|
|
|
|

* Health Research Center, Department of Family and Preventive Medicine, University of Utah, Salt Lake City, UT 84101 and
Division of Research, Kaiser Permanente, Oakland, CA 94612
2To whom correspondence should be addressed. E-mail: mmurtaugh{at}hrc.utah.edu.
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: rectal cancer meat CYP1A1 NAT2 GSTM1
Heterocyclic amines (HCAs)3 are formed as a by-product of reactions during the cooking of meat, especially when it is well-done, char-broiled, or pan-fried (15). Dietary exposure to HCAs has been a suspected risk factor for colorectal cancer since the 1970s (6). Food is one of the primary sources of polycyclic aromatic hydrocarbon (PAH) exposure in the United States, and grilled or barbecued meats contribute much of the carcinogenic PAH in the diet (7). Inherited variation in the metabolism of HCA and PAH compounds appears to be responsible for between-individual variation in systemic exposure and may modify cancer risk associated with these exposures. Metabolism of certain PAH compounds to mutagenic forms is initiated by a cytochrome p-4501A1 (CYP1A1)-catalyzed hydroxylation. Reactive intermediates can be detoxified by the glutathione S-transferase M1 (GSTM1) enzyme. We hypothesized that variants that increase CYP1A1 activity, and the GSTM1 null variant, associated with no enzymatic activity, are also associated with increased risk of cancers. Initial N-hydroxylation of HCA compounds in liver is primarily catalyzed by CYP1A2; to date, no known CYP1A2 genetic variants explain the interindividual variation in CYP1A2 activity (8,9). However, other CYP enzymes, including CYP1A1, are capable of some metabolism of HCA and are expressed in extrahepatic tissues (10). Further, CYP1A enzymes are coordinately regulated and a CYP1A1 polymorphism may be correlated with a difference in CYP1A2 activity (11). The N-acetyl transferase (NAT) enzymes catalyze the next step of activation of HCAs, O-acetylation, to form compounds that covalently bind to DNA. Therefore, we hypothesized that CYP1A1 and the inherited low-activity NAT2 variants may be associated with decreased risk of colorectal cancer (12).
We used genotype information from large, population-based case-control studies of cancers of the colon (13) and rectum (14) for our previous reports that a high index for mutagen exposure from meat in diet was associated with an increased risk of colon (15) and rectal cancer (16) in men. In men, consumption of well-done meat was associated with an increased risk for rectal cancer (16). There was no association between mutagen index and colon or rectal cancer for women (15,16). We found that the risk of colon cancer was not associated with the NAT2 phenotype or the GSTM1 genotype alone, but was modestly increased among those men with the NAT2 intermediate or rapid type acetylator phenotype and high processed meat consumption or high mutagen index (15). Use of red meat drippings by women was associated with a decreased risk of rectal cancer, and this decrease was greater among women with the slow NAT2-imputed phenotype and the GSTM1 absent genotype (16). We previously reported that genotypes of phase II metabolizing enzymes interacted with associations of meat and meat preparation variables differentially by gender with risk for colon (15) and rectal cancer (16).
Studies considering combinations of phase I and phase II metabolizing enzymes might be necessary to determine substantial increases in risk (8,17,18). However, the variants in the human CYP1A1 gene are infrequent in Caucasian populations, so studies of association with cancer have had little power to detect an association (1922). In the present report, we investigated whether polymorphisms in CYP1A1, independently and in combination with GSTM1 genotype or NAT2 imputed phenotype, modify the association of meat consumption and/or preparation with risk of colorectal cancer in men and women from Utah and northern California. Specifically we hypothesized that CYP1A1 variants increasing activity would be independently associated with increased risk of colorectal cancer. We hypothesized that those with the activity increasing variants in CYP1A1 and GSTM1 null genotype would be at increased risk of colorectal cancer and that those with the fast/intermediate NAT2 imputed phenotype would be at increased risk of colorectal cancer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Controls were matched to cases by sex and by 5-year age groups. At the KPMCP, controls were randomly selected from membership lists, and in Utah controls 65 y and older were randomly selected from social security lists and controls younger than 65 were randomly selected from drivers license lists. A total of 952 rectal cancer cases and 1205 matched controls and 1346 colon cancer cases and 1544 matched controls are included in the analyses presented. Response rates for the rectal study were 65.2% for cases and 65.3% for controls; cooperation rates, or the number of people who participated from those who we were able to contact, were 73.2% for cases and 68.8% for controls. For the colon cancer study response rates were 71.8% for cases and 68.0% for controls.
