Journal of Nutrition Animal Diets/Enrichment Products...

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reiterer, G.
Right arrow Articles by Hennig, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reiterer, G.
Right arrow Articles by Hennig, B.
© 2004 The American Society for Nutritional Sciences J. Nutr. 134:771-775, April 2004


Nutrient-Gene Interactions

Quercetin Protects Against Linoleic Acid-Induced Porcine Endothelial Cell Dysfunction1

Gudrun Reiterer*, Michal Toborek{dagger} and Bernhard Hennig*,**,2

* Graduate Center for Nutritional Sciences, Department of {dagger} Surgery and ** Molecular and Cell Nutrition Laboratory, College of Agriculture, University of Kentucky, Lexington, KY 40546-0215

2To whom correspondence should be addressed. E-mail: bhennig{at}uky.edu.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Consumption of plant phenolics, such as quercetin, may be associated with decreased risk of cardiovascular disease by stabilizing and protecting vascular endothelial cells against oxidative and proinflammatory insults. The present study focused on the effect of quercetin on linoleic acid–induced oxidative stress and the inflammatory pathways of nuclear factor-{kappa}B (NF-{kappa}B) and activator protein-1 (AP-1). Because the transcription factor peroxisome proliferator activated receptor {gamma} (PPAR{gamma}) was reported to downregulate inflammatory pathways, we further investigated the effect of quercetin on PPAR{gamma}. Porcine pulmonary-arterial endothelial cells were activated with linoleic acid in the presence or absence of quercetin. Oxidative stress was markedly induced by endothelial cell exposure to linoleic acid and diminished by treatment with quercetin as measured via the oxidation of 2',7'-dichlorofluorescin. Quercetin reduced linoleic acid–mediated binding activity of NF-{kappa}B and AP-1 and mRNA levels of inflammatory genes such as interleukin-6 (IL-6) and vascular cell adhesion molecule-1 (VCAM-1). Cotreatment of linoleic acid plus quercetin or vitamin E also decreased linoleic acid–induced binding activity of PPAR{gamma}. These data suggest that quercetin has potent antioxidative and anti-inflammatory properties and protects endothelial cells against linoleic acid–mediated cell dysfunction.


KEY WORDS: • atherosclerosis • fatty acids • quercetin • PPAR

Atherosclerotic lesions are thought to be initiated by vascular endothelial cell dysfunction. A damaged endothelium is less effective as a selectively permeable barrier to plasma components (1,2). The endothelium interacts with the blood and underlying tissues, serves as both a pro- and antithrombotic surface, and releases regulatory factors important in modulating vascular tone. Factors implicated in the pathogenesis of atherosclerosis include chronic and cumulative metabolic alterations of the endothelium induced by numerous activating molecules, such as certain lipids, prooxidants, and inflammatory cytokines. These risk factors may contribute to an overall cellular imbalance of the oxidative stress/antioxidant balance, thus leading to chronic activation of the endothelium and alterations of the endothelial barrier function, which can result in accelerated uptake of cholesterol-rich lipoproteins into the vessel wall.

After consumption of high-energy foods, triglyceride-rich lipoproteins are elevated, and hydrolysis of triglycerides by lipoprotein lipase occurs in proximity to the endothelial surface (3). An excessive local concentration of fatty acid anions may cause endothelial injury and therefore initiate the onset of atherosclerosis. PUFA are more susceptible to lipid peroxidation than SFA, in particular when insufficiently protected by antioxidants. Thus, if oxidative stress is a critical underlying parameter of atherosclerosis (4), then high serum PUFA concentrations may indicate a higher risk of atherosclerosis (5).

Antioxidants, such as vitamin E, can significantly reduce the linoleic acid–mediated endothelial cell activation and loss of endothelial integrity (6). Quercetin, like other polyphenolics, possesses high antioxidant abilities to inhibit free radical processes in cells (7), including the prevention of lipid peroxidation (8).

