![]() |
|
|
Expression in Adipose Tissue in Obese Insulin-Resistant Dogs1
National Veterinary School of Nantes, Laboratory of Nutrition and Endocrinology, Nantes, France and Human Nutrition Research Centre, Nantes, France
2 To whom correspondence should be addressed. E-mail: pnguyen{at}vet-nantes.fr.
KEY WORDS: uncoupling protein PPAR
obesity insulin resistance
Introduction
Peroxisome proliferator-activated receptors (PPARs)3 are members of the nuclear receptor superfamily. They are activated by a variety of fatty acids, fatty acid derivatives, and synthetic compounds. Three closely related subtypes, PPAR
, PPAR
/ß, and PPAR
have been identified. Each member displays distinct tissue-selective expression and biological activity. PPAR
is expressed in liver, heart, muscle, and kidney where it regulates fatty acid catabolism (1). PPAR
/ß is ubiquitously expressed; it is implicated in the regulation of lipid metabolism in neurons (2), is the mediator of fatty acidcontrolled differentiation of preadipose cells (3), and plays a role in inflammatory status (4). PPAR
is highly enriched in adipocytes and macrophages, is involved in adipocyte differentiation and glucose homeostasis, and promotes lipid storage in mature adipocytes by increasing the expression of several genes, especially uncoupling protein 1 (UCP1) (5).
UCPs belong to a transporter family present in the mitochondrial inner membrane that, by dissipating the mitochondrial proton gradient, uncouples respiration from ATP synthesis (6). UCP1, a classical UCP, is present exclusively in adipose tissue, which is the major site of regulatory thermogenesis in small rodents. It is now accepted that UCP1 is a key molecule for thermogenesis, such as cold- and diet-induced heat production (7). Thus, this molecule may contribute to the adaptive change in energy expenditure, and thereby to the regulation of whole-body energy balance. Its dysfunction may contribute to the development of obesity.
The role of PPAR
in adipogenesis, its effect on UCP1 expression, and the involvement of UCP1 in energetic status led us to study their expression in visceral adipose tissue in obese dogs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Five healthy adult beagle dogs, 39 y old, initial body weight (BW) 12.2 ± 1.0 kg, were housed according to the regulations for animal welfare of the French Ministry of Agriculture and Fisheries. The experimental protocols adhered to European Union guidelines and were approved by the Animal Use and Care Advisory Committee of the University of Nantes.
Diet
Before the initiation of the study, dogs were fed according to the National Research Council (NRC) recommendation (132 kcal metabolizable energy (ME)/kg BW0.75) and consumed in a single meal, a dry commercial dog food (27% crude protein, 13% ether extract, and 3730 kcal ME/kg, on a dry matter basis). To develop obesity and insulin resistance, dogs were given a hyperenergetic diet fed ad libitum, with 75% of the energy allowance from a dry diet (34% crude protein, 32.6% ether extract, and 4790 kcal ME/kg) and 25% from a canned food (35% crude protein, 20% ether extract, and 3860 kcal ME/kg). Food intake was recorded daily.
Insulin sensitivity was assessed using the euglycemic hyperinsulinemic clamp technique, before BW gain and when the BW gain had been at least 20% of the initial BW for at least 5 wk.
RNA extraction
While dogs were anesthetized, tissue samples (200500 mg) were collected quickly from omental visceral adipose tissue and snap-frozen in liquid nitrogen. Frozen samples were then homogenized, and total RNA was extracted from individual samples using TRIzol reagent according to manufacturer's description (Gibco BRL, Grand Island, NY). After isolation, RNA pellets were dissolved in water and then quantified spectrophotometrically.
Reverse transcription and PCR analysis
One microgram of total RNA was reverse-transcribed in a 20-µL reaction volume using random primers (Pharmacia, Saclay, Orsay Cedex, France) and Superscript II Moloney leukemia virus reverse transcriptase according to the manufacturer's instructions (Life Technologies, Cergy Pontoise, France). After reverse transcription, 80 µL of distilled water was added.