Data collection. Data were collected by trained and certified interviewers using laptop computers. The interview took approximately 2 h. Quality control methods used in the rectal cancer study were the same as those used in the colon cancer study and have been described in detail elsewhere (23).
Diet. We obtained dietary intake using an adaptation of the Coronary Artery Risk Development in Young Adults diet history (2426). Participants were asked to recall foods eaten for the calendar year occurring 2 y before their cancer diagnosis (cases) or recruitment into the study (controls), the frequency that they were eaten, serving size, and whether fats were added in the preparation. Food intake data were converted to nutrient data using the Minnesota Nutrition Coordinating Center nutrient database Version 4.02_30. Additional information was gathered on usual doneness of red meats (rare, medium rare, medium well done, and well done). Participants were asked how frequently they fried, broiled, baked, or barbequed (cooked at high temperatures) and how frequently drippings were used in other foods or gravies. Variables included servings of particular foods or food groups (i.e., red meat, poultry, red meat drippings) consumed per day, week, or year. The mutagen index was calculated as the frequency of red meat, poultry, and fish consumption prepared by frying, broiling, baking, or barbecuing plus the use of drippings from red meat, poultry, or fish, multiplied by the usual doneness of red meat, poultry, and fish (1 = rare, 2 = medium rare, 3 = medium well, and 4 = well done) and the microwave factor (1 = microwave never used or used for thawing, 0.75 = sometimes used, 0.50 = often used, 0.25 = always used) (15). A higher index reflects higher intake of potentially mutagenic compounds.
Genetic data.
DNA was extracted from whole blood. The CYP1A1 thymine (T) > cytosine (C) (*2A allele) transition in the 3'-untranslated region was detected using the PCR method described by Hayashi et al. (27), in which the 343 basepair (bp) PCR product was digested with MspI. The common allele (T) is uncut and is
340 bp in length. The C allele is digested and leads to 2 smaller bands of 200 and 140 bp. The CYP1A1 A4889G (Ile462Val, *2B allele) was detected using allele-specific PCR and was performed with one upstream primer and 2 downstream primers as described by Rebbeck et al. (28) with the following modifications. The downstream primer specific for the uncommon allele guanine (G) was modified with a GC clamp to increase the melting temperature (CGCCCGCCGCCGCCCGCCGCGTGTATCGGTGAGACCG); the downstream primer specific for the common allele adenine (A) is the same as in Rebbeck et al. (28) (GAAGTGTATCGGTGAGACCA). The common upstream primer used was (TTCCACCCGTTGCAGCAGGATAGCC) (29). PCR was performed and analyzed using the iCycler iQ real-time detection system. PCR conditions were 35 cycles of 15 s each at 95, 61, and 72°C. This was followed by 10 s at 95°C and then by 80 cycles of half degree decrements for 10 s for analysis of melting temperature. The melting temperature of the common allele was 85.5°C, whereas the melting temperature of the uncommon (G) allele, due to the GC clamp, was 90.5°C. This assay utilizes Sybr green dye and the 2.3 version of the software. Any genotype with a G allele was verified by PCR amplification with the following primers: CTGTCTCCCTCTGGTTACAGGAAG (29) and GGCACGC TGAATTCCAC GCAATGCAGC AGGATAGC, which was then followed by BsrDI restriction digestion. PCR conditions for this reaction were the same as for the above iCycler reaction except that 30 cycles were performed. The uncut product is 215 bp in length. The G allele leads to loss of the restriction site and a 192-bp band due to digestion of the control BsrDI site. Amplicons with the A allele are further digested to 149/43 bp.
The GSTM1 null genotype was detected using the PCR method described by Zhong et al. (30). To determine acetylator status we assessed the presence of the *5, *6, or *7 alleles of NAT2, using the method of Bell et al. (31). These 3 variants account for
90 to 95% of the slow acetylation phenotype in Caucasians. All 3 variants could be identified from 1 PCR product that is digested with 3 different restriction enzymes. The C481T variant (*5 allele) was determined using a KpnI digest; the G590A variant (*6 allele) using a TaqI digest; and the G857A variant (*7 allele) using a Bam HI digest. Because genotype, not phenotype, is measured, we define imputed phenotype as follows: those carrying two *5, *6, or *7 variant alleles were classified as slow acetylators; those with 1 or 0 of these alleles were classified as rapid/intermediate acetylators. Detailed descriptions of the methods have been previously reported (15,16,32).
