![]() |
|
|
Department of Biological Sciences, University of Notre Dame, Notre Dame, IN 46556
* To whom correspondence should be addressed. E-mail: jwelsh3{at}nd.edu.
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It is now recognized that the 25(OH)D3 1
-hydroxylase enzyme (CYP27B1) responsible for converting 25(OH)D3 to 1,25(OH)2D3 is expressed in many tissues, including mammary epithelium (49). However, the mechanisms by which the substrate 25(OH)D3 becomes available to the enzyme in nonrenal tissues have yet to be defined. Given the importance of endocytosis in renal cell uptake of 25(OH)D3DBP, we hypothesized that megalin and cubilin might mediate uptake of protein-bound circulating 25(OH)D3 in extra-renal tissues as well. We chose to test this hypothesis using mammary epithelial cells because they express metabolizing enzymes and receptors for vitamin D steroids and are growth inhibited by 1,25(OH)2D3 (10). Furthermore, 25(OH)D3 and DBP are present in milk, suggesting that both compounds can enter and traverse mammary epithelium in a physiological context (11,12). In this study, we specifically examined whether megalin and cubilin play a role in the uptake of the 25(OH)D3-DBP complex and subsequent activation of the VDR pathway in mammary cells.
| Materials and Methods |
|---|
|
|
|---|
-MEM containing 5% FBS and penicillin/streptomycin, but, for some comparative experiments, MCF-7 cells were cultured in RPMI containing 10% FBS as described for T-47D cells. HME cells were maintained in culture medium 171 (Cascade Biologics), supplemented with bovine pituitary extract (0.4% v:v), bovine insulin (5 mg/L), hydrocortisone (0.5 mg/L), and recombinant human epithelial growth factor (3 µg/L). Analysis of megalin and cubilin mRNA expression in mammary cells. For initial screening of megalin and cubilin expression in mammary epithelium, total RNA was isolated with Trizol Reagent (Invitrogen) from surgically dissected glands of C57Bl6 mice at various stages of development (5). Total RNA was isolated from cell lines and isolated mammary ducts with the RNeasy Mini Kit (Qiagen). For isolation of mammary epithelial ducts, whole thoracic and inguinal mammary glands were removed, washed twice with PBS, minced, and incubated in RPMI containing 2 g/L collagenase A (Calbiochem) and 1 g/L hyaluronidase (Sigma). After 2 h digestion at 37°C in a shaking water bath, the mixture was centrifuged at 500 x g for 5 min and the supernatant was discarded. Following 2 successive washes with PBS, the pellet was resuspended in RPMI and the mammary ducts were collected under a stereoscope. Ducts were pooled, washed with PBS, and used for RNA isolation.
Total RNA from tissues, ducts, and cell lines was used for first-strand cDNA synthesis using TaqMan Reverse Transcription Reagents (N8080234, Applied Biosystems) as previously described (13), generating three 2.0 µg cDNA stocks for each sample. Each of the cDNA stocks were independently analyzed in duplicate (200 ng/well) for megalin and cubilin expression via real-time PCR using SYBR Green Detection reagents (4309155, Applied Biosystems). Data with primer sets specific for human megalin (forward primer: AAATTGAGCACAGCACCTTTGA, reverse primer: TCTGCTTTCCTGACTCGAATAATG) and human cubilin (forward primer: GGTTCCCTGCCAATTATCCAA, reverse primer: CCGCCATCCAAAATTTCTACA) were normalized against GAPDH RNA (forward primer: CCACCCATGGCAAATTCC, reverse primer: TGATGGGATTTCCATTGATGAC). cDNA stocks generated from whole mammary gland and purified mammary ducts were analyzed using primer sets specific for mouse megalin (forward primer:AGGCCACCAGTTCACTTGCT, reverse primer: AGGACACGCCCATTCTCTTG) and mouse cubilin (forward primer: GGGATCCTCTCAGGGACACA, reverse primer: TGCTGGCCGATTCTAAATCAA) and were normalized against 18s RNA (forward primer: AGTCCCTGCCCTTTGTACACA, reverse primer: GATCCGAGGGCCTCACTAAAC). Relative gene expression was graded on a scale of 0 (nondetectable) to +++++ (strong expression). The expression scale indicates relative SYBR Green signal intensity in cell and tissue samples compared with a standard curve generated for megalin and cubilin. Expression data are representative of multiple experiments (usually 5 mice/group or 3 independent cell platings).