Quantitative real-time PCR was conducted using a Rotorgene 2000 (Ozyme, Saint-Quentin en Yvelines, France) in a 20-µL mixture containing 0.25 mM dNTPs, 0.5 mM of each primer, 2 U Taq Titanium Polymerase (Ozyme), 1X SYBR Green (Roche Diagnostic, Meylan, France), and 2 µL of cDNA. Glyceraldehyde 3 phosphate deshydrogenase (GAPDH) was used as a reference for initial RNA loading. The sense/antisense primers (Genosys, Pampisford, UK), designed using the GeneJockey 2 Software program, were: UCP1: 5'-CAATGCTCACCAAGGAAGGACC-3' (sense) and 5' CTTCATCAGTTCTCGCTTCAGC 3' (antisense); PPAR
: 5'-CATTTACACGATGCTGGCGTCC-3' (sense) and 5' CTCCACTGAGAATAATGACGGC 3'(antisense), and GAPDH: 5'-ACAGTCAAGGCTGAGAACGG-3' (sense) and 5' CCACAACATACTCAGCACCAGC 3' (antisense). The specificity of PCR primers and the annealing temperature were tested under normal PCR conditions with temperature gradient (5570°C) as annealing. The real-time PCR conditions for PPAR
were denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 10 s, 63°C for 10 s, 72°C for 10 s, and 85°C for 15 s during which fluorescence was acquired. PCR conditions for UCP1 were denaturation at 95°C for 5 min followed by 35 cycles of 95°C for 10 s, 69°C for 15 s, 72°C for 15 s, and 86°C for 15 s during which fluorescence was acquired. PCR conditions for GAPDH were denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 10 s, 69°C for 15 s, 72°C for 15 s, and 86°C for 15 s during which fluorescence was acquired. The fluorescence cycle threshold (Ct) was calculated to quantify the relative amount of gene expression. Results are expressed according to the 2
Ct method (8) and the level of expression of the control group was arbitrarily set at 100%.
Statistical analysis
Values are expressed as the mean ± SEM. Comparison among means was performed by Student's t test for unpaired values. P-values <0.05 were considered significant. All calculations were performed using Statview 5 software (Abacus Concepts, Berkeley, CA).
| RESULTS |
|---|
|
|
|---|
BW increased by 43 ± 5%, from 12.2 ± 1.0 kg to 17.5 ± 1.7 kg (P < 0.05) over 198 ± 18 d. Mean energy intake was 1.88 ± 0.08 times the NRC recommendation (132 kcal ME/kg BW0.75) on the basis of initial BW.
Insulin sensitivity
Baseline glucose concentrations did not differ in the dogs, either when normal weight or when obese and insulin resistant. In contrast, baseline insulin concentrations were significantly higher when dogs were obese and insulin resistant (24 ± 1 µU/mL) compared with the dogs before becoming obese (10 ± 1 µU/mL) (P < 0.05). Insulin infusion elevated the plasma insulin value to a steady-state plateau. Glucose infusion rate increased during the first hour of the clamp, then remained constant. The glucose infusion rate needed to maintain euglycemia was significantly higher in the dogs when normal weight than when obese and insulin resistant (28 ± 3 and 15 ± 1 mg.kg1.min1, P < 0.05).
UCP1 mRNA expression
The UCP1 mRNA expression in visceral adipose tissue was significantly reduced in the dogs when obese and insulin resistant compared with dogs before becoming obese. Thus relative UCP1 mRNA expression decreased from 100 ± 28% in the dogs when normal weight to 24 ± 13% in the dogs when obese and insulin resistant (P < 0.05) (Fig. 1).
|
mRNA expression
The PPAR
mRNA expression in visceral adipose tissue was significantly reduced in the dogs when obese and insulin resistant compared with dogs before the hyperenergetic diet. Thus relative PPAR
mRNA expression decreased from 100 ± 28% in normal weight state to 23 ± 2% in obese insulin-resistant state (P < 0.05) (Fig. 2).
|
| DISCUSSION |
|---|
|
|
|---|
mRNA expression in visceral adipose tissue in the dogs when normal weight and insulin sensitive compared with those when obese and insulin resistant.