Height and weight were measured at the time of interview. The BMI (kg/m2) was calculated for men and women. Weight was also reported for the 2 and 5 y prior to interview. Physical activity data were collected using a physical activity questionnaire that has been described elsewhere (33). All procedures were approved by the University of Utah Institution Review Board.
Statistical methods. Descriptive statistics of continuous variables are presented as means ± SD with comparisons made by Students t test. Descriptive statistics for categorical variables are presented as percentages and comparisons are made using chi-square tests. Differences were considered significant at P < 0.05. Unconditional logistic regression models were used to estimate risk (odds ratios, 95% CI) of colon and rectal cancer and dietary meat consumption and meat preparation methods. Associations were explored in men and women separately based on previous gender-specific findings (15,16). Associations with the mutagen index were similar for colon and rectal cancer; therefore, to increase power we pooled colon and rectal cancer cases by gender for further analysis.
We assessed dietary data by determining risk across medians, thirds, or quartiles of intake or cutoffs used for previous papers (15) depending on the distribution of the data. The medians, thirds, or quartiles were determined by the sex-specific intake distribution in the control population. In these models the following variables were included: age at selection, BMI, physical activity, energy intake, dietary fiber, dietary calcium, and cigarette smoking status. To evaluate the potential influence of ethnicity on results, analyses were repeated in Caucasians only. Odds ratios and interpretation of the data were not substantially different, although statistical significance (P < 0.05) and CI were influenced by the smaller cell sizes. Results are reported for all race/ethnicities without race/ethnicity as a covariate.
Linear trend was determined by evaluating the significance of linear association across the categorized variable. We assessed the CYP1A1 as no variant (*1 neither variant) or any *2 variant (heterozygous/variant) of the MspI or Ill462Val polymorphisms. The GSTM1 was assessed as present or absent and the NAT2 was analyzed as slow or rapid/intermediate imputed phenotype. Interaction, or effect modification, between meat-related variables and the CYP1A1 alone and with the GSTM1 or NAT2 genotype was evaluated as the excess risk on both additive (34) and multiplicative scales with trend variables.
| RESULTS |
|---|
|
|
|---|
|
|
|
The combination of CYP1A1 genotype and NAT2 imputed phenotype modified the association of white meat consumption and use of white meat drippings with risk for colorectal cancer. Men with the highest consumption of white meat, the CYP1A1 wild-type genotypes, and the NAT2 slow imputed phenotype had an increased risk of colorectal cancer (OR 1.40, 95% CI 1.01, 1.95, Table 4). The risk for colorectal cancer decreased (OR 0.61, 95% CI 0.14, 1.03) among men with the most frequent use of white meat drippings and the CYP1A1 variant genotype and the NAT2 rapid imputed phenotype. The increased risk associated with a high white meat mutagen index and CYP1A1 wild genotype occurred primarily among those men who also had the NAT2 rapid imputed phenotype (P for multiplicative interaction < 0.02). An increased risk was also associated with a low white meat mutagen index in women with the CYP1A1 variant genotype and the NAT2 slow imputed phenotype, although neither the odds ratio (OR 1.47, 95%CI 0.88, 2.46) nor the interaction was significant (P > 0.14).
|
| DISCUSSION |
|---|
|
|
|---|
CYP1A1 plays a role in activation of PAHs and HCAs; therefore we hypothesized a greater risk of colorectal cancer with CYP1A1 variants tending to increase enzymatic activity and greater intake of meats, especially well-done meats or those cooked at high temperatures. Although red meat is a suspected risk factor for colorectal cancer (36), and we previously found a positive association of red meat with colon cancer (P > 0.05) and red meat doneness (P = 0.04) with the risk of rectal cancer (16) among men, we found that the more consistent associations detected in this study were with white meat and white meat drippings. The association of white meat to colorectal cancer is not consistent, with reports that white meat is both a significant risk factor for colon cancer in men and women (37) when analyzed separately (15) and associated with a decreased risk of colorectal adenomas (38). Levels of HCAs in beef and chicken did not differ (39). Cooking methods also affects levels of HCA, and a recent report suggested that baked versus pan-fried red and white meats have different relations to colorectal cancer (40). In the present study, we asked about the frequency of consumption of baked, broiled, and fried red and white meats, leaving the possibility that the associations with fried red meat could be masked by pooling with baked and broiled meats. We observed an increased risk among men with the CYP1A1 wild type and a high white meat mutagen index instead of with the variant genotype, suggesting that activation of HCA by the CYP1A1 variant is not a critical determinant of colorectal cancer risk. Nonetheless, an increase in DNA adducts from normal mucosa has been reported to be associated with consumption of white meat in men (41), supporting a role for white meat in colorectal carcinogenesis. Whether these unexpected results stem from differences in other aspects of diet that we did not account for or whether the influence of the single genotype, in the context of the complexity of carcinogen metabolism, is not strong enough for detection is yet unknown.
