Journal of Nutrition EB Program 2010 Abstracts

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, W. T.
Right arrow Articles by DeMars, L. C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, W. T.
Right arrow Articles by DeMars, L. C. S.
© 2004 The American Society for Nutritional Sciences J. Nutr. 134:1328-1333, June 2004


Biochemical and Molecular Actions of Nutrients

Increased Heme Oxygenase-1 Expression during Copper Deficiency in Rats Results from Increased Mitochondrial Generation of Hydrogen Peroxide1–,4

W. Thomas Johnson5 and Lana C. S. DeMars

U.S. Department of Agriculture, Agricultural Research Service, Grand Forks Human Nutrition Research Center, Grand Forks, ND 58202-9034

5To whom correspondence should be addressed. E-mail: tjohnson{at}gfhnrc.ars.usda.gov.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
The activity of hepatic heme oxygenase (HO) in rats is elevated in response to copper deficiency. However, the mechanism responsible for the increase in HO activity is poorly understood. Oxidative stress is a common denominator for many of the signals that induce HO-1, the inducible isoform of HO. The present study evaluated the role of H2O2 and the mitochondrial electron transport chain as a potential mechanism for the induction of HO-1 during copper deficiency. Mitochondria isolated from the livers of young male rats fed a copper-deficient diet for 5 wk had significantly (P < 0.05) reduced levels of NADH:cytochrome c reductase (31% reduction), succinate:cytrochrome c reductase (42% reduction), and cytochrome c oxidase (70% reduction) activities and significantly increased production of H2O2 (48% increase) when glutamate was used as a substrate. Hepatic levels of HO-1 protein and mRNA were also significantly elevated (48 and 20%, respectively) in copper-deficient rats, indicating that copper deficiency stimulated the expression of the HO-1 gene. Furthermore, hepatic HO-1 protein content was best described by a regression model that included mitochondrial NADH:cytochrome c reductase and succinate:cytochrome c reductase activities, but not cytochrome c oxidase activity (R2 = 0.54, P < 0.02). Hydrogen peroxide is a known inducer of HO-1, and our results suggest that increased mitochondrial H2O2 production resulting from inhibition of respiratory complex activities contributes to the induction of HO-1 during copper deficiency. The levels of HO-1 protein and mRNA were also elevated (85 and 95%, respectively) in hearts from copper-deficient rats, indicating that the effects of copper deficiency on HO-1 gene expression are not limited to hepatic tissue.


KEY WORDS: • heme oxygenase • mitochondria • hydrogen peroxide • respiratory complexes • copper deficiency

Heme oxygenase (HO)6 catalyzes the initial rate-limiting step in heme catabolism, producing equimolar quantities of iron, carbon monoxide, and biliverdin from the oxidative cleavage of b-type heme. The HO family consists of the following 3 isozymes: an inducible form, HO-1, a constitutively expressed form, HO-2, and a cloned form, HO-3, identified in the brain (1,2). The HO-1 form is induced by its heme substrate (3) and also by a number of stress factors including heavy metals, certain organic compounds, hypoxia, hyperoxia, heat shock, ultraviolet radiation, hydrogen peroxide, and cytokines (410). Although the exact functional role of HO-1 induction is not fully understood, the realization that many inducers of HO-1 are either oxidants themselves or are able to generate reactive oxygen species (ROS) led to the hypothesis that HO-1 induction is an adaptive cellular defense mechanism against oxidative stress (11,12). Confirmation of the role of HO-1 in defense against oxidative stress comes from the observation that cultured fibroblasts from HO-1 knockout mice are highly susceptible to hydrogen peroxide– and heme-mediated toxicity (13).

