![]() |
|
|

* Graduate Center for Nutritional Sciences, Department of
Surgery and
** Molecular and Cell Nutrition Laboratory, College of Agriculture, University of Kentucky, Lexington, KY 40546-0215
2To whom correspondence should be addressed. E-mail: bhennig{at}uky.edu.
| ABSTRACT |
|---|
|
|
|---|
B (NF-
B) and activator protein-1 (AP-1). Because the transcription factor peroxisome proliferator activated receptor
(PPAR
) was reported to downregulate inflammatory pathways, we further investigated the effect of quercetin on PPAR
. Porcine pulmonary-arterial endothelial cells were activated with linoleic acid in the presence or absence of quercetin. Oxidative stress was markedly induced by endothelial cell exposure to linoleic acid and diminished by treatment with quercetin as measured via the oxidation of 2',7'-dichlorofluorescin. Quercetin reduced linoleic acidmediated binding activity of NF-
B and AP-1 and mRNA levels of inflammatory genes such as interleukin-6 (IL-6) and vascular cell adhesion molecule-1 (VCAM-1). Cotreatment of linoleic acid plus quercetin or vitamin E also decreased linoleic acidinduced binding activity of PPAR
. These data suggest that quercetin has potent antioxidative and anti-inflammatory properties and protects endothelial cells against linoleic acidmediated cell dysfunction.
KEY WORDS: atherosclerosis fatty acids quercetin PPAR
Atherosclerotic lesions are thought to be initiated by vascular endothelial cell dysfunction. A damaged endothelium is less effective as a selectively permeable barrier to plasma components (1,2). The endothelium interacts with the blood and underlying tissues, serves as both a pro- and antithrombotic surface, and releases regulatory factors important in modulating vascular tone. Factors implicated in the pathogenesis of atherosclerosis include chronic and cumulative metabolic alterations of the endothelium induced by numerous activating molecules, such as certain lipids, prooxidants, and inflammatory cytokines. These risk factors may contribute to an overall cellular imbalance of the oxidative stress/antioxidant balance, thus leading to chronic activation of the endothelium and alterations of the endothelial barrier function, which can result in accelerated uptake of cholesterol-rich lipoproteins into the vessel wall.
After consumption of high-energy foods, triglyceride-rich lipoproteins are elevated, and hydrolysis of triglycerides by lipoprotein lipase occurs in proximity to the endothelial surface (3). An excessive local concentration of fatty acid anions may cause endothelial injury and therefore initiate the onset of atherosclerosis. PUFA are more susceptible to lipid peroxidation than SFA, in particular when insufficiently protected by antioxidants. Thus, if oxidative stress is a critical underlying parameter of atherosclerosis (4), then high serum PUFA concentrations may indicate a higher risk of atherosclerosis (5).
Antioxidants, such as vitamin E, can significantly reduce the linoleic acidmediated endothelial cell activation and loss of endothelial integrity (6). Quercetin, like other polyphenolics, possesses high antioxidant abilities to inhibit free radical processes in cells (7), including the prevention of lipid peroxidation (8).
Numerous oxidative stress-sensitive transcription factors, such as nuclear factor-
B (NF-
B)3 and activator protein-1 (AP-1) (9) can mediate an inflammatory response due to oxidative stress by inducing gene transcription of adhesion molecules and cytokines such as vascular cell adhesion molecule-1 (VCAM-1) and interleukin-6 (IL-6). Antioxidants such as quercetin could protect plasma lipids from oxidation, thereby preventing the induction of inflammatory events. Thus, quercetin could help maintain the integrity of the endothelium.