Western blotting. T-47D and MCF-7 cell lysates were separated on SDS-PAGE, transferred to nitrocellulose and immunoblotted with a polyclonal sheep anti-CYP27B1 antibody (The Binding Site) as previously described (8). Specific binding was detected by chemiluminescence using products from Pierce and exposure to autoradiography film (Kodak Biomax).
Analysis of CYP24 mRNA and promoter induction. CYP24, a VDR target gene that is highly induced by 1,25(OH)2D3, was used as a marker of VDR transcriptional activity. CYP24 mRNA was measured in MCF-7 and T-47D cells plated in 6-well plates (2.0 x 105 cells/well) and treated with 100 nmol/L 1,25(OH)2D3, 100 nmol/L 25(OH)D3 or vehicle for 48 h. Total RNA was isolated as described above and PCR was performed using the TaqMan PCR Core Reagent Kit (Applied Biosystems) using primer sets and a probe specific for human CYP24 (forward primer: CAAACCGTGGAAGGCCTATC, reverse primer: AGTCTTCCCCTTCCAGGATCA, probe: ACTACCGCAAAGAAGGCTACGGGCTG). Data were normalized against 18 s expression. To assess direct induction of the CYP24 promoter, cells were cotransfected with a 300 bp region of the human CYP24 promoter linked to firefly luciferase (obtained from the late Jack Omdahl, University of New Mexico) and a thymidine kinase driven renilla luciferase normalization construct (Promega). Cells were treated for 48 h with 25(OH)D3, 1,25(OH)2D3 or vehicle, in the presence or absence of DBP or FBS as indicated. Luciferase activity was measured with the Dual Luciferase Kit (Promega) and expressed as fold increase relative to control cells after normalization for transfection efficiency.
Fluorescein conjugation of DBP and cell uptake studies. DBP (Calbiochem) was conjugated to Alexa-488 using a commercial kit (A10235, Molecular Probes). For in vitro DBP uptake studies, subconfluent T-47D and MCF-7 cells plated on 4-well Lab-Tek II CC2 chamber slides (5000 cells/well) were incubated overnight in RPMI medium containing 10% FBS. For endocytosis assays, cells were washed with PBS, switched to serum-free medium and incubated with 0.02 g/L Alexa-DBP at either 37°C (the optimal temperature for endocytosis) or 4°C (a temperature that inhibits endocytosis) for periods of up to 60 min. To determine whether endocytosis of DBP requires megalin, uptake experiments were conducted for 30 min in the absence or presence of 1 µmol/L receptor associated protein (RAP) (Innovative Research), a known inhibitor of megalin-mediated endocytosis. In some experiments, cells were incubated with Hoechst (1 mg/L in PBS) for visualization of nuclei or Lysotracker (75 nmol/L, Molecular Probes) for identification of lysosomes. After incubations, cells were washed thoroughly in PBS, fixed with ice-cold methanol, mounted with antifade medium and examined under phase contrast and fluorescent filters. Comparative experiments on T-47D and MCF-7 cells were conducted in parallel, and images were acquired with a constant exposure time for both cell lines.
Statistical methods. Data were analyzed by Student's t test or 1-way ANOVA and Dunn's or Student-Neuman-Keuls post-tests, as appropriate, using InStat software (version 3.0 for Windows, GraphPad Software). Differences between means were considered significant when P < 0.05 was obtained.
| Results |
|---|
|
|
|---|
|
To determine whether the differential responses to 25(OH)D3 might be related to transformation, we compared the ability of 25(OH)D3 to induce CYP24 in MCF-7 cells and in T-47D cells, another human breast cancer cell line. MCF-7 and T-47D cells express CYP27B1 mRNA (6) and protein (Fig. 2) at equivalent levels. The ability of 1,25(OH)2D3 and 25(OH)D3 to induce endogenous CYP24 gene expression, as measured by real time PCR, was compared in these cell lines grown under identical medium conditions (RPMI containing 10% FBS). Consistent with the CYP24 reporter gene data (Fig. 1C), 25(OH)D3 did not induce endogenous CYP24 gene expression in MCF-7 cells under these conditions, although 1,25(OH)2D3 robustly induced this VDR target gene (Table 1). In contrast, both 25(OH)D3 and 1,25(OH)2D3 induced CYP24 gene expression in T-47D cells (464- and 982-fold, respectively). Collectively, these data suggest that serum and DBP interfere with 25(OH)D3 actions in MCF-7 cells, but that some cells (HME, T-47D) are capable of responding to 25(OH)D3 even in the presence of DBP.