Whereas CYP1A1 is involved in metabolism of both HCAs and PAHs, NAT2 plays a role in both detoxification and activation of HCAs, and GSTM1 is involved in the detoxification of PCAs. We also found an increased risk of colon, but not rectal cancer among individuals with at least one variant allele of the CYP1A1 genotypes examined, GSTM1, null, and the NAT2-imputed phenotype (17). These findings support the notion that modification in risk of colon cancer may be more evident when phase II metabolizing enzymes are examined in combination with CYP1A1 genotype (17,20,22,35,4244). Whereas a Japanese study reported no univariate association of CYP1A1 MSP1 or GSTM1 null genotype to colorectal adenomas in smokers (42), examination of multiple phase I and phase II metabolizing enzymes previously suggested that individuals with multiple polymorphisms were at nearly5-fold greater risk of colorectal cancer (20). Although NAT2 alone has generally not been reported to be associated with risk of colon (45), rectal, (32) or colorectal cancer (40,46,47), 2 studies reported an increase in risk of colorectal cancer in individuals with both the CYP1A2 rapid phenotype and the NAT2 rapid phenotype (35,43).
We previously reported that the associations of rectal cancer, NAT2, and GSTM1 with meat and meat preparation were not always in the hypothesized direction (16). However, although it is generally thought that risks would increase with the NAT2 rapid phenotype, the role of NAT2 in both activation and detoxification of HCAs (8,44) makes findings with both slow and rapid phenotypes believable. In women, we found no association of CYP1A1 polymorphisms alone, GSTM1 polymorphisms alone, or red meat mutagen alone with colon (15)and rectal cancer (16), but we did find a positive association with the CYP1A1 *2 genotype, the GSTM1 present genotype, and the red meat mutagen index. Previous findings include inverse associations of poultry and fish with colorectal cancer among those with GSTM1 phenotypes, which was attributed to confounding of other healthy habits (47). Lin and colleagues described a lower risk of colorectal adenomas among GSTM1 absent genotypes with high broccoli intake, presumably due to higher isothiocyanate levels (48). Therefore, it is difficult to discern which associations might be spurious and which might appropriately reflect activation or detoxification activities.
We did not directly measure heterocyclic amines and polycyclic aromatic hydrocarbons, but inferred their intake by asking questions about preference for doneness of meat and preparation method. Strengths of the study include rigorous quality control procedures (23) and in-depth dietary assessment that included detailed meat preparation questions (2426). Gender differences in association are difficult to reconcile; however, few studies have reported gender-specific interactions of gene environment associations, likely due to sample size issues. Biological plausibility of gender differences is supported by reports that estrogen may stimulate manganese and superoxide dismutase (antioxidants), influence gastrointestinal motility in pregnancy (49), protect against microsatellite instability in colorectal cancer (50), and be associated with increased risk of Crohns disease (51). We cannot rule out the possibility of recall bias for information recalled for up to 2 y prior to cancer diagnosis or case selection. It is possible that the time frame of measurements of exposure (diet and lifestyle) does not coincide with the pathological process and, if so, meaningful associations may be missed. Random measurement error and misclassification in measurement of diet, as well as lifestyle factors, generally results in attenuation of associations whereas multiple comparisons increase the likelihood of spurious findings. Given the unexpected directions of some of the findings, the possibility that one or more of the reported associations might be spurious should be the subject of further research.