There is increasing evidence that peroxisome proliferator activated receptors (PPARs) can modulate inflammatory events and are thus antiatherogenic (10). For example, PPAR
can interfere negatively with NF-
B, signal transducer and activator of transcription (STAT), and AP-1 signaling pathways (11,12). This could be by preventing transcription factors from binding to their target sequences (12,13), possibly through an interaction with a subunit of the transcription factors (e.g., p65) (12). Because most of the proinflammatory genes are under the control of the AP-1 and NF-
B signaling pathways, and because PPARs can counterregulate a wide spectrum of proinflammatory genes, anti-inflammatory compounds may act through PPAR signaling. The binding pockets of PPARs are open to a variety of naturally occurring lipid-like substances acting as low-affinity ligands (14). Because quercetin is a lipophilic, polyphenolic substance with a chemical structure that could potentially fit the binding pocket of PPARs, we investigated whether the anti-inflammatory properties of quercetin could be through the activation of PPAR
.
In this study we aimed to demonstrate that quercetin has endothelium-protective effects by preventing linoleic acidinduced oxidative stress formation and by decreasing the activation of oxidant-sensitive pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The experimental media were composed of M-199 enriched with 5% (v:v) FBS and fatty acids (90 µmol/L). Fatty acids (>99% pure) were obtained from Nu-Chek-Prep. Preparations of experimental media with fatty acids were made as described previously (16). Thus, fatty acids were introduced into the media bound to serum albumin. Quercetin (1050 µmol/L) and vitamin E (25 µmol/L) were added from stock solutions in dimethylsulfoxide (DMSO) and ethanol, respectively. Controls and fatty acid groups not treated with quercetin or vitamin E contained an equal amount of DMSO or ethanol. The final DMSO concentration in the media never exceeded 0.05% (v:v) in all treatment groups. For most experimental settings, cells were treated with quercetin and fatty acids for 6 h. Vitamin E was added 18 h before fatty acid treatment.
Measurement of oxidative stress. Cellular oxidation was determined by 2',7'-dichlorofluorescein (DCF) fluorescence as described by Mattson et al. (17). This measurement of cell oxidation utilizes an imaging technique based on the conversion of 2',7'-dichlorofluorescin into fluorescent 2',7'-dichlorofluorescein as a result of activation with reactive oxygen species (ROS), primarily peroxyl radicals and peroxides. After treatment of endothelial cells with linoleic acid for 6 h, cells were loaded with 100 µmol/L 2,7-dichlorofluorescin diacetate (Molecular Probes) by incubation for 30 min. Before analysis for oxidative stress, cells were washed 3 times in HEPES buffer. In experiments utilizing H2O2 as an inducer of oxidative stress, 0.1 mmol/L H2O2 in HEPES buffer was applied to cells after DCF-staining. Imaging studies employed a multiwell fluorescent plate reader (Molecular Devices). The dye was excited at 490 nm, and emission was filtered using a 510-nm barrier filter.
Transcription factor (NF-
B, AP-1, and PPAR
) activation studies: electrophoretic mobility shift assay (EMSA).
Nuclear extracts containing active proteins were prepared from cells according to the method of Dignam et al. (18). Nuclear extracts were incubated for 25 min with 32P-end-labeled oligonucleotide probes containing enhancer DNA element NF-
B (5' AGTTGAGGGGACTTTCCCAGGC 3'), AP-1 (5' CGCTTGATGAGTCAGCCGGAA 3') (Promega) or PPAR
(5' AGGTCAAAGGTCA 3') (Santa Cruz). Incubation at room temperature was performed in the presence of nonspecific competitor DNA. After binding, the complexed and uncomplexed DNA in the mixture were resolved by electrophoresis in a 6.5% (wt:v) nondenaturing polyacrylamide gel and visualized by autoradiography. Control reactions using a 200-fold molar excess of unlabeled oligonucleotide probes or a supershift assay were performed to demonstrate the specificity of the shifted DNA-protein complexes for NF-
B, PPAR
and AP-1, respectively.