|
|
|
|
The requirement for endocytosis during DBP uptake in T-47D cells was confirmed with temperature-shift techniques. Alexa-DBP uptake into the cytoplasm and perinuclear regions of T-47D cells (Fig. 4, top panels) was readily detected in cells incubated at 37°C, a temperature conducive to endocytosis. As expected for an endocytic process, intracellular DBP did not colocalize with the nuclear stain Hoechst. When cells were incubated with Alexa-DBP at 4°C, a temperature that disrupts microtubules and blocks endocytosis, DBP uptake was completely blocked (Fig. 4, middle panels). To provide evidence that megalin and cubilin are required for DBP uptake, we utilized an inhibitor of megalin-mediated endocytosis, RAP, which binds to the extracellular domain of megalin and inhibits ligand binding and internalization (2). When T-47D cells were coincubated at 37°C with Alexa-DBP and RAP, Alexa-DBP uptake was markedly blunted, with low levels of fluorescence detected in only 12 cells per field (Fig. 4, bottom panels). Collectively, this series of studies supports the concept that internalization of DBP in T-47D breast cancer cells occurs via endocytosis and is facilitated by the membrane localized coreceptors megalin and cubilin.
|
| Discussion |
|---|
|
|
|---|
Although our DBP uptake data were obtained with mammary cells in culture, they raise the possibility that the mammary gland in vivo may be capable of transporting vitamin D metabolites bound to DBP via receptor-mediated endocytosis. Both DBP and 25(OH)D3 are present in breast milk (16), but whether endocytosis in general, or the megalin-cubilin complex in particular, participates in transport of either molecule across the mammary epithelia is, at present, unknown. In support of this possibility, we detected megalin and cubilin gene expression in normal murine mammary gland as well as isolated mammary ducts, and megalin protein has been identified in human mammary gland (17). Furthermore, megalin expression was highest in glands removed during pregnancy and lactation, and supplementation of mice with estrogen and progesterone to simulate pregnancy enhanced megalin expression in mammary ductal epithelial cells 50-fold (M. Rowling and J. Welsh, unpublished data). These observations warrant further study on the impact of megalin-mediated endocytosis on 25(OH)D3 uptake, transcytosis, storage, and metabolism in mammary epithelia.
In addition to endocytosis of 25(OH)D3-DBP, megalin mediates the cellular uptake of many serum transport proteins, including those that act as carriers for the steroid hormones androgen and estrogen as well as lipophilic vitamins such as retinol (1,1821). As these bioactive molecules have important roles in regulation of cell proliferation, differentiation, and survival, the coexpression of megalin and cubilin in mammary cells, reported here, to our knowledge, for the first time, could have important implications for both development and transformation in this tissue. Indeed, studies with megalin knockout mice have demonstrated that megalin-mediated endocytosis plays a functional role in several epithelial tissues, including the thyroid gland, gall bladder, and both male and female reproductive organs (19,2227). Unfortunately, the limited viability of megalin knockout mice (2) precludes assessment of the impact of megalin on transport of vitamins in the mammary gland in vivo until a tissue-specific knockout is generated.
In summary, to our knowledge, these are the first studies to demonstrate that mammary epithelial cells coexpress megalin and cubilin, which contribute to the endocytic uptake of 25(OH)D3-DBP and activation of the VDR pathway. An important implication of these observations is that extra-renal hydroxylation of 25(OH)D3 and autocrine production of the VDR ligand 1,25(OH)2D3 may require the presence of functional megalin and cubilin for uptake of the circulating 25(OH)D3-DBP complex.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Abbreviations used: 25(OH)D3, 25-hydroxycholecalciferol; 1,25(OH)2D3, 1,25-dihydroxycholecalciferol; CYP, cytochrome P450; DBP, vitamin D binding protein; HME, human mammary epithelial; RAP, receptor-associated protein; VDR, vitamin D receptor. ![]()
Manuscript received 9 June 2006. Initial review completed 7 July 2006. Revision accepted 13 September 2006.