Numerous oxidative stress-sensitive transcription factors, such as nuclear factor-{kappa}B (NF-{kappa}B)3 and activator protein-1 (AP-1) (9) can mediate an inflammatory response due to oxidative stress by inducing gene transcription of adhesion molecules and cytokines such as vascular cell adhesion molecule-1 (VCAM-1) and interleukin-6 (IL-6). Antioxidants such as quercetin could protect plasma lipids from oxidation, thereby preventing the induction of inflammatory events. Thus, quercetin could help maintain the integrity of the endothelium.

There is increasing evidence that peroxisome proliferator activated receptors (PPARs) can modulate inflammatory events and are thus antiatherogenic (10). For example, PPAR{gamma} can interfere negatively with NF-{kappa}B, signal transducer and activator of transcription (STAT), and AP-1 signaling pathways (11,12). This could be by preventing transcription factors from binding to their target sequences (12,13), possibly through an interaction with a subunit of the transcription factors (e.g., p65) (12). Because most of the proinflammatory genes are under the control of the AP-1 and NF-{kappa}B signaling pathways, and because PPARs can counterregulate a wide spectrum of proinflammatory genes, anti-inflammatory compounds may act through PPAR signaling. The binding pockets of PPARs are open to a variety of naturally occurring lipid-like substances acting as low-affinity ligands (14). Because quercetin is a lipophilic, polyphenolic substance with a chemical structure that could potentially fit the binding pocket of PPARs, we investigated whether the anti-inflammatory properties of quercetin could be through the activation of PPAR{gamma}.

In this study we aimed to demonstrate that quercetin has endothelium-protective effects by preventing linoleic acid–induced oxidative stress formation and by decreasing the activation of oxidant-sensitive pathways.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Cell culture and experimental media. Endothelial cells were isolated from porcine pulmonary arteries as described previously (15). Tissues obtained during routine slaughters were donated by the College of Agriculture, University of Kentucky. Cells were subcultured in medium 199 (M-199) containing 10% (v:v) fetal bovine serum (FBS, HyClone Laboratories) using standard techniques.

The experimental media were composed of M-199 enriched with 5% (v:v) FBS and fatty acids (90 µmol/L). Fatty acids (>99% pure) were obtained from Nu-Chek-Prep. Preparations of experimental media with fatty acids were made as described previously (16). Thus, fatty acids were introduced into the media bound to serum albumin. Quercetin (10–50 µmol/L) and vitamin E (25 µmol/L) were added from stock solutions in dimethylsulfoxide (DMSO) and ethanol, respectively. Controls and fatty acid groups not treated with quercetin or vitamin E contained an equal amount of DMSO or ethanol. The final DMSO concentration in the media never exceeded 0.05% (v:v) in all treatment groups. For most experimental settings, cells were treated with quercetin and fatty acids for 6 h. Vitamin E was added 18 h before fatty acid treatment.

    Measurement of oxidative stress. Cellular oxidation was determined by 2',7'-dichlorofluorescein (DCF) fluorescence as described by Mattson et al. (17). This measurement of cell oxidation utilizes an imaging technique based on the conversion of 2',7'-dichlorofluorescin into fluorescent 2',7'-dichlorofluorescein as a result of activation with reactive oxygen species (ROS), primarily peroxyl radicals and peroxides. After treatment of endothelial cells with linoleic acid for 6 h, cells were loaded with 100 µmol/L 2,7-dichlorofluorescin diacetate (Molecular Probes) by incubation for 30 min. Before analysis for oxidative stress, cells were washed 3 times in HEPES buffer. In experiments utilizing H2O2 as an inducer of oxidative stress, 0.1 mmol/L H2O2 in HEPES buffer was applied to cells after DCF-staining. Imaging studies employed a multiwell fluorescent plate reader (Molecular Devices). The dye was excited at 490 nm, and emission was filtered using a 510-nm barrier filter.