Il-6 and VCAM-1 expression studies. Total RNA was extracted from endothelial cells by the use of TRI reagent (Sigma) according to the manufacturers protocol. Gene expression was determined through RT-PCR as described earlier (19). The following primers were employed in the PCRs; IL-6 forward: 5' AAT TCG GTA CAT CCT CGA CG 3', reverse: 5' GCG CAG AAT GAG ATG AGT TG 3', VCAM-1 forward: 5' ATGACA TGC TTG AGC CAG G 3', reverse: 5' GTG TCT CCT TCT TTG ACA CT 3', ß-actin forward: 5' GGG ACC TGA CCG ACT ACC TC3', reverse: 5' GGG CGA TGA TCT TGA TCT TC3'. The amplified PCR products were electrophoresed on a 2% (wt:v) tris-borate EDTA agarose gel, stained with SYBR Gold (Molecular Probes) and visualized by using phosphorimaging technology (FLA-5000; Fuji).
Statistical analysis. The data were quantified and analyzed using the Scion Image and Sigma Stat software, respectively. Comparisons between treatments were made by 1- or 2-way ANOVA with post-hoc comparisons of the means made by Tukeys tests. A statistical probability of P < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
|
B and AP-1.
Linoleic acid increased the DNA binding activity of both transcription factors NF-
B and AP-1 as determined by EMSA. Cotreatment of quercetin and linoleic acid for 6 h downregulated the activation of NF-
B and AP-1 (Figs. 2A and B, respectively). Consistent with the observations made in measuring oxidative stress, 25 µmol/L appeared to be the most effective concentration of quercetin with no additional benefit of higher concentrations to downregulate NF-
B (Fig. 2A). Maximal downregulation of linoleic acidinduced AP-1 binding activity already occurred at 10 µmol/L quercetin (Fig. 2B).
|
|
B and AP-1 binding activity or VCAM-1 mRNA. Indeed, quercetin was effective only when applied at higher concentrations (50 µmol/L).
Quercetin and vitamin E decrease linoleic acidinduced PPAR
binding activity.
PPAR
protects cells against proinflammatory and prooxidative insults, and linoleic acid is a natural ligand for this transcription factor. Therefore, the effects of linoleic acid and/or quercetin on PPAR
DNA binding activity were assessed in the present study. Exposure to linoleic acid for 6 h markedly induced PPAR
activity (Figs. 4A and B). Although quercetin alone did not affect binding of this transcription factor, it diminished PPAR
activation in cells cotreated with linoleic acid. To assess whether the effects of quercetin on activation of PPAR
were specific, cells were pretreated with another antioxidant, vitamin E (25 µmol/L for 18 h) and treated with linoleic acid for 6 h. Similar to the effects exerted by quercetin, vitamin E also protected against linoleic acidinduced binding activity of PPAR
(Fig. 4B).
|
| DISCUSSION |
|---|
|
|
|---|
The antioxidant properties of quercetin also could be responsible in part for the anti-inflammatory effects observed in the present study. We showed that quercetin can downregulate the linoleic acidinduced activation of both NF-
B and AP-1. These are oxidative stresssensitive transcription factors that can therefore be modified by oxidants and antioxidants. The precise way in which linoleic acid induces an inflammatory response in endothelial cells is not clear. However, oxidation products of linoleic acid might be directly involved in the activation of NF-
B. Lipid peroxides rather than H2O2 were suggested to mediate the activation of NF-
B in response to oxidative stress (24). It is possible that lipid metabolites and derivatives, including oxidized fatty acids, can induce the inflammation, in addition to the native linoleic acid itself. Furthermore, quercetin was suggested to suppress inhibitory I
B kinase (25) and c-Jun kinase (26), which subsequently could lead to suppression of NF-
B and AP-1 activation. Activation of NF-
B leads to expression of inflammatory cytokines and adhesion molecules, resulting in recruitment of monocytes and accelerated development of atherosclerosis (27). Because most of the proinflammatory genes are under the control of the AP-1 and NF-
B signaling pathways (28) and quercetin can counterregulate these pathways, the potent anti-inflammatory properties of quercetin are clearly demonstrated. In support of its anti-inflammatory properties, we showed that quercetin can block the linoleic acidinduced expression of both VCAM-1 and IL-6, a downstream event of NF-
B activation (29).