Elevated HO activity was reported in livers of copper-deficient rats (14). Although the increase in HO activity may be caused by alterations in iron and selenium metabolism that occur during copper deficiency, a mechanism for the increase has not been clearly identified. However, copper deficiency, by decreasing the activities of copper-dependent antioxidant enzymes, primarily superoxide dismutase (SOD)-1 and ceruloplasmin, results in an increase in oxidative stress (15) that may be an important determinant of HO activity in copper-deficient rats through the induction of HO-1. Cytochrome c oxidase (CCO), the terminal respiratory complex (complex IV) of the mitochondrial respiratory chain, is a copper-dependent enzyme whose activity is also reduced during copper deficiency (16,17). Although CCO is not an antioxidant enzyme per se, the reduction in CCO activity may also contribute to oxidative stress during copper deficiency by promoting increased mitochondrial ROS production. Although the mitochondrial electron transport chain converts 85–90% of the oxygen utilized by cells to water, ~1–2% of the oxygen is converted to ROS (18,19). Mitochondrial ROS production is largely determined by the redox state of the respiratory complexes and is highest when the complexes are highly reduced (18). Blockage of electron flow near the terminus of the electron transport chain increases the reducing potential of the respiratory complexes upstream from the blockage, causing increased ROS production through single electron transfer to molecular oxygen. This principle was demonstrated by showing that partial inhibition of CCO in mitochondria from the flight muscles of house flies increases the rate of mitochondrial H2O2 production (20). Thus, reduction in CCO activity caused by copper deficiency may result in overproduction of mitochondrially generated H2O2. The overproduction of H2O2 combined with compromised enzymatic antioxidant defenses may produce sufficient oxidative stress during copper deficiency to induce stress proteins such as HO-1. Accordingly, the present study examined the effect of copper deficiency on mitochondrial respiratory complex activities as a potential model for investigating the relationship between mitochondrially generated ROS and the expression of HO-1. In addition, the tissue specificity of HO-1 overexpression during copper deficiency was examined by comparing HO-1 induction in liver and heart.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Animals and diets. Male weanling Sprague-Dawley rats (n = 20; Charles River, Wilmington, MA) were housed individually in stainless steel cages in a room maintained at 22 ± 2°C and 50 ± 10% humidity with a 12-h light:dark cycle. The rats were randomly assigned (10 rats/group) to AIN-93G purified diets (21) formulated as either copper-deficient diet (CuD) containing no added copper or as copper-adequate diet (CuA) containing 6 mg Cu/kg diet as CuSO4 · H2O. The analyzed copper contents of the CuD and CuA were 0.3 and 5.4 mg/kg, respectively. Rats had free access to demineralized water and diets for 5 wk. After 5 wk of dietary treatment, the rats were anesthetized with ketamine/xylazine, and livers, hearts, and blood were removed for analysis. Liver copper and iron concentrations were measured by atomic absorption spectrophotometry (22). Plasma ceruloplasmin was assayed in serum by its amine oxidase activity (23). An electronic cell counter (Cell-Dyne 3500, Abbott Diagnostics) was used to measure hemoglobin (Hgb) concentrations and hematocrits. The study was approved by the Animal Care and Use Committee of the Grand Forks Human Nutrition Research Center, and the rats were maintained in accordance with the NIH guidelines for the care and use of laboratory rats.

    Immunoblot analysis. Liver and heart samples were weighed and homogenized in 10 volumes of either liver homogenizing buffer (0.25 mol/L sucrose, 10 mmol/L HEPES, 0.1 mmol/L EGTA, pH 7.4) or heart homogenizing buffer (0.225 mol/L mannitol, 0.075 mol/L sucrose, 20 mmol/L HEPES, 1 mmol/L EGTA, pH 7.4). Homogenates were centrifuged at 600 x g for 10 min. After the pellet was discarded, the supernatant fractions were centrifuged at 9000 x g for 10 min. The resulting supernatants, which contained suspended microsomes, were used for immunoblot detection of HO-1.

Proteins (15 µg of protein per lane) were separated by SDS-PAGE on 10% polyacrylamide gels and electroblotted to polyvinylidene fluoride membrane (Immobilon-P, Millipore). The blots were dried and incubated, without prior blocking, according to the manufacturer’s recommendation (Millipore Technical Note RP562), with anti-HO-1 (StressGen Biotechnologies) for 1 h at room temperature. After incubation with primary antibody, the blots were rinsed and incubated with horseradish peroxidase-coupled anti-IgG. Visualization of HO-1 was accomplished by chemiluminescence and exposure of the blots to luminescence detection film (ECL Western Blotting detection reagents and Hyperfilm-ECL, Amersham). The ODs of immunoreactive protein in the visualized bands were determined by imaging densitometry (GS-700 Imaging Densitometer, Bio-Rad Laboratories). One lane of each electrophoresis gel, regardless of whether it contained liver or heart samples, was loaded with a standard microsomal sample (15 µg protein) prepared from adult rat liver. This corrects for between-blot variations by allowing the content of HO-1 in liver and heart samples to be represented as a relative OD calculated by dividing the density of the immunoreactive protein in the experimental sample by the OD of the immunoreactive protein in the standard liver microsomal sample. In addition, each electrophoresis gel contained samples from rats fed CuD and CuA to balance between-blot variations for the 2 diet treatment groups.