| LITERATURE CITED |
|---|
|
|
|---|
1. Moestrup SK, Verroust PJ. Megalin- and cubilin-mediated endocytosis of protein-bound vitamins, lipids, and hormones in polarized epithelia. Annu Rev Nutr. 2001;21:40728.[Medline]
2. Nykjaer A, Dragun D, Walther D, Vorum H, Jacobsen C, Herz J, Melsen F, Christensen E, Willnow T. An endocytic pathway essential for renal uptake and activation of the steroid 25(OH)hydroxyvitamin D3. Cell. 1999;96:50715.[Medline]
3. Nykjaer A, Fyfe J, Kozyraki R, Leheste JR, Jacobsen C, Nielsen MS, Verroust PJ, Aminoff M, de la Chapelle, et al. Cubilin dysfunction causes abnormal metabolism of the steroid hormone 25(OH) vitamin D(3). Proc Natl Acad of Sci USA. 2001;98:13895900.
4. Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM, Hewison M. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-hydroxylase. J Clin Endocrinol Metab. 2001;86:88894.
5. Zinser GM, Welsh J. Accelerated mammary gland development during pregnancy and delayed post-lactational involution in vitamin D3 receptor null mice. Mol Endocrinol. 2004;18:220823.
6. Townsend K, Banwell CM, Guy M, Colston KW, Mansi JL, Stewart PM, Campbell MJ, Hewison M. Autocrine metabolism of vitamin D in normal and malignant breast tissue. Clin Cancer Res. 2005;11:357986.
7. Townsend K, Evans KN, Campbell MJ, Colston KW, Adams JS, Hewison M. Biological actions of extra-renal 25-hydroxyvitamin D-1alpha-hydroxylase and implications for chemoprevention and treatment. J Steroid Biochem Mol Biol. 2005;97:1039.[Medline]
8. Kemmis CK, Salvador SM, Smith KM, Welsh JE. Human mammary epithelial cells express CYP27B1 and are growth inhibited by 25-hydroxyvitamin D3, the major circulating form of vitamin D3. J Nutr. 2006;136:88792
9. Schwartz GG, Whitlatch LW, Chen TC, Lokeshwar BL, Holick MF. Human prostate cells synthesize 1,25-dihydroxyvitamin D3 from 25-hydroxyvitamin D3. Cancer Epidemiol Biomarkers Prev. 1998;7:3915.
10. Welsh J, Wietzke JA, Zinser GM, Byrne B, Smith K, Narvaez CJ. Vitamin D-3 receptor as a target for breast cancer prevention. J Nutr. 2003;133:2425S33S.
11. Kunz C, Niesen M, von Lilienfeld-Toal H, Burmeister W. Vitamin D, 25-hydroxy-vitamin D and 1,25-dihydroxy-vitamin D in cow's milk, infant formulas and breast milk during different stages of lactation. Int J Vitam Nutr Res. 1984;54:1418.[Medline]
12. Hollis BW, Pittard, 3rd WB, Reinhardt TA. Relationships among vitamin D, 25-hydroxyvitamin D, and vitamin D-binding protein concentrations in the plasma and milk of human subjects. J Clin Endocrinol Metab. 1986;62:414.
13. Zinser GM, McEleney K, Welsh J. Characterization of mammary tumor cell lines from wild type and vitamin D3 receptor knockout mice. Mol Cell Endocrinol. 2003;200:6780.[Medline]
14. Esteban C, Geuskens M, Ena JM, Mishal Z, Macho A, Torres JM, Uriel J. Receptor-mediated uptake and processing of vitamin D-binding protein in human B-lymphoid cells. J Biol Chem. 1992;267:1017783.
15. Colston KW, Welsh JE. Vitamin D and breast cancer. In: Feldman D, Pike JW, and Gloriuex F, editors. Vitamin D. 2nd ed. Amsterdam: Elsevier.
16. Hollis BW, Roos BA, Draper HH, Lambert PW. Vitamin D and its metabolites in human milk. J Nutr. 1981;111:12408.
17. Lundgren S, Carling T, Hjalm G, Juhlin C, Rastad J, Pihlgren U, Rask L, Akerstrom G, Hellman P. Tissue distribution of human gp330/megalin, a putative calcium sensing protein. J Histochem Cytochem. 1997;45:38392.