Because PPAR
can interfere negatively with NF-
B, STAT, and AP-1 signaling pathways (11,12), we further investigated whether quercetin can affect PPAR
binding activity. Even though both PPAR
and PPAR
were reported to be anti-inflammatory and antiatherogenic, PPAR
is involved in lipid metabolism and could therefore be activated independently of fatty acid modification by oxidation. Thus, the present study focuses on PPAR
. Although quercetin has a chemical structure that could potentially be a ligand for PPAR
, exposure to quercetin alone did not activate this transcription factor. Consistent with the known overall effects of fatty acids on PPAR
activation, treatment with linoleic acid induced PPAR
binding activity in endothelial cells. However, cotreatment with quercetin markedly downregulated linoleic acidinduced PPAR
activation. These results are consistent with earlier reports showing that quercetin can mediate downregulation of PPAR
in transiently transfected macrophages (30) and in murine epidermal keratinocytes (31). Because linoleic acid can induce oxidative stress and inflammation and at the same time activate PPAR, we suspected that lipid oxidation is involved in activating the PPAR pathway. To further address the question whether the decreased PPAR
activation observed in the present study is specific for quercetin, endothelial cells were treated with another antioxidant (vitamin E) followed by exposure to linoleic acid. Vitamin E also prevented the linoleic acidmediated activation of PPAR
. These data suggest that quercetin can reduce the linoleic acidmediated activation of PPAR
due to its antioxidant effect and the prevention of lipid oxidation. Previous studies indicated that oxidized products of linoleic acid are good ligands for PPARs (32). Quercetin may act as an antioxidant; thus the decreased formation of oxidized products of linoleic acid might be a reason for the lower binding of linoleic acid to PPAR
in the presence of quercetin.
These data suggest that the quercetin-mediated protection observed against linoleic acidinduced endothelial cell activation is independent of PPAR
signaling. In addition, it appears that the diminished PPAR
DNA binding activity observed in cells exposed to linoleic acid plus quercetin may be related to a general antioxidant effect of this polyphenolic. Indeed, PPARs may act as critical rescue molecules by downregulating oxidative stresssensitive and inflammatory signaling pathways. In cells that are protected by antioxidants such as quercetin and vitamin E, oxidative stresssensitive pathways, including PPAR
, are less likely to become activated.
Overall, our data suggest that quercetin is a potent antioxidant and anti-inflammatory substance, which can protect the endothelium against oxidative stress and inflammatory events, despite downregulation of PPAR
activation. Specifically, quercetin inhibited linoleic acidinduced activation of oxidative stresssensitive pathways, such as NF-
B and AP-1, and inflammatory genes, such as VCAM-1 and IL-6. These data support the hypothesis that plant phenolics such as quercetin can help prevent the development of atherosclerosis by downregulating the expression of inflammatory cytokines and adhesion molecules.
| FOOTNOTES |
|---|
3 Abbreviations used: AP-1, activator protein-1; DCF, 2',7'-dichlorofluorescein; DMSO, dimethylsulfoxide; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; IL-6, interleukin-6; NF-
B, nuclear factor-
B; PPAR, peroxisome proliferator activated receptor; ROS, reactive oxygen species; STAT, signal transducer and activator of transcription; VCAM-1, vascular cell adhesion molecule-1. ![]()
Manuscript received 9 October 2003. Initial review completed 11 November 2003. Revision accepted 11 January 2004.
| LITERATURE CITED |
|---|
|
|
|---|
1. Flarahan, N. A. (1992) Atherosclerosis or lipoprotein-induced endothelial dysfunction. Circulation 85:1927-1938.
2. Ross, R. (1999) Atherosclerosis is an inflammatory disease. Am. Heart J. 138:S419-S420.[Medline]
3. Zilversmit, S. B. (1979) Atherogenesis: a postprandial phenomenon. Circulation 60:473-485.
4. Steinberg, D. & Witztum, J. L. (2002) Is the oxidative modification hypothesis relevant to human atherosclerosis? Do the antioxidant trials conducted to date refute the hypothesis?. Circulation 105:2107-2111.