These data suggest a modest decrease in the risk of colorectal cancer among individuals who have the CYP1A1 any *2 variant genotype and consume white meat prepared at high temperatures or white meat drippings. Risk increased among women with a high red meat mutagen index, CYP1A1 any *2 variant genotype, and the GSTM1 present genotype. Associations of white meat mutagen index and white meat dripping use with risk of colorectal cancer was more evident within select subgroups of individuals with the CYP1A1 any *2 variant genotype combined with one of the GSTM1 present genotype or the intermediate/rapid NAT2 imputed phenotype than with CYP1A1 alone. Genetic susceptibility conferred by polymorphisms in CYP1A1 alone and in combination with NAT2 intermediate/rapid imputed phenotype and GSTM1 present genotype may modify the association of meat and meat preparation variables with risk for colorectal cancer.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
3 Abbreviations used: A, adenine; bp, base pair; CYP, cytochrome p-450; C, cytosine; G, guanine; GST, glutathione S-transferase; HCA, heterocyclic amine; KPMCP, Kasier Permantente Northern California Cancer Registry; NAT, N-acetyl transferase; PAH, polycyclic aromatic hydrocarbon; PCR, polymerase chain reaction; T, thymine. ![]()
Manuscript received 1 June 2004. Initial review completed 4 July 2004. Revision accepted 26 October 2004.
| LITERATURE CITED |
|---|
|
|
|---|
1. Grivas, S., Nyhammar, T., Olsson, K. & Jagerstad, M. (1985) Formation of a new mutagenic DiMeIQx compound in a model system by heating creatinine, alanine and fructose. Mutat. Res. 151:177-183.[Medline]
2. Jagerstad, M., Reutersward, A. L., Grivas, S., Olsson, K., Negishi, C. & Sato, S. (1985) Effects of meat composition and cooking conditions on the formation of mutagenic imidazoquinoxalines (MeIQx and its methyl derivatives). Princess Takamatsu Symp. 16:87-96.[Medline]
3. Sinha, R., Rothman, N., Salmon, C. P., Knize, M. G., Brown, E. D., Swanson, C. A., Rhodes, D., Rossi, S., Felton, J. S. & Levander, O. A. (1998) Heterocyclic amine content in beef cooked by different methods to varying degrees of doneness and gravy made from meat drippings. Food Chem. Toxicol. 36:279-287.[Medline]
4. Sinha, R., Rothman, N., Brown, E. D., Salmon, C. P., Knize, M. G., Swanson, C. A., Rossi, S. C., Mark, S. D., Levander, O. A. & Felton, J. S. (1995) High concentrations of the carcinogen 2-amino-1-methyl-6-phenylimidazo- [4,5-b]pyridine (PhIP) occur in chicken but are dependent on the cooking method. Cancer Res. 55:4516-4519.
5. Keating, G. A., Sinha, R., Layton, D., Salmon, C. P., Knize, M. G., Bogen, K. T., Lynch, C. F. & Alavanj, M. (2000) Comparison of heterocyclic amine levels in home-cooked meats with exposure indicators (United States). Cancer Causes Control 11:731-739.[Medline]
6. Weisburger, J. H. (2002) Comments on the history and importance of aromatic and heterocyclic amines in public health. Mutat. Res. 506507:9-20.
7. Kazerouni, N., Sinha, R., Hsu, C. H., Greenberg, A. & Rothman, N. (2001) Analysis of 200 food items for benzo[a]pyrene and estimation of its intake in an epidemiologic study. Food Chem. Toxicol. 39:423-436.[Medline]
8. Sachse, C., Bhambra, U., Smith, G., Lightfoot, T. J., Barrett, J. H., Scollay, J., Garner, R. C., Boobis, A. R., Wolf, C. R. & Gooderham, N. J. (2003) Polymorphisms in the cytochrome P450 CYP1A2 gene (CYP1A2) in colorectal cancer patients and controls: allele frequencies, linkage disequilibrium and influence on caffeine metabolism. Br. J. Clin. Pharmacol. 55:68-76.[Medline]
9. Landi, M. T., Sinha, R., Lang, N. P. & Kadlubar, F. F. (1999) Human cytochrome P4501A2. IARC Sci. Publ. :173-195.
10. Schut, H. A. & Snyderwine, E. G. (1999) DNA adducts of heterocyclic amine food mutagens: implications for mutagenesis and carcinogenesis. Carcinogenesis 20:353-368.
11. MacLeod, S., Sinha, R., Kadlubar, F. F. & Lang, N. P. (1997) Polymorphisms of CYP1A1 and GSTM1 influence the in vivo function of CYP1A2. Mutat. Res. 376:135-142.[Medline]
12. Goldman, R. & Shields, P. G. (2003) Food mutagens. J. Nutr. 133(suppl. 3):965S-973S.
13. Slattery, M. L., Potter, J., Caan, B., Edwards, S., Coates, A., Ma, K. N. & Berry, T. D. (1997) Energy balance and colon cancerbeyond physical activity. Cancer Res. 57:75-80.