    RNA isolation and PCR amplification. Standard methods were used to isolate total RNA by phenol-guanidine thiocyanate-chloroform extraction and to determine its quality and quantity (24). Real-time RT-PCR was performed using the Smart Cycler II System (Cepheid) with Smart Cycler software (version 2.0c.). Genomic DNA was removed from RNA samples before performing RT-PCR using DNase I amplification grade (Invitrogen Life Technologies) and following the manufacturer’s instructions. Heme oxygenase-1 mRNA was identified using fluorogenic primers targeted towards the rat HO-1 gene (Acc. no. NM 012580). The primer sequences, designed using LUX Designer software (Invitrogen Life Technologies), were as follows: HO-1 forward (FAM labeled), CACGATCCAAGTTCAAACAGCTCTATCGG; and HO-1 reverse, TGAGCAGGAAGGCGGTCTTAG. PCR also was performed in identical tubes with a FAM-labeled primer (mouse/rat PGK1-Certified LUX Primer Set, Invitrogen Life Technologies) targeted toward the phosphoglycerate kinase-1 gene (PGK-1), which was used as the internal control. One-step, real-time RT-PCR was performed using the Quanti Test Probe RT-PCR kit (Qiagen). Reaction mixtures were prepared according to instructions and contained LUX FAM-labeled primer (400 nmol/L), unlabeled primer (400 nmol/L), and 50 ng liver RNA or 100 ng heart RNA in a total volume of 25 µL. Conditions for RT-PCR were as follows: RT (30 min, 50°C; 15 min, 95°C) and 45 cycles of 3-step PCR (15 s, 94°C; 30 s, 50°C; 30 s, 72°C). Relative standard curves for the amplification of the HO-1 and PGK-1 genes were constructed by determining the threshold cycle (Ct) for several dilutions of total liver or heart RNA. The amount of HO-1 RNA relative to PGK-1 RNA in livers and hearts from rats fed copper-deficient and copper-adequate diets was quantified by measuring Ct, determining the corresponding amount of RNA from the appropriate standard curve, and calculating the ratio of HO-1 RNA to PGK-1 RNA (25).

    Hepatic mitochondrial enzyme activities and hydrogen peroxide production. Livers were homogenized as described above. The homogenate was centrifuged at 600 x g for 10 min. After the pellet was discarded, the supernatant was centrifuged at 7700 x g for 10 min. The resulting mitochondrial pellet was washed once and resuspended in liver homogenizing buffer (1 mL/g liver). NADH:cytochrome c reductase (NADHCR), succinate:cytochrome c reductase (SucCR), and CCO activities were assayed at 30°C in isolated mitochondria by a sequential, continuous assay that allows measurement of the 3 enzyme activities in a single sample of mitochondria (26). Briefly, CCO activity was measured by monitoring the change in absorbance at 550 nm ({Delta}A550) resulting from the oxidation of reduced cytochrome c. The CCO activity was monitored until {Delta}A550 was ~0.6 U, at which point CCO activity was terminated by adding KCN (0.17 mmol/L final concentration). Succinate was then added (12.5 mmol/L final concentration) and SucCR activity was measured by monitoring {Delta}A550 resulting from the reduction of the cytochrome c previously oxidized by CCO. SucCR activity was terminated by adding malonate (17 mmol/L final concentration), and NADHCR activity was measured by adding NADH (2.8 nmol/L final concentration) and monitoring {Delta}A550 resulting from the further reduction of cytochrome c. The rate of cytochrome c oxidation or reduction (nmol/min) was calculated using a molar extinction coefficient of 19,600 for cytochrome c (16). The rate of hydrogen peroxide production was measured fluorometrically (27) using a p-hydroxyphenylacetate-horseradish peroxidase coupled assay as previously described. The rate of hydrogen peroxide release from mitochondria (75–150 µg protein) was determined after the addition of glutamate (final concentration 10 mmol/L).

    Protein assay. The protein concentrations of liver and heart preparations used for enzyme assays, electrophoresis, and measurement of hydrogen peroxide release were determined with bichinchoninic acid (BCA Protein Assay Reagent Kit, Pierce). Volumes of samples applied to electrophoresis gels were adjusted on the basis of sample protein concentrations to ensure that 15 µg of protein was applied to each lane.

    Statistics. Values shown in text and figures are means ± SEM. The data were analyzed for significant differences by a one-tailed t test for 2 samples with unequal variance, {alpha} = 0.05. Associations between HO-1 content and mitochondrial enzyme activities were modeled by stepwise multiple regression analysis (SAS/STAT 8.02, SAS Institute).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Rats fed CuD had lower liver copper concentrations and higher iron concentrations than rats fed CuA, viz., 25.6 ± 3.3 vs. 150 ± 3.2 nmol Cu/g dry liver, respectively, and 4.62 ± 0.37 vs. 2.24 ± 0.16 µmol Fe/g dry liver, respectively (P < 0.05). Initial body weights of rats fed CuD and CuA were 81 ± 1 and 81 ± 2 g, respectively. However, final weights of rats fed CuD were lower (P < 0.05) than final weights of rats fed CuA, viz., 302 ± 8 vs. 333 ± 8 g, respectively. Low copper intake caused anemia as indicated by reductions in Hgb concentrations and hematocrits in rats fed CuD compared with those fed CuA, viz. 111 ± 6 vs. 138 ± 1 g Hgb/L, respectively, and 0.34 ± 0.02 vs 0.42 ± 0.01, respectively (P < 0.05). Low copper intake also reduced the amine oxidase activity of ceruloplasmin in serum, viz., 0.03 ± 0.03 U/L in rats fed CuD vs. 60.2 ± 6.7 U/L in rats fed CuA (P < 0.05). These findings all indicate the presence of copper deficiency in rats consuming CuD.