5. Kok, F. J., van Poppel, G., Melse, J., Verheul, E., Schouten, E. G., Kruyssen, D. H. & Hofman, A. (1991) Do antioxidants and polyunsaturated fatty acids have a combined association with coronary atherosclerosis?. Atherosclerosis 86:85-90.[Medline]
6. Hennig, B., Toborek, M., Joshi-Barve, S., Barger, S. W., Barve, S., Mattson, M. P. & McClain, C. J. (1996) Linoleic acid activates nuclear transcription factor-kappa B (NF-kappa B) and induces NF-kappa B-dependent transcription in cultured endothelial cells. Am. J. Clin. Nutr. 63:322-328.
7. Lee, J. Y., Chang, E. J., Kim, H. J., Park, J. H. & Choi, S. W. (2002) Antioxidative flavonoids from leaves of Carthamus tinctorius. Arch. Pharm. Res. 25:313-319.[Medline]
8. Heijnen, C. G., Haenen, G. R., Oostveen, R. M., Stalpers, E. M. & Bast, A. (2002) Protection of flavonoids against lipid peroxidation: the structure activity relationship revisited. Free Radic. Res. 36:575-581.[Medline]
9. Turpaev, K. T. (2002) Reactive oxygen species and regulation of gene expression. Biochemistry 67:281-292.[Medline]
10. Takano, H. & Komuro, I. (2002) Roles of peroxisome proliferator-activated receptor gamma in cardiovascular disease. J. Diabet. Complicat. 16:108-114.
11. Zhou, Y. C. & Waxman, D. J. (1999) Cross-talk between janus kinase-signal transducer activator of transcription (JAK-STAT) and peroxisome proliferator-activated receptor
(PPAR
) signaling pathways. J. Biol. Chem. 274:2672-2681.
12. Delerive, P., Martin-Nizard, F., Chinetti, G., Trottein, F., Fruchart, J. C. & Duriez, P. (1999) PPAR activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the AP-1 signaling pathway. Circ. Res. 85:394-402.
13. Marx, N., Sukhova, G., Collins, T., Libby, P. & Plutzky, J. (1999) PPAR
activators inhibit cytokine-induced vascular cell adhesion molecule-1 expression in human endothelial cells. Circulation 99:3125-3131.
14. Van Bilsen, M., Van der Vusse, G. J., Gilde, A. J., Lindhout, M. & Van der Lee, K. A. (2002) Peroxisome proliferator-activated receptors: lipid binding proteins controlling gene expression. Mol. Cell Biochem. 239:131-138.[Medline]
15. Hennig, B., Shasby, D. M., Fulton, A. B. & Spector, A. A. (1984) Exposure to free fatty acid increases the transfer of albumin across cultured endothelial monolayers. Arteriosclerosis 4:489-497.
16. Toborek, M., Lee, Y. W., Kaiser, S. & Hennig, B. (2002) Measurement of inflammatory properties of fatty acids in human endothelial cells. Methods Enzymol 352:198-219.[Medline]
17. Mattson, M. P., Barger, S. W., Begley, J. G. & Mark, R. J. (1995) Calcium, free radicals, and excitotoxic neuronal death in primary cell culture. Methods Cell Biol 46:187-216.[Medline]
18. Dignam, J. D., Martin, P. L., Shastry, B. S. & Roeder, R. G. (1993) Eukaryotic gene transcription with purified components. Methods Enzymol 101:582-598.