    Transcription factor (NF-{kappa}B, AP-1, and PPAR{gamma}) activation studies: electrophoretic mobility shift assay (EMSA). Nuclear extracts containing active proteins were prepared from cells according to the method of Dignam et al. (18). Nuclear extracts were incubated for 25 min with 32P-end-labeled oligonucleotide probes containing enhancer DNA element NF-{kappa}B (5' AGTTGAGGGGACTTTCCCAGGC 3'), AP-1 (5' CGCTTGATGAGTCAGCCGGAA 3') (Promega) or PPAR{gamma} (5' AGGTCAAAGGTCA 3') (Santa Cruz). Incubation at room temperature was performed in the presence of nonspecific competitor DNA. After binding, the complexed and uncomplexed DNA in the mixture were resolved by electrophoresis in a 6.5% (wt:v) nondenaturing polyacrylamide gel and visualized by autoradiography. Control reactions using a 200-fold molar excess of unlabeled oligonucleotide probes or a supershift assay were performed to demonstrate the specificity of the shifted DNA-protein complexes for NF-{kappa}B, PPAR{gamma} and AP-1, respectively.

    Il-6 and VCAM-1 expression studies. Total RNA was extracted from endothelial cells by the use of TRI reagent (Sigma) according to the manufacturer’s protocol. Gene expression was determined through RT-PCR as described earlier (19). The following primers were employed in the PCRs; IL-6 forward: 5' AAT TCG GTA CAT CCT CGA CG 3', reverse: 5' GCG CAG AAT GAG ATG AGT TG 3', VCAM-1 forward: 5' ATGACA TGC TTG AGC CAG G 3', reverse: 5' GTG TCT CCT TCT TTG ACA CT 3', ß-actin forward: 5' GGG ACC TGA CCG ACT ACC TC3', reverse: 5' GGG CGA TGA TCT TGA TCT TC3'. The amplified PCR products were electrophoresed on a 2% (wt:v) tris-borate EDTA agarose gel, stained with SYBR Gold (Molecular Probes) and visualized by using phosphorimaging technology (FLA-5000; Fuji).

    Statistical analysis. The data were quantified and analyzed using the Scion Image and Sigma Stat software, respectively. Comparisons between treatments were made by 1- or 2-way ANOVA with post-hoc comparisons of the means made by Tukey’s tests. A statistical probability of P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
    Quercetin attenuates linoleic acid and H2O2-induced oxidative stress. Quercetin dose dependently reduced oxidative stress when cells were cotreated with 90 µmol/L linoleic acid and 10, 25, or 50 µmol/L quercetin for 6 h. Significant effects were observed at 25 and 50 µmol/L quercetin (Fig. 1A). Similar effects were obtained in endothelial cells exposed to 0.1 mmol/L H2O2 for up to 60 min (Fig. 1B). Quercetin at 25 and 50 µmol/L significantly reduced the generation of free radicals. Increasing the concentration of quercetin to 50 µmol/L did not increase protection against free radical formation compared with 25 µmol/L quercetin.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1 Fatty acid– (A) and H2O2- (B) induced oxidative stress in primary endothelial cells. Cells were grown in 24-well plates, exposed to 90 µmol/L fatty acid and/or various concentrations of quercetin for 6 h. Oxidative stress was determined spectrometrically by measuring the conversion of dichlorofluorescin to dichlorofluorescein. Q, quercetin; L, linoleic acid; H, H2O2; concentrations in µmol/L. Values are means ± SEM, n = 3. *Different from the control, P < 0.05; #linoleic acid + quercetin (L + Q) and H2O2 + quercetin (H + Q) different from linoleic acid (L), P < 0.05.