One objective of this investigation was to determine whether copper deficiency affects mitochondrial respiratory complex activities other than CCO. In the present study, CCO activity in mitochondria isolated from livers of copper-deficient rats was 70% lower (P < 0.05) than the activity in mitochondria from copper-adequate controls (Fig. 1A). However, CCO was not the only respiratory complex in hepatic mitochondria affected by copper deficiency. Copper deficiency caused a 42% reduction (P < 0.05) in SucCR activity (Fig. 1B), which represents the combined activities of respiratory complexes II and III, and a 31% (P < 0.05) reduction in NADHCR activity (Fig. 1C), which represents the combined activities of respiratory complexes I and III. These findings indicate that an overall decline in mitochondrial electron transport activity occurs during copper deficiency.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1 Cytochrome c oxidase (A), succinate: cytochrome c reductase (B) and NADH:cytochrome c reductase (C) activities in hepatic mitochondria isolated from rats fed either CuD or CuA. A unit of activity for cytochrome c oxidase is defined as the amount of enzyme that catalyzes the oxidation of 1 nmol of ferrocytochrome c/min at 30°C. A unit of activity for succinate:cytochrome c reductase or NADH:cytochrome c reductase is defined as the amount of enzyme that catalyzes the reduction of 1 nmol of ferricytochrome c/min at 30°C. Bars represent means ± SEM, n = 10. *Lower than in rats fed CuA, P < 0.05 (one-tailed t test).

 
The rate of mitochondrial H2O2 release was measured to determine whether the general decline in respiratory complex activities during copper deficiency stimulated mitochondrial ROS production. In the absence of substrate, H2O2 production by hepatic mitochondria from copper-deficient and control rats was undetectable. However, the addition of glutamate stimulated the release of H2O2 (Fig. 2). Although the rate of H2O2 release was detectable upon the addition of glutamate regardless of the copper status of the rats, the rate of H2O2 release was 49% (P < 0.05) greater from hepatic mitochondria isolated from copper-deficient rats than mitochondria from copper-adequate controls.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2 Rates of hydrogen peroxide release from hepatic mitochondria isolated from rats fed CuD and CuA. Rates of hydrogen peroxide release were measured using glutamate (10 mmol/L) as substrate for the mitochondrial respiratory chain. Bars represent means ± SEM, n = 10. *Higher than in rats fed CuA, P < 0.05 (one-tailed t test).

 
To determine whether the increase in H2O2 production by hepatic mitochondria during copper deficiency has potential for inducing stress proteins, the expression of HO-1 was evaluated by immunoblotting and real-time RT-PCR in the liver of rats fed CuD and CuA. HO-1 was detected on immunoblots of liver protein extracts as a band representing a 30-kDa protein. HO-1 was detectable in livers from copper-deficient and control rats, but the HO-1 content was 48% higher (P < 0.05) in the copper-deficient rats (Fig. 3A). HO-1 mRNA was also 200% higher (P < 0.05) in livers of copper-deficient compared with control rats (Fig. 3B). HO-1 protein and mRNA levels were measured in hearts of copper-deficient and control rats to determine whether induction of HO-1 during copper deficiency could also occur in extra hepatic tissue. The effect of copper deficiency on HO-1 expression in the heart was similar to its effect in liver. HO-1 protein was 85% higher and HO-1 RNA was 95% higher (P < 0.05) in hearts of copper-deficient rats compared with controls (Fig. 4).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3 HO-1 protein content (A) and mRNA expression (B) in livers of rats fed CuD and CuA. Bands above the bars in (A) are representative immunoblots of HO-1, which was detected as a 30-kDa protein. Densities of immunoblot bands were quantified by imaging densitometry. HO-1 protein is expressed as a ratio of HO-1 band density for a sample obtained from a rat in a diet treatment group to HO-1 band density obtained from a liver microsomal standard as described in Materials and Methods. HO-1 mRNA content, measured by real-time PCR, is expressed as the ratio of HO-1 mRNA to PGK-1 mRNA. Bars represent means ± SEM, n = 10. *Higher than in rats fed CuA, P < 0.05 (one-tailed t test).

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4 HO-1 protein content (A) and mRNA expression (B) in hearts of rats fed CuD and CuA. Bands above the bars in (A) are representative immunoblots of HO-1, which was detected as a 30-kDa protein. Densities of immunoblot bands were quantified by imaging densitometry. HO-1 protein is expressed as a ratio of HO-1 band density for a sample obtained from a rat in a diet treatment group to HO-1 band density obtained from a liver microsomal standard as described in Materials and Methods. HO-1 mRNA content, measured by real-time PCR, is expressed as the ratio of HO-1 mRNA to PGK-1 mRNA. Bars represent means ± SEM, n = 10. *Higher than in rats fed CuA, P < 0.05 (one-tailed t test).