19. Lee, Y. W., Kuhn, H., Hennig, B., Neish, A. S. & Toborek, M. (2001) IL-4 induced oxidative stress upregulates VCAM-1 gene expression in human endothelial cells. J. Mol. Cell Cardiol. 33:83-94.[Medline]
20. Hennig, B., Meerarani, P., Ramadass, P., Watkins, B. A. & Toborek, M. (2000) Fatty acidmediated activation of vascular endothelial cells. Metabolism 49:1006-1013.[Medline]
21. Metodiewa, D., Jaiswal, A. K., Cenas, N., Dickancaite, E. & Segura-Aguilar, J. (1999) Quercetin may act as a cytotoxic prooxidant after its metabolic activation to semiquinone and quinoidal product. Free Radic. Biol. Med. 26:107-116.[Medline]
22. Long, L. H., Clement, M. V. & Halliwell, B. (2000) Artifacts in cell culture: rapid generation of hydrogen peroxide on addition of (-)-epigallocatechin, (-)-epigallocatechin gallate, (+)-catechin, and quercetin to commonly used cell culture media. Biochem. Biophys. Res. Commun. 273:50-53.[Medline]
23. Hollman, P. C. & Katan, M. B. (1997) Absorption, metabolism and health effects of dietary flavonoids in man. Biomed. Pharmacother. 51:305-310.[Medline]
24. Bowie, A. & ONeill, L.A.J. (2000) Oxidative stress and nuclear factor-kappaB activation: a reassessment of the evidence in the light of recent discoveries. Biochem. Pharmacol. 59:13-23.[Medline]
25. Peet, G. W. & Li, J. (1999) IkappaB kinases alpha and beta show a random sequential kinetic mechanism and are inhibited by staurosporine and quercetin. J. Biol. Chem. 274:32655-32661.
26. Yoshizumi, M., Tsuchiya, K., Suzaki, Y., Kirima, K., Kyaw, M. & Moon, J. H. (2002) Quercetin glucuronide prevents VSMC hypertrophy by angiotensin II via the inhibition of JNK and AP-1 signaling pathway. Biochem. Biophys. Res. Commun. 293:1458-1465.[Medline]
27. Sluiter, W., Pietersma, A., Lamers, J. M. & Koster, J. F. (1993) Leukocyte adhesion molecules on the vascular endothelium: their role in the pathogenesis of cardiovascular disease and the mechanisms underlying their expression. J. Cardiovasc. Pharmacol. 22:S37-S44.
28. Valen, G., Yan, Z. Q. & Hansson, G. K. (2001) Nuclear factor kappa-B and the heart. J. Am. Coll. Cardiol. 38:307-314.
29. Li, X. & Stark, G. R. (2002) NFkappaB-dependent signaling pathways. Exp. Hematol. 4:285-258.
30. Liang, Y. C., Tsai, S. H., Tsai, D. C., Lin-Shiau, S. Y. & Lin, J. K. (2001) Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-gamma by flavonoids in mouse macrophages. FEBS Lett 496:12-18.[Medline]
31. Thuillier, P., Brash, A. R., Kehrer, J. P., Stimmel, J. B., Leesnitzer, L. M., Yang, P., Newman, R. A. & Fischer, S. M. (2002) Inhibition of PPAR-mediated keratinocyte differentiation by lipoxygenase inhibitors. Biochem. J. 366:901-910.[Medline]
32. Bull, A. W., Steffensen, K. R., Leers, J. & Rafter, J. J. (2003) Activation of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gamma. Carcinogenesis 24:1717-1722.
This article has been cited by other articles:
![]() |
S. Sarada, P. Himadri, C. Mishra, P. Geetali, M. S. Ram, and G. Ilavazhagan Role of Oxidative Stress and NFkB in Hypoxia-Induced Pulmonary Edema Experimental Biology and Medicine, September 1, 2008; 233(9): 1088 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ungvari, Z. Orosz, A. Rivera, N. Labinskyy, Z. Xiangmin, S. Olson, A. Podlutsky, and A. Csiszar Resveratrol increases vascular oxidative stress resistance Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2417 - H2424. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Csiszar, K. Smith, N. Labinskyy, Z. Orosz, A. Rivera, and Z. Ungvari Resveratrol attenuates TNF-{alpha}-induced activation of coronary arterial endothelial cells: role of NF-{kappa}B inhibition. Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1694 - H1699. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Degner, M. Q. Kemp, G. T. Bowden, and D. F. Romagnolo Conjugated Linoleic Acid Attenuates Cyclooxygenase-2 Transcriptional Activity via an Anti-AP-1 Mechanism in MCF-7 Breast Cancer Cells J. Nutr., February 1, 2006; 136(2): 421 - 427. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||