Adipocytes have been identified as a central player in the control of energy balance and whole-body lipid homeostasis. Indeed, storage and release of fatty acids and glycerol from the adipocyte have an overall impact on lipid homeostasis as well as hepatic and peripheral glucose metabolism. Adipocytes can play another secretory function. They play an important role in energy regulation via endocrine, paracrine, and autocrine signals (9). One of these signals, PPAR
, is highly expressed in both white and brown adipose tissues (10). It functions as a key modulator of lipid homeostasis by promoting adipocyte differentiation, and storage in mature adipocytes by increasing the expression of several genes (5).
The nutritional regulation of PPAR
gene expression is still unclear. In rodents, adipose tissue PPAR
expression is regulated by insulin (11). It is decreased by fasting and increased by a high-fat diet (12). Other studies showed no significant changes in PPAR
mRNA levels in muscle or adipose tissue after a high-fat diet, in either adult rats (13) or pups (14). In humans, a long-term hypocaloric diet decreased PPAR
expression in adipose tissue (15). In moderately overweight subjects, the amount of PPAR
mRNA was not modified by a 5-wk low- or high-glycemic index diet, whereas the former was associated with a loss of weight (16).
Genetic models have advanced our understanding of the role of PPAR
signaling in insulin resistance. In mouse models of lipoatrophic diabetes, the absence of adipose tissue is associated with severe insulin resistance (17). Moreover, PPAR
+/ mice were found to have small adipocytes and to be more insulin sensitive than wild-type controls, and adipocyte hypertrophy in response to a high-fat diet was partially prevented in these mice (18). There appears to be an optimal PPAR
activity in adipose tissue for an optimal whole-body lipid metabolism. Both too little and too much PPAR
, leading in atrophy and hypertrophy, respectively, appears to cause insulin resistance. The decrease in PPAR
expression in our study could be a mechanism to limit adipogenesis and insulin resistance in dogs fed for 7 mo with a high-fat high-energy diet.
Most nutritional studies have been carried out for a relatively short period. So, animals were in an early state of obesity, with high adipogenesis and high-energy metabolism. In our work, the study design was quite different. Indeed, we have studied a very long-term effect of a high-fat diet given at a high hyperenergetic level. At the end of the excessive diet treatment, the dogs had been obese for a few weeks; their BW was in a steady state. Gene expression in white adipose tissue from obese and/or diabetic mice has been characterized using DNA microarray technology. The expression of genes involved in adipocyte differentiation and adipogenesis was decreased in obese mice compared with lean controls (19). Another study profiling gene expression in wild-type and leptin-deficient mice also showed a reduced expression of several genes involved in adipocyte differentiation, especially genes involved in lipid metabolism (20). The decreased PPAR
expression in our study is consistent with these findings.
Another protein, UCP1 could be involved in regulating energy metabolism. UCP1 is present in adipose tissue and has a well-documented role in cold-induced thermogenesis. Brown adipose tissue oxidative phosphorylation is uncoupled, i.e., shows a high thermogenesis without ATP synthesis (21). Experiments with UCP1-ablated mice showed that this thermogenesis requires the presence of UCP1 in adipose tissue (22).
UCP1 is responsible for diet-induced thermogenesis (7). This was postulated to be a defense mechanism against diet-induced obesity. Nevertheless, the link between UCP1 expression and metabolic status is still unclear. Thus, on the one hand, there is an upregulation of adipose UCP1 during high-fat feeding in rodents (13,23); but the involvement of UCP1 in thermogenesis has to be taken into account. Indeed, a high-fat diet increased UCP1 expression at 23°C and decreased expression at 29°C. Housing animals at thermoneutrality significantly decreased the UCP1 levels (24). On the other hand, targeted disruption of the UCP1 gene rendered animals cold sensitive, but not obese (7). A prolonged starvation induced a rise in UCP mRNA, associated with a fall in body temperature (25). The relationship between body weight and UCP1 levels is not well established. Intraperitoneal administration of adiponectin, which attenuated body weight gain and reduced visceral adiposity in A(y)/a obese mice increased the expression of UCP1 mRNA (26). In prediabetic obese OLETF rats, UCP-1 mRNA expression levels and the UCP-1 protein content were reduced as compared with the lean LETO rats. DHEA treatment increased UCP1 mRNA expression and factors involved in regulation of UCP1 expression, i.e., ß3 adrenergic receptor, PPAR
coactivator 1, and PPAR
(27).