14. Slattery, M. L., Edwards, S., Curtin, K., Ma, K., Edwards, R., Holubkov, R. & Schaffer, D. (2003) Physical activity and colorectal cancer. Am. J. Epidemiol. 158:214-224.
15. Kampman, E., Slattery, M. L., Bigler, J., Leppert, M., Samowitz, W., Caan, B. J. & Potter, J. D. (1999) Meat consumption, genetic susceptibility, and colon cancer risk: a United States multicenter case-control study. Cancer Epidemiol. Biomarkers Prev. 8:15-24.
16. Murtaugh, M. A., Ma, K. N., Sweeney, C., Caan, B. J. & Slattery, M. L. (2004) Meat consumption patterns and preparation, genetic variants of metabolic enzymes, and their association with rectal cancer in men and women. J. Nutr. 134:776-784.
17. Slattery, M., Samowitz, W., Ma, K., Murtaugh, M., Sweeney, C., Levin, T. & Neuhausen, S. (2004) Cyp1A1, cigarette smoking, and colon and rectal cancers. Am. J. Epidemiol. 160:842-852.
18. Roberts-Thomson, I. C., Butler, W. J. & Ryan, P. (1999) Meat, metabolic genotypes and risk for colorectal cancer. Eur. J. Cancer Prev. 8:207-211.[Medline]
19. Ye, Z. & Parry, J. M. (2002) Meta-analysis of 20 case-control studies on the N-acetyltransferase 2 acetylation status and colorectal cancer risk. Med. Sci. Monit. 8:CR558-CR565.[Medline]
20. Kiss, I., Sandor, J., Pajkos, G., Bogner, B., Hegedus, G. & Ember, I. (2000) Colorectal cancer risk in relation to genetic polymorphism of cytochrome P450 1A1, 2E1, and glutathione-S-transferase M1 enzymes. Anticancer Res. 20:519-522.[Medline]
21. Sivaraman, L., Leatham, M. P., Yee, J., Wilkens, L. R., Lau, A. F. & Le Marchand, L. (1994) CYP1A1 genetic polymorphisms and in situ colorectal cancer. Cancer Res. 54:3692-3695.
22. Sachse, C., Smith, G., Wilkie, M. J., Barrett, J. H., Waxman, R., Sullivan, F., Forman, D., Bishop, D. T. & Wolf, C. R. (2002) A pharmacogenetic study to investigate the role of dietary carcinogens in the etiology of colorectal cancer. Carcinogenesis 23:1839-1849.
23. Edwards, S., Slattery, M. L., Mori, M., Berry, T. D., Caan, B. J., Palmer, P. & Potter, J. D. (1994) Objective system for interviewer performance evaluation for use in epidemiologic studies. Am. J. Epidemiol. 140:1020-1028.
24. McDonald, A., Van Horn, L., Slattery, M., Hilner, J., Bragg, C., Caan, B., Jacobs, D., Liu, K., Hubert, H., Gernhofer, N., Betz, E. & Havlik, D. (1991) The CARDIA dietary history: development and implementation. J. Am. Diet. Assoc. 91:1104-1112.[Medline]
25. Slattery, M. L., Caan, B. J., Duncan, D., Berry, T. D., Coates, A. & Kerber, R. (1994) A computerized diet history questionnaire for epidemiologic studies. J. Am. Diet. Assoc. 94:761-766.[Medline]
26. Liu, K., Slattery, M., Jacobs, D., Jr, Cutter, G., McDonald, A., Van Horn, L., Hilner, J. E., Caan, B., Bragg, C. & Dyer, A., et al (1994) A study of the reliability and comparative validity of the cardia dietary history. Ethn. Dis. 4:15-27.[Medline]
27. Hayashi, S. I., Watanabe, J., Nakachi, K. & Kawajiri, K. (1991) PCR detection of an A/G polymorphism within exon 7 of the CYP1A1 gene. Nucleic Acids Res. 19:4797.
28. Rebbeck, T. R., Rosvold, E. A., Duggan, D. J., Zhang, J. & Buetow, K. H. (1994) Genetics of CYP1A1: coamplification of specific alleles by polymerase chain reaction and association with breast cancer. Cancer Epidemiol. Biomarkers Prev. 3:511-514.[Abstract]
29. Song, N., Tan, W., Xing, D. & Lin, D. (2001) CYP 1A1 polymorphism and risk of lung cancer in relation to tobacco smoking: a case-control study in China. Carcinogenesis 22:11-16.