 
A mathematical model was developed using stepwise multiple regression analysis to predict hepatic HO-1 content based on the activities of NADHCR, SucCR, and CCO. The regression analysis indicated that the variation in HO-1 across both dietary groups was best described (R2 = 0.54, P < 0.02) by the following equation:

Cytochrome c oxidase activity was not a significant (P > 0.05) predictor of hepatic HO-1 content.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Copper deficiency invariably leads to a decline in CCO activity in a variety of tissues (16,17). Although CCO is a component of the mitochondrial respiratory chain, the decline in CCO activity resulting from copper deficiency has not been clearly linked to defective energy metabolism. For example, 70–90% reductions in CCO activity during copper deficiency either had no effect or only modestly lowered the ATP content of liver, brain, and platelets (2832). Thus, reduced CCO activity most likely does not contribute to the biological consequences of copper deficiency by impairing energy production. However, the inhibition of CCO activity by copper deficiency may reflect a systematic decline in respiratory complex activities that impair electron flow and affect the mitochondrial production of ROS.

In the present study, copper deficiency caused significant reductions in the activities of CCO, NADHCR, and SucCR (Fig. 1). NADHCR activity represents the combined electron transport activities of respiratory complexes I + III, and SucCR activity represents the combined electron transport activity of respiratory complexes II + III. Thus, the reductions in CCO, NADHCR, and SucCR indicate that copper deficiency causes general impairment of the mitochondrial electron transport chain by inhibiting copper-dependent and copper-independent respiratory complexes. Complexes I and III are major sites for mitochondrial ROS generation, and the activities of these complexes are determinants of ROS production (33,34). It was shown that genetic or drug-induced inhibition of complex I in cell models increases mitochondrial ROS production (35). Even a partial 25% inhibition of complex I, which was accompanied by only 5% inhibition of respiration, led to a 48% increase in mitochondrial ROS production. Also, fibroblasts from patients with inherited complex I deficiencies exhibit increased mitochondrial ROS production (36). In the present study, copper deficiency led to a 30% inhibition of NADHCR activity and a 40% inhibition of SucCR activity. The degree of NADHCR and SucCR inhibition we observed is similar to that observed by Davies and co-workers (26) in hepatic mitochondria from rats fed CuD for 8 wk. Although the mechanisms through which copper deficiency exerts its inhibitory effect on respiratory complexes upstream from copper-dependent CCO are not clear, the magnitude of the inhibition of respiratory complex activities caused by copper deficiency is within the range that could increase mitochondrial ROS production.

Superoxide is the primary ROS produced by mitochondria, and the rate of its production depends on the metabolic state of the mitochondria; the highest rate occurs in state 4 when ADP is unavailable and the reduction state of the respiratory chain components is high (37). The superoxide produced by the electron transport chain is readily converted to diffusible and more stable H2O2 by Mn-dependent mitochondrial SOD2 located in the mitochondrial matrix. Thus, it is conceivable that conditions that increase superoxide production by respiratory chain components also lead to increased H2O2 release from mitochondria. In the present study, H2O2 production by hepatic mitochondria was measured in the absence of ADP using glutamate, which is an NADH-linked, complex I substrate. Under these conditions, the mitochondria produced measurable amounts of H2O2, indicating that the electron transport chain was functional in the isolated mitochondria and that the mitochondria were likely in state 4. However, the rate of H2O2 production by hepatic mitochondria was increased by copper deficiency (Fig. 2). To our knowledge, this finding is the first to show that copper deficiency stimulates mitochondrial H2O2 release and suggests that the suppression of respiratory complex activities by copper deficiency leads to increased superoxide production at 1 or more sites in the electron transport chain.

Although mitochondria isolated from livers of copper-deficient rats exhibited elevated rates of H2O2 release, the question is whether the increase in H2O2 release had any intracellular consequences. The ability of H2O2 to stimulate gene expression is well documented (38), and HO was one of the first enzymes shown to be upregulated by H2O2 (39,40). Our study is the first to show that copper deficiency causes the induction of HO-1 in liver and heart. This finding is consistent with a previous report of increased hepatic HO activity in copper-deficient rats (14) and suggests that HO-1 induction is the most likely explanation for the increased HO activity caused by copper deficiency. Induction of HO-1 is controlled at the transcriptional level by regulatory elements localized in the promoter 5'-flanking region of the HO-1 gene (11). In the extensively studied mouse HO-1 gene, 2 enhancer regions, SX2 and AB1, contain multiple copies of a cis-acting element termed the stress response element (StRE) that mediate transcriptional activation in response to a number of agents, including H2O2. The consensus StRE resembles the consensus binding site for the activator protein (AP)-1 superfamily of transcription factors, which have been implicated in the activation of HO-1 gene transcription by ROS (41). In particular, it was shown that Nrf2, a basic leucine zipper protein, is an important transcription factor for HO-1 gene induction (42). Although the exact mechanisms through which copper deficiency causes the elevation of hepatic HO-1 protein and mRNA are not clear, our findings suggest that the increase in H2O2 release from the mitochondria of copper-deficient rats measured in vitro reflects an intracellular condition in which increased mitochondrial H2O2 production may have initiated the activation of AP-1–dependent HO-1 gene transcription. Although sources of ROS other than the mitochondria may also be involved in stimulating the expression of HO-1, results of the regression analysis showing that variations in the activities of NADHCR and SucCR accounted for ~50% of the variation in hepatic HO-1 protein suggest that changes in mitochondrial electron transport chain activity contribute at least partially to the upregulation of HO-1.