 
    Quercetin decreases linoleic acid–induced binding activity of NF-{kappa}B and AP-1. Linoleic acid increased the DNA binding activity of both transcription factors NF-{kappa}B and AP-1 as determined by EMSA. Cotreatment of quercetin and linoleic acid for 6 h downregulated the activation of NF-{kappa}B and AP-1 (Figs. 2A and B, respectively). Consistent with the observations made in measuring oxidative stress, 25 µmol/L appeared to be the most effective concentration of quercetin with no additional benefit of higher concentrations to downregulate NF-{kappa}B (Fig. 2A). Maximal downregulation of linoleic acid–induced AP-1 binding activity already occurred at 10 µmol/L quercetin (Fig. 2B).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2 Fatty acid–induced NF-{kappa}B (A) and AP-1 (B) binding activity in endothelial cells. Primary endothelial cells were cotreated with 90 µmol/L linoleic acid and 10, 25, or 50 µmol/L quercetin for 6 h. The binding activity of the transcription factors was determined by EMSA. Q, quercetin; L, linoleic acid; concentrations in µmol/L. Values are means ± SEM, n = 3. *Different from the control, P < 0.05; #linoleic acid + quercetin (L + Q) different from linoleic acid (L), P < 0.05.

 
    Quercetin protects against linoleic acid–induced IL-6 and VCAM-1 gene expression. VCAM-1 expression was upregulated after a 6-h exposure to linoleic acid (Fig. 3A), and coexposure to quercetin protected against this effect. The quercetin-induced decrease in VCAM-1 gene expression was concentration dependent, with complete blockage of linoleic acid–induced gene expression in the presence of 25 µmol/L quercetin (Fig. 3A).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 3 Effects of linoleic acid and quercetin on VCAM-1 (A) and IL-6 (B) mRNA levels in endothelial cells as measured by RT-PCR. Endothelial cells were exposed to linoleic acid and/or quercetin for 6 h. ß-Actin was used as a housekeeping gene. Q, quercetin; L, linoleic acid; concentrations in µmol/L. Values are means ± SEM, n = 3. *Different from the control, P < 0.05; #linoleic acid + quercetin (L + Q) different from linoleic acid (L), P < 0.05.

 
Cytokine IL-6 expression was upregulated in response to linoleic acid treatment (Fig. 3B). Quercetin was less potent in downregulating IL-6 mRNA compared with the effects seen in the downregulation of NF-{kappa}B and AP-1 binding activity or VCAM-1 mRNA. Indeed, quercetin was effective only when applied at higher concentrations (50 µmol/L).

    Quercetin and vitamin E decrease linoleic acid–induced PPAR{gamma} binding activity. PPAR{gamma} protects cells against proinflammatory and prooxidative insults, and linoleic acid is a natural ligand for this transcription factor. Therefore, the effects of linoleic acid and/or quercetin on PPAR{gamma} DNA binding activity were assessed in the present study. Exposure to linoleic acid for 6 h markedly induced PPAR{gamma} activity (Figs. 4A and B). Although quercetin alone did not affect binding of this transcription factor, it diminished PPAR{gamma} activation in cells cotreated with linoleic acid. To assess whether the effects of quercetin on activation of PPAR{gamma} were specific, cells were pretreated with another antioxidant, vitamin E (25 µmol/L for 18 h) and treated with linoleic acid for 6 h. Similar to the effects exerted by quercetin, vitamin E also protected against linoleic acid–induced binding activity of PPAR{gamma} (Fig. 4B).



