & figures 2006. 2006 [cited 2006]. Available at: www.cancer.org.
14. Taplin ME, Ho SM. Clinical review 134: the endocrinology of prostate cancer. J Clin Endocrinol Metab. 2001;86:346777.
15. Gann PH, Hennekens CH, Ma J, Longcope C, Stampfer MJ. Prospective study of sex hormone levels and risk of prostate cancer. J Natl Cancer Inst. 1996;88:111826.
16. Shaneyfelt T, Husein R, Bubley G, Mantzoros CS. Hormonal predictors of prostate cancer: a meta-analysis. J Clin Oncol. 2000;18:84753.
17. Ross RK, Bernstein L, Lobo RA, Shimizu H, Stanczyk FZ, Pike MC, Henderson BE. 5-alpha-reductase activity and risk of prostate cancer among Japanese and US white and black males. Lancet. 1992;339:8879.[Medline]
18. Lookingbill DP, Demers LM, Wang C, Leung A, Rittmaster RS, Santen RJ. Clinical and biochemical parameters of androgen action in normal healthy Caucasian versus Chinese subjects. J Clin Endocrinol Metab. 1991;72:12428.
19. Soronen P, Laiti M, Torn S, Harkonen P, Patrikainen L, Li Y, Pulkka A, Kurkela R, Herrala A, et al. Sex steroid hormone metabolism and prostate cancer. J Steroid Biochem Mol Biol. 2004;92:2816.[Medline]
20. Boileau TW, Clinton SK, Erdman JW, Jr. Tissue lycopene concentrations and isomer patterns are affected by androgen status and dietary lycopene concentration in male F344 rats. J Nutr. 2000;130:16138.
21. Boileau TW, Clinton SK, Zaripheh S, Monaco MH, Donovan SM, Erdman JW, Jr. Testosterone and food restriction modulate hepatic lycopene isomer concentrations in male F344 rats. J Nutr. 2001;131:174652.
22. Siler U, Barella L, Spitzer V, Schnorr J, Lein M, Goralczyk R, Wertz K. Lycopene and vitamin E interfere with autocrine/paracrine loops in the Dunning prostate cancer model. FASEB J. 2004;18:101921.
23. Herzog A, Siler U, Spitzer V, Seifert N, Denelavas A, Hunziker PB, Hunziker W, Goralczyk R, Wertz K. Lycopene reduced gene expression of steroid targets and inflammatory markers in normal rat prostate. FASEB J. 2005;19:2724.
24. Reeves PG, Nielsen FH, Fahey GC, Jr. AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993;123:193951.
25. Zaripheh S, Boileau TW, Lila MA, Erdman JW, Jr. [14C]-lycopene and [14C]-labeled polar products are differentially distributed in tissues of F344 rats prefed lycopene. J Nutr. 2003;133:418995.
26. Campbell JK, Rogers RB, Lila MA, Erdman JW, Jr. Biosynthesis of 14C-phytoene from tomato cell suspension cultures (Lycopersicon esculentum) for utilization in prostate cancer cell culture studies. J Agric Food Chem. 2006;54:74755.[Medline]
27. Yeum KJ, Booth SL, Sadowski JA, Liu C, Tang G, Krinsky NI, Russell RM. Human plasma carotenoid response to the ingestion of controlled diets high in fruits and vegetables. Am J Clin Nutr. 1996;64:594602.
28. Zaripheh S, Nara TY, Nakamura MT, Erdman JW, Jr. Dietary lycopene downregulates carotenoid 15,15'-monooxygenase and PPAR-gamma in selected rat tissues. J Nutr. 2006;136:9328.
29. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods. 2001;25:386401.[Medline]
30. Pohl RJ, Fouts JR. A rapid method for assaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal Biochem. 1980;107:1505.[Medline]
31. Breinholt V, Lauridsen ST, Daneshvar B, Jakobsen J. Dose-response effects of lycopene on selected drug-metabolizing and antioxidant enzymes in the rat. Cancer Lett. 2000;154:20110.[Medline]
32. Cohen J, Cohen P. Applied multiple regression/correlation analysis for the behavioral sciences. 2nd ed. Hillsdale, (NJ): L. Erlbaum Associates, 1983.
33. Elo JP, Akinola LA, Poutanen M, Vihko P, Kyllonen AP, Lukkarinen O, Vihko R. Characterization of 17beta-hydroxysteroid dehydrogenase isoenzyme expression in benign and malignant human prostate. Int J Cancer. 1996;66:3741.[Medline]
34. Koh E, Noda T, Kanaya J, Namiki M. Differential expression of 17beta-hydroxysteroid dehydrogenase isozyme genes in prostate cancer and noncancer tissues. Prostate. 2002;53:1549.[Medline]
35. Harkonen PL, Makela SI. Role of estrogens in development of prostate cancer. J Steroid Biochem Mol Biol. 2004;92:297305.[Medline]
36. Baker PJ, Sha JH, O'Shaughnessy PJ. Localisation and regulation of 17beta-hydroxysteroid dehydrogenase type 3 mRNA during development in the mouse testis. Mol Cell Endocrinol. 1997;133:12733.[Medline]
37. Ripple MO, Henry WF, Rago RP, Wilding G. Prooxidant-antioxidant shift induced by androgen treatment of human prostate carcinoma cells. J Natl Cancer Inst. 1997;89:408.