The heart is particularly susceptible to oxidative stress during copper deficiency because of its relatively low activities of SOD, catalase, and glutathione peroxidase (43). Thus, our finding that HO-1 protein and mRNA are elevated in hearts of copper-deficient rats (Fig. 4) indicates that the upregulation of HO-1 is not limited to hepatic tissue during copper deficiency, but may be a general response to a shift in redox status associated with copper deficiency in tissues that are susceptible to oxidative stress.

In conclusion, our data indicate that copper deficiency stimulates the gene expression of HO-1 and increases HO-1 protein content in liver and heart. Our findings also suggest that copper deficiency leads to an increase in mitochondrial ROS production through a mechanism that may involve inhibition of respiratory complex activities. Collectively, the results of the present study suggest that the induction of HO-1 during copper deficiency occurs through a series of events in which the respiratory chain is inhibited, causing an increase in mitochondrial generation of H2O2. Release of H2O2 into the cytosol then serves as a signal that stimulates an increase in HO-1 gene expression. Rogers and co-workers (44) suggested recently that ROS may serve as signal transducers in mitochondria-to-nucleus signaling pathways. Although further research is required to establish the exact mechanisms for the induction of stress proteins such as HO-1 during copper deficiency, our results indicate that copper deficiency provides another model in addition to cultured cell models in which genetic, drug, or environmentally induced mitochondrial respiratory chain deficiencies are used to investigate mitochondria-to-nucleus signaling.


    ACKNOWLEDGMENTS
 
The authors thank Steve DuFault for technical assistance and LuAnn Johnson for statistical analysis of the data.


    FOOTNOTES
 
1 Presented in part at Experimental Biology 01,March 31-April 4, 2001, Orlando, FL [Johnson, W. T. (2001) Mitochondrial oxidative stress may contribute to the induction of hepatic heme oxygenase-1 in copper-deficient rats. FASEB J. 15:A271 (abs.)] and at the 11th International Symposium on Trace Elements in Man and Animals, June 2–6, 2002, Berkeley, CA [Johnson, W. T. (2003) Oxidative stress resulting from inhibition of the mitochondrial electron transport chain contributes to the induction of hepatic heme oxygenase-1 in copper deficient rats. J. Nutr. 133: 260E (abs.)]. Back

2 Supported by U.S. Department of Agriculture CRIS Project No. 5450–51000-023. Back

3 The U.S. Department of Agriculture, Agricultural Research Service, Northern Plains Area, is an equal opportunity/affirmative action employer and all agency services are available without discrimination. Back

4 Mention of a trademark or proprietary product does not constitute a guarantee or warranty of the product by the U.S. Department of Agriculture and does not imply its approval to the exclusion of other products that may also be suitable. Back

6 Abbreviations used: AP, activator protein; CCO, cytochrome c oxidase; Ct, threshold cycle; CuA, Cu-adequate diet; CuD, Cu-deficient diet; Hgb, hemoglobin; HO, heme oxygenase; NADHCR, NADH:cytochrome c reductase; PKG, phosphoglycerate kinase-1; ROS, reactive oxygen species; SOD; superoxide dismutase; StRE, stress response element; SucCR, succinate:cytochrome c reductase. Back

Manuscript received 12 January 2004. Initial review completed 30 January 2004. Revision accepted 27 February 2004.


    LITERATURE CITED
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Maines, M. D., Trakshel, G. M. & Kutty, R. K. (1986) Characterization of two constitutive forms of rat liver microsomal heme oxygenase. Only one molecular species of the enzyme is inducible. J. Biol. Chem. 261:411-419.[Abstract/Free Full Text]

2. McCoubrey, W. K., Huang, T. J. & Maines, M. D. (1997) Isolation and characterization of a cDNA from rat brain that encodes hemoprotein heme oxygenase-3. Eur. J. Biochem. 247:725-732.[Medline]

3. Yoshida, T., Biro, P., Cohen, R. M. & Shibahara, S. (1988) Human heme oxygenase cDNA and induction of its mRNA by heme. Eur. J. Biochem. 171:457-461.[Medline]

4. Taketani, S., Kohno, H., Yoshinaga, T. & Tokunaga, R. (1989) The human 32-kDa stress protein induced by exposure to arsenite and cadmium ions is heme oxygenase. FEBS Lett. 245:173-176.[Medline]