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 4 Effects of linoleic acid, quercetin (A) and vitamin E (B) on PPAR{gamma} activity in endothelial cells. Primary endothelial cells were cotreated with 90 µmol/L linoleic acid and 10, 25, or 50 µmol/L quercetin for 6 h or pretreated with 25 µmol/L vitamin E 18 h before fatty acid treatment. The binding activity of the transcription factor was determined by EMSA. Q, quercetin; L, linoleic acid; concentrations in µmol/L. Values are means ± SEM, n = 3. *Different from the control, P < 0.05; #linoleic acid + quercetin (L + Q) different from linoleic acid (L), P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Foods rich in plant phenolics may be associated with a decreased risk of atherosclerosis by protecting vascular endothelial cells against proinflammatory lipids. In the present study, we demonstrated an overall antioxidant and anti-inflammatory effect of quercetin. We reported earlier (20) that linoleic acid markedly increases oxidative stress in cultured endothelial cells as measured by DCF fluorescence. Here we show that cotreatment with quercetin significantly inhibits the formation of ROS after treating endothelial cells with linoleic acid. The reduction in the generation of ROS is likely due to a direct scavenging effect of quercetin. The chemical structure of quercetin allows the prediction of antioxidant properties of this molecule. It has been suggested that quercetin becomes oxidized to a semiquinone and quinine (21) while neutralizing ROS. Both the semiquinone and the quinine could be regenerated by glutathione and vitamins E and C (21). Therefore, quercetin could be a valuable contributor to the cellular oxidant defense system. On the other hand, when applied in high concentrations and for long incubation times, quercetin was shown to exhibit prooxidant effects, as reported by others (21,22); we observed this also upon extended treatment with high levels of this phenolic compound (data not shown). As a consequence, the antioxidant capacities of quercetin have been challenged. However, a prooxidant effect of quercetin in vivo seems to be unlikely because plasma quercetin levels do not reach concentrations that induce oxidative stress in in vitro experiments (23).

The antioxidant properties of quercetin also could be responsible in part for the anti-inflammatory effects observed in the present study. We showed that quercetin can downregulate the linoleic acid–induced activation of both NF-{kappa}B and AP-1. These are oxidative stress–sensitive transcription factors that can therefore be modified by oxidants and antioxidants. The precise way in which linoleic acid induces an inflammatory response in endothelial cells is not clear. However, oxidation products of linoleic acid might be directly involved in the activation of NF-{kappa}B. Lipid peroxides rather than H2O2 were suggested to mediate the activation of NF-{kappa}B in response to oxidative stress (24). It is possible that lipid metabolites and derivatives, including oxidized fatty acids, can induce the inflammation, in addition to the native linoleic acid itself. Furthermore, quercetin was suggested to suppress inhibitory I{kappa}B kinase (25) and c-Jun kinase (26), which subsequently could lead to suppression of NF-{kappa}B and AP-1 activation. Activation of NF-{kappa}B leads to expression of inflammatory cytokines and adhesion molecules, resulting in recruitment of monocytes and accelerated development of atherosclerosis (27). Because most of the proinflammatory genes are under the control of the AP-1 and NF-{kappa}B signaling pathways (28) and quercetin can counterregulate these pathways, the potent anti-inflammatory properties of quercetin are clearly demonstrated. In support of its anti-inflammatory properties, we showed that quercetin can block the linoleic acid–induced expression of both VCAM-1 and IL-6, a downstream event of NF-{kappa}B activation (29).

Because PPAR{gamma} can interfere negatively with NF-{kappa}B, STAT, and AP-1 signaling pathways (11,12), we further investigated whether quercetin can affect PPAR{gamma} binding activity. Even though both PPAR{alpha} and PPAR{gamma} were reported to be anti-inflammatory and antiatherogenic, PPAR{alpha} is involved in lipid metabolism and could therefore be activated independently of fatty acid modification by oxidation. Thus, the present study focuses on PPAR{gamma}. Although quercetin has a chemical structure that could potentially be a ligand for PPAR{gamma}, exposure to quercetin alone did not activate this transcription factor. Consistent with the known overall effects of fatty acids on PPAR{gamma} activation, treatment with linoleic acid induced PPAR{gamma} binding activity in endothelial cells. However, cotreatment with quercetin markedly downregulated linoleic acid–induced PPAR{gamma} activation. These results are consistent with earlier reports showing that quercetin can mediate downregulation of PPAR{gamma} in transiently transfected macrophages (30) and in murine epidermal keratinocytes (31). Because linoleic acid can induce oxidative stress and inflammation and at the same time activate PPAR, we suspected that lipid oxidation is involved in activating the PPAR pathway. To further address the question whether the decreased PPAR{gamma} activation observed in the present study is specific for quercetin, endothelial cells were treated with another antioxidant (vitamin E) followed by exposure to linoleic acid. Vitamin E also prevented the linoleic acid–mediated activation of PPAR{gamma}. These data suggest that quercetin can reduce the linoleic acid–mediated activation of PPAR{gamma} due to its antioxidant effect and the prevention of lipid oxidation. Previous studies indicated that oxidized products of linoleic acid are good ligands for PPARs (32). Quercetin may act as an antioxidant; thus the decreased formation of oxidized products of linoleic acid might be a reason for the lower binding of linoleic acid to PPAR{gamma} in the presence of quercetin.