38. Boileau TWM, Moore AC, Erdman JW, Jr. Carotenoids and vitamin A. In: Papas AM, editor. Antioxidant status, diet, nutrition, and health. Boca Raton, (FL): CRC Press LLC; 1999. p. 13358.
39. Gonzalez FJ. Molecular genetics of the P-450 superfamily. Pharmacol Ther. 1990;45:138.[Medline]
40. Nelson DR, Kamataki T, Waxman DJ, Guengerich FP, Estabrook RW, Feyereisen R, Gonzalez FJ, Coon MJ, Gunsalus IC, et al. The P450 superfamily: update on new sequences, gene mapping, accession numbers, early trivial names of enzymes, and nomenclature. DNA Cell Biol. 1993;12:151.[Medline]
41. Le Blanc GA, Waxman DJ. Interaction of anticancer drugs with hepatic monooxygenase enzymes. Drug Metab Rev. 1989;20:395439.[Medline]
42. Waxman DJ, Attisano C, Guengerich FP, Lapenson DP. Human liver microsomal steroid metabolism: identification of the major microsomal steroid hormone 6 beta-hydroxylase cytochrome P-450 enzyme. Arch Biochem Biophys. 1988;263:42436.[Medline]
43. Warrington JS, Greenblatt DJ, von Moltke LL. Age-related differences in CYP3A expression and activity in the rat liver, intestine, and kidney. J Pharmacol Exp Ther. 2004;309:7209.
44. Schrag ML, Wienkers LC. Covalent alteration of the CYP3A4 active site: evidence for multiple substrate binding domains. Arch Biochem Biophys. 2001;391:4955.[Medline]
45. Fujita S, Kitagawa H, Chiba M, Suzuki T, Ohta M, Kitani K. Age and sex associated differences in the relative abundance of multiple species of cytochrome P-450 in rat liver microsomes. A separation by HPLC of hepatic microsomal cytochrome P-450 species. Biochem Pharmacol. 1985;34:18614.[Medline]
46. Fujita S, Chiba M, Ohta M, Kitani K, Suzuki T. Alteration of plasma sex hormone levels associated with old age and its effect on hepatic drug metabolism in rats. J Pharmacol Exp Ther. 1990;253:36974.
47. Patki KC, Von Moltke LL, Greenblatt DJ. In vitro metabolism of midazolam, triazolam, nifedipine, and testosterone by human liver microsomes and recombinant cytochromes p450: role of CYP 3a4 and CYP 3a5. Drug Metab Dispos. 2003;31:93844.
48. Feingold IB, Longhurst PA, Colby HD. Regulation of adrenal and hepatic alpha-tocopherol content by androgens and estrogens. Biochim Biophys Acta. 1993;1176:1926.[Medline]
49. Mueller E, Smith M, Sarraf P, Kroll T, Aiyer A, Kaufman DS, Oh W, Demetri G, Figg WD, et al. Effects of ligand activation of peroxisome proliferator-activated receptor gamma in human prostate cancer. Proc Natl Acad Sci USA. 2000;97:109905.
50. Subbarayan V, Sabichi AL, Kim J, Llansa N, Logothetis CJ, Lippman SM, Menter DG. Differential peroxisome proliferator-activated receptor-gamma isoform expression and agonist effects in normal and malignant prostate cells. Cancer Epidemiol Biomarkers Prev. 2004;13:17106.
51. Kubota T, Koshizuka K, Williamson EA, Asou H, Said JW, Holden S, Miyoshi I, Koeffler HP. Ligand for peroxisome proliferator-activated receptor gamma (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res. 1998;58:334452.
52. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature. 1998;391:7982.[Medline]
53. Smith MR, Kantoff PW. Peroxisome proliferator-activated receptor gamma as a novel target for prostate cancer. Invest New Drugs. 2002;20:195200.[Medline]
54. Pham H, Banerjee T, Nalbandian GM, Ziboh VA. Activation of peroxisome proliferator-activated receptor (PPAR)-gamma by 15S-hydroxyeicosatrienoic acid parallels growth suppression of androgen-dependent prostatic adenocarcinoma cells. Cancer Lett. 2003;189:1725.[Medline]
55. Campbell JK, Canene-Adams K, Lindshield BL, Boileau TW, Clinton SK, Erdman JW, Jr. Tomato phytochemicals and prostate cancer risk. J Nutr. 2004;134:3486S92S.
This article has been cited by other articles:
![]() |
J. P. Mills, P. W. Simon, and S. A. Tanumihardjo {beta}-Carotene from Red Carrot Maintains Vitamin A Status, but Lycopene Bioavailability Is Lower Relative to Tomato Paste in Mongolian Gerbils J. Nutr., June 1, 2007; 137(6): 1395 - 1400. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||