5. Morita, T., Perrella, M. A., Lee, M. & Kourembanas, S. (1995) Smooth muscle cell-derived carbon monoxide is a regulator of vascular cGMP. Proc. Natl. Acad. Sci. U.S.A. 92:1475-1479.[Abstract/Free Full Text]

6. Lee, P. J., Alam, J., Sylvester, S. L., Inamdar, N., Otterbein, L. & Choi, A.M.K. (1996) Regulation of heme-oxygenase-1 expression in vivo and in vitro in hyperoxic lung injury. Am. J. Respir. Cell Mol. Biol. 14:556-568.[Abstract]

7. Shibahara, S., Muller, R. M. & Taguchi, H. (1987) Transcriptional control of rat heme oxygenase by heat shock. J. Biol. Chem. 262:12889-12892.[Abstract/Free Full Text]

8. Keyse, S. M. & Tyrrell, R. M. (1989) Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UV radiation, hydrogen peroxide and sodium arsenite. Proc. Natl. Acad. Sci. U.S.A. 86:99-103.[Abstract/Free Full Text]

9. Kutty, R. K., Nagineni, G., Kutty, J. J., Hooks, G. J., Chander, G. J. & Wiggert, B. (1994) Increased expression of heme oxygenase-1 in human retinal pigment epithelial cells by transforming growth factor-beta. J. Cell. Physiol. 159:371-378.[Medline]

10. Cantoni, L., Rossi, C., Rizzardini, M., Gadina, M. & Ghezzi, P. (1991) Interlukin-1 and tumor necrosis factor induce hepatic heme oxygenase. Biochem. J. 279:891-894.

11. Immenschuh, S. & Ramadori, G. (2000) Gene regulation of heme oxygenase-1 as a therapeutic target. Biochem. Pharmacol. 60:1121-1128.[Medline]

12. Otterbein, L. E. & Choi, A.M.K. (2000) Heme oxygenase: colors of defense against cellular stress. Am. J Physiol. 279:L1029-L1037.

13. Poss, K. D. & Tonegwa, S. (1997) Reduced stress defense in heme oxygenase 1-deficient cells. Proc. Natl. Acad. Sci. U.S.A. 94:10925-10930.[Abstract/Free Full Text]

14. Williams, D. M., Burk, R. F., Jenkinson, S. G. & Lawrence, R. A. (1981) Hepatic cytochrome P450 and microsomal heme oxygenase in copper deficient rats. J. Nutr. 111:979-983.

15. Saari, J. T. (2000) Copper deficiency and cardiovascular disease: role of peroxidation, glycation, and nitration. Can. J. Physiol. Pharmacol. 78:848-855.[Medline]

16. Prohaska, J. R. (1991) Changes in Cu-Zn-superoxide dismutase, cytochrome c oxidase, glutathione peroxidase and glutathione transferase activities in copper-deficient mice and rats. J. Nutr. 121:355-363.

17. Johnson, W. T., Dufault, S. N. & Thomas, A. C. (1993) Platelet cytochrome c oxidase as an indicator of copper status in rats. Nutr. Res. 13:1153-1162.

18. Freeman, B. A. & Crapo, J. D. (1982) Biology of disease-free radicals and tissue injury. Lab. Investig. 47:412-426.[Medline]

19. Raha, S. & Robinson, B. H. (2001) Mitochondria, oxygen free radicals, and apoptosis. Am. J. Med. Genet. 106:62-70.[Medline]

20. Sohal, R. S. (1993) Aging, cytochrome c oxidase activity, and hydrogen peroxide release by mitochondria. Free Radic. Biol. Med. 14:583-588.[Medline]

21. Reeves, P. G., Nielsen, F. H. & Fahey, G. C., Jr (1993) AIN-93 purified diets for laboratory rodents: final report of the American Institute ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J. Nutr. 123:1939-1951.

22. Johnson, W. T. & Kramer, T. R. (1987) Effect of copper deficiency on erythrocyte membrane proteins of rats. J. Nutr. 117:1085-1090.

23. Schosinsky, K. H., Lehmann, H. P. & Beeler, M. F. (1974) Measurement of ceruloplasmin from its oxidase activity in serum by use of o-dianisidine dihydrochloride. Clin. Chem. 20:1556-1563.[Abstract]

24. Sambrook, J. & Russell, D. W. (2001) Purification of RNA from cells and tissues by acid phenol-guanidinium thiocyanate-chloroform extraction. Molecular Cloning: A Laboratory Manual, Volume 1 3rd ed. 2001:7.4-7.8 Cold Spring Harbor Laboratory Press Coldspring Harbor, NY.