These data suggest that the quercetin-mediated protection observed against linoleic acid–induced endothelial cell activation is independent of PPAR{gamma} signaling. In addition, it appears that the diminished PPAR{gamma} DNA binding activity observed in cells exposed to linoleic acid plus quercetin may be related to a general antioxidant effect of this polyphenolic. Indeed, PPARs may act as critical rescue molecules by downregulating oxidative stress–sensitive and inflammatory signaling pathways. In cells that are protected by antioxidants such as quercetin and vitamin E, oxidative stress–sensitive pathways, including PPAR{gamma}, are less likely to become activated.

Overall, our data suggest that quercetin is a potent antioxidant and anti-inflammatory substance, which can protect the endothelium against oxidative stress and inflammatory events, despite downregulation of PPAR{gamma} activation. Specifically, quercetin inhibited linoleic acid–induced activation of oxidative stress–sensitive pathways, such as NF-{kappa}B and AP-1, and inflammatory genes, such as VCAM-1 and IL-6. These data support the hypothesis that plant phenolics such as quercetin can help prevent the development of atherosclerosis by downregulating the expression of inflammatory cytokines and adhesion molecules.


    FOOTNOTES
 
1 Supported in part by grants from National Institute of Environmental Health Sciences/National Institutes of Health (ES 07380), U.S. Department of Agriculture/National Resources Institute (2001-35200-10675), and the Kentucky Agricultural Experimental Station. G.R. is a recipient of an American Heart Association predoctoral fellowship. Back

3 Abbreviations used: AP-1, activator protein-1; DCF, 2',7'-dichlorofluorescein; DMSO, dimethylsulfoxide; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; IL-6, interleukin-6; NF-{kappa}B, nuclear factor-{kappa}B; PPAR, peroxisome proliferator activated receptor; ROS, reactive oxygen species; STAT, signal transducer and activator of transcription; VCAM-1, vascular cell adhesion molecule-1. Back

Manuscript received 9 October 2003. Initial review completed 11 November 2003. Revision accepted 11 January 2004.


    LITERATURE CITED
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Flarahan, N. A. (1992) Atherosclerosis or lipoprotein-induced endothelial dysfunction. Circulation 85:1927-1938.[Free Full Text]

2. Ross, R. (1999) Atherosclerosis is an inflammatory disease. Am. Heart J. 138:S419-S420.[Medline]

3. Zilversmit, S. B. (1979) Atherogenesis: a postprandial phenomenon. Circulation 60:473-485.[Abstract/Free Full Text]

4. Steinberg, D. & Witztum, J. L. (2002) Is the oxidative modification hypothesis relevant to human atherosclerosis? Do the antioxidant trials conducted to date refute the hypothesis?. Circulation 105:2107-2111.[Free Full Text]

5. Kok, F. J., van Poppel, G., Melse, J., Verheul, E., Schouten, E. G., Kruyssen, D. H. & Hofman, A. (1991) Do antioxidants and polyunsaturated fatty acids have a combined association with coronary atherosclerosis?. Atherosclerosis 86:85-90.[Medline]

6. Hennig, B., Toborek, M., Joshi-Barve, S., Barger, S. W., Barve, S., Mattson, M. P. & McClain, C. J. (1996) Linoleic acid activates nuclear transcription factor-kappa B (NF-kappa B) and induces NF-kappa B-dependent transcription in cultured endothelial cells. Am. J. Clin. Nutr. 63:322-328.[Abstract/Free Full Text]