In conclusion, these results indicate a parallel decrease in adipose tissue UCP1 and PPAR
mRNA expression in the dogs when obese and insulin resistant. PPAR
expression in obese animals, where adipogenesis is greatly reduced, seems to have little relevance. The decrease in PPAR
expression could account for the decrease in UCP1 expression, which could, in turn, participate in the promotion of obesity.
| FOOTNOTES |
|---|
3 Abbreviations used: BW, body weight; GAPDH, glyceraldehyde 3 phosphate deshydrogenase; NRC, National Research Council; PPAR, peroxisome proliferator-activated receptor; UCP, uncoupling protein. ![]()
| LITERATURE CITED |
|---|
|
|
|---|
1. Dreyer, C., Keller, H., Mahfoudi, A., Laudet, V., Krey, G. & Wahli, W. (1993) Positive regulation of the peroxisomal beta-oxidation pathway by fatty acids through activation of peroxisome proliferator-activated receptors (PPAR). Biol. Cell. 77: 6776.[Medline]
2. Basu-Modak, S., Braissant, O., Escher, P., Desvergne, B., Honegger, P. & Wahli, W. (1999) Peroxisome proliferator-activated receptor ß regulates acyl-CoA synthetase 2 in reaggregated rat brain cell cultures. J. Biol. Chem. 274: 3588135888.
3. Bastie, C., Luquet, S., Holst, D., Jehl-Pietri, C. & Grimaldi, P. A. (2000) Alterations of peroxisome proliferator-activated receptor
activity affect fatty acid-controlled adipose differentiation. J. Biol. Chem. 275: 3876838773.
4. Lee, C. H., Chawla, A., Urbiztondo, N., Liao, D., Boisvert, W. A. & Evans, R. M. (2003) Transcriptional repression of atherogenic inflammation: modulation by PPAR
. Science 302: 453457.
5. Desvergne, B. & Wahli, W. (2001) Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr. Rev. 20: 649688.
6. Palmieri, F. (1994) Mitochondrial carrier proteins. FEBS Lett. 346: 4854.[Medline]
7. Enerback, S., Jacobsson, A., Simpson, E. M., Guerra, C., Yamashita, H., Harper, M. E. & Kozak, L. P. (1997) Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387: 9094.[Medline]
8. Li, Y., Zimmermann, B., Zhong, X., Gupta, A., Holzgreve, W. & Hahn, S. (2003) Determination of RHD zygosity using real-time quantitative PCR. Swiss Med. Wkly. 33: 442445.
9. Mohamed-Ali, V., Pinkney, J. H. & Coppak, S. W. (1998) Adipose tissue as an endocrine and paracrine organ. Int. J. Obes. 22: 11451158.[Medline]
10. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I. & Spiegelman, B. M. (1994) mPPAR
2: tissue-specific regulator of an adipocyte enhancer. Genes Dev. 8: 12241234.
11. Vidal-Puig, A., Jimenez-Linan, M., Lowell, B. B., Hamann, A., Hu, E., Spiegelman, B. M., Flier, J. S. & Moller, D. E. (1996) Regulation of PPAR
gene expression by nutrition and obesity in rodents. J. Clin. Invest. 97: 25532561.[Medline]
12. Redonnet, A., Groubet, R., Noel-Suberville, C., Bonilla, S., Martinez, A. & Higueret, P. (2001) Exposure to an obesity-inducing diet early affects the pattern of expression of peroxisome proliferator, retinoic acid, and triiodothyronine nuclear receptors in the rat. Metabolism 50: 11611167.[Medline]
13. Margareto, J., Marti, A. & Martinez, J. A. (2001) Changes in UCP mRNA expression levels in brown adipose tissue and skeletal muscle after feeding a high-energy diet and relationships with leptin, glucose and PPAR
. J. Nutr. Biochem. 12: 130137.[Medline]
14. Rousseau, V., Becker, D. J., Ongemba, L. N., Rahier, J., Henquin, J. C. & Brichard, S. M. (1997) Developmental and nutritional changes of ob and PPAR
2 gene expression in rat white adipose tissue. Biochem. J. 321: 451456.