30. Zhong, S., Howie, A. F., Ketterer, B., Taylor, J., Hayes, J. D., Beckett, G. J., Wathen, C. G., Wolf, C. R. & Spurr, N. K. (1991) Glutathione S-transferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis 12:1533-1537.
31. Bell, D. A., Taylor, J. A., Butler, M. A., Stephens, E. A., Wiest, J., Brubaker, L. H., Kadlubar, F. F. & Lucier, G. W. (1993) Genotype/phenotype discordance for human arylamine N-acetyltransferase (NAT2) reveals a new slow-acetylator allele common in African-Americans. Carcinogenesis 14:1689-1692.
32. Slattery, M. L., Edwards, S., Curtin, K., Schaffer, D. & Neuhausen, S. (2003) Associations between smoking, passive smoking, GSTM-1, NAT2, and rectal cancer. Cancer Epidemiol. Biomarkers Prev. 12:882-889.
33. Slattery, M. L., Edwards, S. L., Boucher, K. M., Anderson, K. & Caan, B. J. (1999) Lifestyle and colon cancer: an assessment of factors associated with risk. Am. J. Epidemiol. 150:869-877.
34. Hosmer, D. & Lemeshow, S. (1992) Confidence interval estimation of interaction. Epidemiology 3:452-456.[Medline]
35. Le Marchand, L., Hankin, J. H., Wilkens, L. R., Pierce, L. M., Franke, A., Kolonel, L. N., Seifried, A., Custer, L. J., Chang, W., Lum-Jones, A. & Donlon, T. (2001) Combined effects of well-done red meat, smoking, and rapid N-acetyltransferase 2 and CYP1A2 phenotypes in increasing colorectal cancer risk. Cancer Epidemiol. Biomarkers Prev. 10:1259-1266.
36. World Cancer Research Fund/American Institute for Cancer Research (1997) Food, nutrition, and the prevention of cancer: a global perspective 1997 American Institute for Cancer Research Washington, DC.
37. Singh, P. N. & Fraser, G. E. (1998) Dietary risk factors for colon cancer in a low-risk population. Am. J. Epidemiol. 148:761-774.
38. Mathew, A., Sinha, R., Burt, R., Caan, B., Paskett, E., Iber, F., Kikendall, J. W., Lance, P., Shike, M., Weissfeld, J., Schatzkin, A., Lanza, E. & Group, T.P.P.S. (2004) Meat intake and the recurrence of colorectal adenomas. Eur. J. Cancer Prev. 13:159-164.[Medline]
39. Knize, M. G., Kulp, K. S., Salmon, C. P., Keating, G. A. & Felton, J. S. (2002) Factors affecting human heterocyclic amine intake and the metabolism of PhIP. Mutat. Res. 506507:153-162.
40. Butler, L. M., Sinha, R., Millikan, R. C., Martin, C. F., Newman, B., Gammon, M. D., Ammerman, A. S. & Sandler, R. S. (2003) Heterocyclic amines, meat intake, and association with colon cancer in a population-based study. Am. J. Epidemiol. 157:434-445.
41. Leuratti, C., Watson, M. A., Deag, E. J., Welch, A., Singh, R., Gottschalg, E., Marnett, L. J., Atkin, W., Day, N. E., Shuker, D. E. & Bingham, S. A. (2002) Detection of malondialdehyde DNA adducts in human colorectal mucosa: relationship with diet and the presence of adenomas. Cancer Epidemiol. Biomarkers Prev. 11:267-273.
42. Inoue, H., Kiyohara, C., Marugame, T., Shinomiya, S., Tsuji, E., Handa, K., Hayabuchi, H., Onuma, K., Hamada, H., Koga, H. & Kono, S. (2000) Cigarette smoking, CYP1A1 MspI and GSTM1 genotypes, and colorectal adenomas. Cancer Res. 60:3749-3752.
43. Lang, N. P., Butler, M. A., Massengill, J., Lawson, M., Stotts, R. C., Hauer-Jensen, M. & Kadlubar, F. F. (1994) Rapid metabolic phenotypes for acetyltransferase and cytochrome P4501A2 and putative exposure to food-borne heterocyclic amines increase the risk for colorectal cancer or polyps. Cancer Epidemiol. Biomarkers Prev. 3:675-682.[Abstract]
44. Hein, D. W., Doll, M. A., Fretland, A. J., Leff, M. A., Webb, S. J., Xiao, G. H., Devanaboyina, U. S., Nangju, N. A. & Feng, Y. (2000) Molecular genetics and epidemiology of the NAT1 and NAT2 acetylation polymorphisms. Cancer Epidemiol. Biomarkers Prev. 9:29-42.