7. Lee, J. Y., Chang, E. J., Kim, H. J., Park, J. H. & Choi, S. W. (2002) Antioxidative flavonoids from leaves of Carthamus tinctorius. Arch. Pharm. Res. 25:313-319.[Medline]

8. Heijnen, C. G., Haenen, G. R., Oostveen, R. M., Stalpers, E. M. & Bast, A. (2002) Protection of flavonoids against lipid peroxidation: the structure activity relationship revisited. Free Radic. Res. 36:575-581.[Medline]

9. Turpaev, K. T. (2002) Reactive oxygen species and regulation of gene expression. Biochemistry 67:281-292.[Medline]

10. Takano, H. & Komuro, I. (2002) Roles of peroxisome proliferator-activated receptor gamma in cardiovascular disease. J. Diabet. Complicat. 16:108-114.

11. Zhou, Y. C. & Waxman, D. J. (1999) Cross-talk between janus kinase-signal transducer activator of transcription (JAK-STAT) and peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) signaling pathways. J. Biol. Chem. 274:2672-2681.[Abstract/Free Full Text]

12. Delerive, P., Martin-Nizard, F., Chinetti, G., Trottein, F., Fruchart, J. C. & Duriez, P. (1999) PPAR activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the AP-1 signaling pathway. Circ. Res. 85:394-402.[Abstract/Free Full Text]

13. Marx, N., Sukhova, G., Collins, T., Libby, P. & Plutzky, J. (1999) PPAR{alpha} activators inhibit cytokine-induced vascular cell adhesion molecule-1 expression in human endothelial cells. Circulation 99:3125-3131.[Abstract/Free Full Text]

14. Van Bilsen, M., Van der Vusse, G. J., Gilde, A. J., Lindhout, M. & Van der Lee, K. A. (2002) Peroxisome proliferator-activated receptors: lipid binding proteins controlling gene expression. Mol. Cell Biochem. 239:131-138.[Medline]

15. Hennig, B., Shasby, D. M., Fulton, A. B. & Spector, A. A. (1984) Exposure to free fatty acid increases the transfer of albumin across cultured endothelial monolayers. Arteriosclerosis 4:489-497.[Abstract/Free Full Text]

16. Toborek, M., Lee, Y. W., Kaiser, S. & Hennig, B. (2002) Measurement of inflammatory properties of fatty acids in human endothelial cells. Methods Enzymol 352:198-219.[Medline]

17. Mattson, M. P., Barger, S. W., Begley, J. G. & Mark, R. J. (1995) Calcium, free radicals, and excitotoxic neuronal death in primary cell culture. Methods Cell Biol 46:187-216.[Medline]

18. Dignam, J. D., Martin, P. L., Shastry, B. S. & Roeder, R. G. (1993) Eukaryotic gene transcription with purified components. Methods Enzymol 101:582-598.

19. Lee, Y. W., Kuhn, H., Hennig, B., Neish, A. S. & Toborek, M. (2001) IL-4 induced oxidative stress upregulates VCAM-1 gene expression in human endothelial cells. J. Mol. Cell Cardiol. 33:83-94.[Medline]

20. Hennig, B., Meerarani, P., Ramadass, P., Watkins, B. A. & Toborek, M. (2000) Fatty acid–mediated activation of vascular endothelial cells. Metabolism 49:1006-1013.[Medline]

21. Metodiewa, D., Jaiswal, A. K., Cenas, N., Dickancaite, E. & Segura-Aguilar, J. (1999) Quercetin may act as a cytotoxic prooxidant after its metabolic activation to semiquinone and quinoidal product. Free Radic. Biol. Med. 26:107-116.[Medline]

22. Long, L. H., Clement, M. V. & Halliwell, B. (2000) Artifacts in cell culture: rapid generation of hydrogen peroxide on addition of (-)-epigallocatechin, (-)-epigallocatechin gallate, (+)-catechin, and quercetin to commonly used cell culture media. Biochem. Biophys. Res. Commun. 273:50-53.[Medline]