15. Vidal-Puig, A. J., Considine, R. V., Jimenez-Linan, M., Werman, A., Pories, W. J., Caro, J. F. & Flier, J. S. (1997) Peroxisome proliferator-activated receptor gene expression in human tissues. Effects of obesity, weight loss, and regulation by insulin and glucocorticoids. J. Clin. Invest. 99: 24162422.[Medline]
16. Bouche, C., Rizkalla, S. W., Luo, J., Vidal, H., Veronese, A., Pacher, N., Fouquet, C., Lang, V. & Slama, G. (2002) Five-week, low-glycemic index diet decreases total fat mass and improves plasma lipid profile in moderately overweight nondiabetic men. Diabetes Care 25: 822828.
17. Gavrilova, O., Marcus-Samuels, B., Graham, D., Kim, J.K., Shulman, G.I., Castle, A.L., Vinson, C., Eckhaus, M. & Reitman ML. (2000) Surgical implantation of adipose tissue reverses diabetes in lipoatrophic mice. J. Clin. Invest. 105: 271278.[Medline]
18. Miles, P. D., Barak, Y., He, W., Evans, R. M. & Olefsky, J. M. (2000) Improved insulin-sensitivity in mice heterozygous for PPAR-
deficiency. J. Clin. Invest. 105: 287292.[Medline]
19. Nadler, S. T., Stoehr, J. P., Schueler, K. L., Tanimoto, G., Yandell, B. S. & Attie, A. D. (2000) The expression of adipogenic genes is decreased in obesity and diabetes mellitus. Proc. Natl. Acad. Sci. USA 97: 1137111376.
20. Soukas, A., Cohen, P., Socci, N. D. & Friedman, J. M. (2000) Leptin-specific patterns of gene expression in white adipose tissue. Genes Dev. 14: 963980.
21. Nedergaard, J., Matthias, A., Golozoubova, V., Jacobsson, A. & Cannon, B. (1999) UCP1: the original uncoupling proteinand perhaps the only one? New perspectives on UCP1, UCP2, and UCP3 in the light of the bioenergetics of the UCP1-ablated mice. J. Bioenerg. Biomembr. 31: 475491.[Medline]
22. Sears, I. B., MacGinnitie, M. A., Kovacs, L. G. & Graves, R. A. (1996) Differentiation-dependent expression of the brown adipocyte uncoupling protein gene: regulation by peroxisome proliferator-activated receptor
. Mol. Cell. Biol. 16: 34103419.[Abstract]
23. Rippe, C., Berger, K., Mei, J., Lowe, M. E. & Erlanson-Albertsson, C. (2003) Effect of long-term high-fat feeding on the expression of pancreatic lipases and adipose tissue uncoupling proteins in mice. Pancreas 26: 3642.
24. Rippe, C., Berger, K., Boiers, C., Ricquier, D. & Erlanson-Albertsson, C. (2000) Effect of high-fat diet, surrounding temperature, and enterostatin on uncoupling protein gene expression. Am. J. Physiol. Endocrinol. Metab. 54: 803807.
25. Champigny, O. & Ricquier, D. (1990) Effects of fasting and refeeding on the level of uncoupling protein mRNA in rat brown adipose tissue: evidence for diet-induced and cold-induced responses. J. Nutr. 120: 17301736.
26. Masaki, T., Chiba, S., Yasuda, T., Tsubone, T., Kakuma, T., Shimomura, I., Funahashi, T., Matsuzawa, Y. & Yoshimatsu, H. (2003) Peripheral, but not central, administration of adiponectin reduces visceral adiposity and upregulates the expression of uncoupling protein in agouti yellow (Ay/a) obese mice. Diabetes 52: 22662273.
27. Ryu, J. W., Kim, M. S., Kim, C. H., Song, K. H., Park, J. Y., Lee, J. D., Kim, J. B. & Lee, K. U. (2003) DHEA administration increases brown fat uncoupling protein 1 levels in obese OLETF rats. Biochem. Biophys. Res. Commun. 303: 726731.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||