25. Winer, J., Jung, C.K.S., Shackel, I. & Williams, P. M. (1999) Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270:41-49.[Medline]

26. Davies, N. T., Lawrence, C. B. & Mills, C. F. (1985) Studies on the effects of copper deficiency on rat liver mitochondria. II. Effects on oxidative phosphorylation. Biochim. Biophys. Acta 809:362-368.[Medline]

27. Hyslop, P. A. & Sklar, L. A. (1984) A quantitative fluorimetric assay for the determination of oxidant production by polymorphonuclear leukocytes: its use in the simultaneous fluorimetric assay of cellular activation processes. Anal. Biochem. 141:280-286.[Medline]

28. Gallagher, C. H. & Reeve, V. E. (1971) Copper deficiency in the rat: effect on adenine nucleotide metabolism. Aust. J. Biol. Med. Sci. 49:445-451.

29. Prohaska, J. R. & Wells, W. W. (1975) Copper deficiency in the developing rat brain: evidence for abnormal mitochondria. J. Neurochem. 25:221-228.[Medline]

30. Kopp, S. J., Klevay, L. M. & Feliksik, J. M. (1983) Physiological and metabolic characterization of a cardiomyopathy induced by chronic copper deficiency. Am. J. Physiol. 245:H855-H866.

31. Rusinko, N. & Prohaska, J. R. (1985) Adenine nucleotide and lactate levels in organs from copper-deficient and brindled mice. J. Nutr. 115:936-943.

32. Johnson, W. T., Dufault, S. N. & Newman, S. M., Jr (1995) Altered nucleotide content and changes in mitochondrial energy states associated with copper deficiency in rat platelets. J. Nutr. Biochem. 6:551-556.

33. Raha, S. & Robinson, B. H. (2000) Mitochondria, oxygen free radicals and ageing. Trends Biochem. Sci. 25:502-508.[Medline]

34. Lenaz, G. (2001) The mitochondrial production of reactive oxygen species: mechanisms and implications in human pathology. IUBMB Life 52:159-164.[Medline]

35. Barrientos, A. & Moraes, C. T. (1999) Titrating the effects of mitochondrial complex I impairment in the cell physiology. J. Biol. Chem. 274:16188-16197.[Abstract/Free Full Text]

36. Pitkänen, S. & Robinson, B. H. (1966) Mitochondrial complex I deficiency leads to increased production of superoxide radicals and induction of superoxide dismutase. J. Clin. Investig. 98:345-351.

37. Cadenas, E. & Davies, K.J.A. (2000) Mitochondrial free radical generation, oxidative stress, and aging. Free Radic. Biol. Med. 29:222-230.[Medline]

38. Allen, R. G. & Tresini, M. (2000) Oxidative stress and gene regulation. Free Radic. Biol. Med. 28:463-499.[Medline]

39. Keyse, S. M. & Tyrrell, R. M. (1987) Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts. J. Biol. Chem. 262:14821-14825.[Abstract/Free Full Text]

40. Applegate, L. A., Luscher, P. & Tyrrell, R. M. (1991) Induction of heme oxygenase: a general response to oxidant stress in cultured mammalian cells. Cancer Res. 51:974-978.[Abstract/Free Full Text]

41. Camhi, S. L., Alam, J., Wiegand, G. W., Chin, B. Y. & Choi, A.M.K. (1998) Transcriptional activation of the HO-1 gene by lipopolysaccharide is mediated by 5' distal enhancers: role of reactive oxygen intermediates and AP-1. Am. J. Respir. Cell Mol. Biol. 18:226-234.[Abstract/Free Full Text]

42. Alam, J., Stewart, D., Touchard, C., Boinapally, S., Choi, A.M.K. & Cook, J. L. (1999) Nrf2, a cap’n’collar transcription factor, regulates induction of the heme oxygenase-1 gene. J. Biol. Chem. 274:26071-26078.[Abstract/Free Full Text]

43. Chen, Y., Saari, J. T. & Kang, Y. J. (1994) Weak antioxidant defenses make the heart a target for damage in copper-deficient rats. Free Radic. Biol. Med. 17:529-536.[Medline]

44. Rogers, R. J., Monnier, J. M. & Nick, H. S. (2001) Tumor necrosis factor-{alpha} selectively induces MnSOD expression via mitochondria-to-nucleus signaling, whereas interleukin-1ß utilizes an alternative pathway. J. Biol. Chem. 276:20419-20427.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Nutr.Home page
A. D. Smith, S. Botero, and O. A. Levander
Copper Deficiency Increases the Virulence of Amyocarditic and Myocarditic Strains of Coxsackievirus B3 in Mice
J. Nutr., May 1, 2008; 138(5): 849 - 855.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Zeng, J. T. Saari, and W. T. Johnson
Copper Deficiency Decreases Complex IV but Not Complex I, II, III, or V in the Mitochondrial Respiratory Chain in Rat Heart
J. Nutr., January 1, 2007; 137(1): 14 - 18.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. N. Ames
Low micronutrient intake may accelerate the degenerative diseases of aging through allocation of scarce micronutrients by triage
PNAS, November 21, 2006; 103(47): 17589 - 17594.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnson, W. T.
Right arrow Articles by DeMars, L. C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnson, W. T.
Right arrow Articles by DeMars, L. C. S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2004 by American Society for Nutrition