23. Hollman, P. C. & Katan, M. B. (1997) Absorption, metabolism and health effects of dietary flavonoids in man. Biomed. Pharmacother. 51:305-310.[Medline]

24. Bowie, A. & O’Neill, L.A.J. (2000) Oxidative stress and nuclear factor-kappaB activation: a reassessment of the evidence in the light of recent discoveries. Biochem. Pharmacol. 59:13-23.[Medline]

25. Peet, G. W. & Li, J. (1999) IkappaB kinases alpha and beta show a random sequential kinetic mechanism and are inhibited by staurosporine and quercetin. J. Biol. Chem. 274:32655-32661.[Abstract/Free Full Text]

26. Yoshizumi, M., Tsuchiya, K., Suzaki, Y., Kirima, K., Kyaw, M. & Moon, J. H. (2002) Quercetin glucuronide prevents VSMC hypertrophy by angiotensin II via the inhibition of JNK and AP-1 signaling pathway. Biochem. Biophys. Res. Commun. 293:1458-1465.[Medline]

27. Sluiter, W., Pietersma, A., Lamers, J. M. & Koster, J. F. (1993) Leukocyte adhesion molecules on the vascular endothelium: their role in the pathogenesis of cardiovascular disease and the mechanisms underlying their expression. J. Cardiovasc. Pharmacol. 22:S37-S44.

28. Valen, G., Yan, Z. Q. & Hansson, G. K. (2001) Nuclear factor kappa-B and the heart. J. Am. Coll. Cardiol. 38:307-314.[Abstract/Free Full Text]

29. Li, X. & Stark, G. R. (2002) NFkappaB-dependent signaling pathways. Exp. Hematol. 4:285-258.

30. Liang, Y. C., Tsai, S. H., Tsai, D. C., Lin-Shiau, S. Y. & Lin, J. K. (2001) Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-gamma by flavonoids in mouse macrophages. FEBS Lett 496:12-18.[Medline]

31. Thuillier, P., Brash, A. R., Kehrer, J. P., Stimmel, J. B., Leesnitzer, L. M., Yang, P., Newman, R. A. & Fischer, S. M. (2002) Inhibition of PPAR-mediated keratinocyte differentiation by lipoxygenase inhibitors. Biochem. J. 366:901-910.[Medline]

32. Bull, A. W., Steffensen, K. R., Leers, J. & Rafter, J. J. (2003) Activation of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gamma. Carcinogenesis 24:1717-1722.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
S. Sarada, P. Himadri, C. Mishra, P. Geetali, M. S. Ram, and G. Ilavazhagan
Role of Oxidative Stress and NFkB in Hypoxia-Induced Pulmonary Edema
Experimental Biology and Medicine, September 1, 2008; 233(9): 1088 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z. Ungvari, Z. Orosz, A. Rivera, N. Labinskyy, Z. Xiangmin, S. Olson, A. Podlutsky, and A. Csiszar
Resveratrol increases vascular oxidative stress resistance
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2417 - H2424.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Csiszar, K. Smith, N. Labinskyy, Z. Orosz, A. Rivera, and Z. Ungvari
Resveratrol attenuates TNF-{alpha}-induced activation of coronary arterial endothelial cells: role of NF-{kappa}B inhibition.
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1694 - H1699.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. C. Degner, M. Q. Kemp, G. T. Bowden, and D. F. Romagnolo
Conjugated Linoleic Acid Attenuates Cyclooxygenase-2 Transcriptional Activity via an Anti-AP-1 Mechanism in MCF-7 Breast Cancer Cells
J. Nutr., February 1, 2006; 136(2): 421 - 427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reiterer, G.
Right arrow Articles by Hennig, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reiterer, G.
Right arrow Articles by Hennig, B.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2004 by American Society for Nutrition