45. Katoh, T., Boissy, R., Nagata, N., Kitagawa, K., Kuroda, Y., Itoh, H., Kawamoto, T. & Bell, D. A. (2000) Inherited polymorphism in the N-acetyltransferase 1 (NAT1) and 2 (NAT2) genes and susceptibility to gastric and colorectal adenocarcinoma. Int. J. Cancer 85:46-49.[Medline]
46. Chen, J., Stampfer, M. J., Hough, H. L., Garcia-Closas, M., Willett, W. C., Hennekens, C. H., Kelsey, K. T. & Hunter, D. J. (1998) A prospective study of N-acetyltransferase genotype, red meat intake, and risk of colorectal cancer. Cancer Res. 58:3307-3311.
47. Tiemersma, E. W., Kampman, E., Bueno de Mesquita, H. B., Bunschoten, A., van Schothorst, E. M., Kok, F. J. & Kromhout, D. (2002) Meat consumption, cigarette smoking, and genetic susceptibility in the etiology of colorectal cancer: results from a Dutch prospective study. Cancer Causes Control 13:383-393.[Medline]
48. Lin, H. J., Probst-Hensch, N. M., Louie, A. D., Kau, I. H., Witte, J. S., Ingles, S. A., Frankl, H. D., Lee, E. R. & Haile, R. W. (1998) Glutathione transferase null genotype, broccoli, and lower prevalence of colorectal adenomas. Cancer Epidemiol. Biomarkers Prev. 7:647-652.[Abstract]
49. Walsh, J. W., Hasler, W. L., Nugent, C. E. & Owyang, C. (1996) Progesterone and estrogen are potential mediators of gastric slow-wave dysrhythmias in nausea of pregnancy. Am. J. Physiol. 270:G506-G514.
50. Slattery, M. L., Potter, J. D., Curtin, K., Edwards, S., Ma, K. N., Anderson, K., Schaffer, D. & Samowitz, W. S. (2001) Estrogens reduce and withdrawal of estrogens increase risk of microsatellite instability-positive colon cancer. Cancer Res. 61:126-130.
51. Boyko, E. J., Theis, M. K., Vaughan, T. L. & Nicol-Blades, B. (1994) Increased risk of inflammatory bowel disease associated with oral contraceptive use. Am. J. Epidemiol. 140:268-278.
This article has been cited by other articles:
![]() |
M. Cotterchio, B. A. Boucher, M. Manno, S. Gallinger, A. B. Okey, and P. A. Harper Red Meat Intake, Doneness, Polymorphisms in Genes that Encode Carcinogen-Metabolizing Enzymes, and Colorectal Cancer Risk Cancer Epidemiol. Biomarkers Prev., November 1, 2008; 17(11): 3098 - 3107. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Ochs-Balcom, G. Wiesner, and R. C. Elston A Meta-Analysis of the Association of N-Acetyltransferase 2 Gene (NAT2) Variants with Breast Cancer Am. J. Epidemiol., August 1, 2007; 166(3): 246 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bendaly, S. Zhao, J. R. Neale, K. J. Metry, M. A. Doll, J. C. States, W. M. Pierce Jr., and D. W. Hein 2-Amino-3,8-Dimethylimidazo-[4,5-f]Quinoxaline-Induced DNA Adduct Formation and Mutagenesis in DNA Repair-Deficient Chinese Hamster Ovary Cells Expressing Human Cytochrome P4501A1 and Rapid or Slow Acetylator N-Acetyltransferase 2 Cancer Epidemiol. Biomarkers Prev., July 1, 2007; 16(7): 1503 - 1509. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Goode, J. D. Potter, W. R. Bamlet, D. N. Rider, and J. Bigler Inherited variation in carcinogen-metabolizing enzymes and risk of colorectal polyps Carcinogenesis, February 1, 2007; 28(2): 328 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Norat, S. Bingham, P. Ferrari, N. Slimani, M. Jenab, M. Mazuir, K. Overvad, A. Olsen, A. Tjonneland, F. Clavel, et al. Meat, Fish, and Colorectal Cancer Risk: The European Prospective Investigation into Cancer and Nutrition J Natl Cancer Inst, June 15, 2005; 97(12): 906 - 916. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||