18. Matarese V, Lodish HF. Specific uptake of retinol-binding protein by variant F9 cell lines. J Biol Chem. 1993;268:1885965.
19. Hammes A, Andreassen TK, Spoelgen R, Raila J, Hubner N, Schulz H, Metzger J, Schweigert FJ, Luppa PB, et al. Role of endocytosis in cellular uptake of sex steroids. Cell. 2005;122:75162.[Medline]
20. Raila J, Willnow TE, Schweigert FJ. Megalin-mediated reuptake of retinol in the kidneys of mice is essential for vitamin A homeostasis. J Nutr. 2005;135:25126.
21. Christensen EI, Moskaug JO, Vorum H, Jacobsen C, Gundersen TE, Nykjaer A, Blomhoff R, Willnow TE, Moestrup SK. Evidence for an essential role of megalin in transepithelial transport of retinol. J Am Soc Nephrol. 1999;10:68595.
22. Marino M, Zheng G, Chiovato L, Pinchera A, Brown D, Andrews D, McCluskey RT. Role of megalin (gp330) in transcytosis of thyroglobulin by thyroid cells. A novel function in the control of thyroid hormone release. J Biol Chem. 2000;275:712537.
23. Marino M, Zheng G, McCluskey RT. Megalin (gp330) is an endocytic receptor for thyroglobulin on cultured fisher rat thyroid cells. J Biol Chem. 1999;274:12898904.
24. Muller D, Nykjaer A, Willnow TE. From holoprosencephaly to osteopathology: role of multifunctional endocytic receptors in absorptive epithelia. Ann Med. 2003;35:2909.[Medline]
25. Hermo L, Lustig M, Lefrancois S, Argraves WS, Morales CR. Expression and regulation of LRP-2/megalin in epithelial cells lining the efferent ducts and epididymis during postnatal development. Mol Reprod Dev. 1999;53:28293.[Medline]
26. Argraves WS, Morales CR. Immunolocalization of cubilin, megalin, apolipoprotein J, and apolipoprotein A-I in the uterus and oviduct. Mol Reprod Dev. 2004;69:41927.[Medline]
27. Erranz B, Miquel JF, Argraves WS, Barth JL, Pimentel F, Marzolo MP. Megalin and cubilin expression in gallbladder epithelium and regulation by bile acids. J Lipid Res. 2004;45:218598.
This article has been cited by other articles:
![]() |
H. S. CROSS, T. NITTKE, and M. PETERLIK Modulation of Vitamin D Synthesis and Catabolism in Colorectal Mucosa: A New Target for Cancer Prevention Anticancer Res, September 1, 2009; 29(9): 3705 - 3712. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sinotte, C. Diorio, S. Berube, M. Pollak, and J. Brisson Genetic polymorphisms of the vitamin D binding protein and plasma concentrations of 25-hydroxyvitamin D in premenopausal women Am. J. Clinical Nutrition, February 1, 2009; 89(2): 634 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Diorio, M. Sinotte, J. Brisson, S. Berube, and M. Pollak Vitamin D Pathway Polymorphisms in Relation to Mammographic Breast Density Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2505 - 2508. [Full Text] [PDF] |
||||
![]() |
R. F Chun, J. S Adams, and M. Hewison Back to the future: a new look at 'old' vitamin D J. Endocrinol., August 1, 2008; 198(2): 261 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Chlon, D. A. Taffany, J. Welsh, and M. J. Rowling Retinoids Modulate Expression of the Endocytic Partners Megalin, Cubilin, and Disabled-2 and Uptake of Vitamin D-Binding Protein in Human Mammary Cells J. Nutr., July 1, 2008; 138(7): 1323 - 1328. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Abbas, J. Linseisen, T. Slanger, S. Kropp, E. J. Mutschelknauss, D. Flesch-Janys, and J. Chang-Claude The Gc2 Allele of the Vitamin D Binding Protein Is Associated with a Decreased Postmenopausal Breast Cancer Risk, Independent of the Vitamin D Status Cancer Epidemiol. Biomarkers Prev., June 1, 2008; 17(6): 1339 - 1343. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Rowling, C. Gliniak, J. Welsh, and J. C. Fleet High Dietary Vitamin D Prevents Hypocalcemia and Osteomalacia in CYP27B1 Knockout Mice J. Nutr., December 1, 2007; 137(12): 2608 - 2615. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||