|
|
|
|


Department of Medicine and
* Department of Kinesiology, University of Illinois at Chicago, Chicago, IL 60612 and
Department of Medicine, Washington University, St. Louis, MO 63110
2To whom correspondence should be addressed. E-mail: brodsi{at}mmc.org.
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: nutrition skeletal muscle protein synthesis
Diminished muscle size is a consequence of protein undernutrition (1,2). The ability of amino acids to regulate protein synthesis in muscle is believed to be mediated through the mammalian target of rapamycin (mTOR)3 as part of a pathway involving downstream targets such as p70 ribosomal protein S6 kinase (p70S6k) and eukaryotic initiation factor 4E binding protein 1 (eIF-4E-BP1) (36). Because p70S6k stimulates ribosome production (7), this model predicts that an increased abundance of amino acids will increase muscle protein synthesis globally. It follows that low dietary protein intake with diminished amino acid availability will induce a broad decrease in muscle protein synthesis.
Previous studies in animal models, however, report that restriction of dietary protein intake affects muscles of various myosin isoform compositions differently (8), particularly during fetal and early postnatal development (9,10). Those muscles in which fast-twitch myosin isoforms predominate [i.e., in order of increasing contraction velocity, myosin heavy chain (MHC) IIa, IIx, and IIb] lose mass and protein content faster during protein deprivation than those in which slow-twitch isoforms predominate (i.e., MHC I). These findings suggest that dietary protein influences the skeletal muscle proteins, particularly MHC isoforms, selectively.
We previously reported that in diabetic patients using isoenergetic dietary protein restriction to preserve renal function, such diets decrease quadriceps-generated torque during intermediate-velocity isokinetic dynamometry (11). In the present study we extended the investigation of these diets to examine their effect on myofibrillar protein production and myosin composition. We studied healthy control subjects, comparing the MHC isoform composition, the MHC fractional synthesis rate, and the expression of MHC genes in subjects consuming an ample American-style level of protein with those in subjects consuming the minimum protein requirement. We hypothesized that restriction of dietary protein to the minimum requirement would inhibit myosin synthesis and alter MHC composition to favor slow-twitch isoforms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Experimental diet. The diets contained a mixture of protein from animal and vegetable sources. The ample-protein (high-protein) diet contained 1.67 g · kg fat-free mass (ffm)-1 · d-1. The restricted-protein (low-protein) diet contained 0.71 g · kg-1ffm · d-1. For a subject with the body composition of a typical college-age male (i.e., 15% fat), the former diet provided 1.5 g · kg-1 · d-1 of protein and the latter diet provided 0.6 g · kg-1 · d-1. This method of assigning dietary protein content assumes that the fat mass contributes minimally to dietary protein requirements compared with the fat-free mass and that indexing the dietary protein assignment to the fat-free mass minimizes the variation in protein intake resulting from variation in body composition. Nonprotein energy intake was assigned by amalgamating the energy intake recorded by subjects in 3-d diet diaries and Harris-Benedict calculation of energy requirements. Nonprotein energy intake did not differ between the groups (Table 1). Subjects followed a rotating menu program with menus that specified the food types and amounts to be consumed (Table 2). Food scales were provided to ensure precision in portion control.
|
|
70 mg of muscle. Biopsies were performed distal to proximal in the ipsilateral leg
7 cm apart. Female subjects were studied during the follicular phase of the menstrual cycle. Urine nitrogen assessment. Urine total nitrogen was measured by modified Kjeldahl analysis as previously described (13).
Urine 3-methylhistidine assessment. The urine excretion of 3-methylhistidine was determined by reverse-phase HPLC (HP 1100, Hewlett-Packard), using a Pico-Tag C-18 column (Waters). Urine aliquots were deproteinized with 10% sulfosalicylic acid, and amino acids were converted to phenylthiocarbamyl (PTC) derivatives by reacting them with phenylisothiocyanate under alkaline conditions. The amino acids, including 3-methylhistidine, were separated using a gradient mobile phase in which a 50-mmol/L sodium acetate buffer (Buffer A; pH 6) was mixed with 760% of a 60:40 acetonitrile:water solution (Buffer B) over 40 min at 38°C. The amino acid PTC chromophore was detected at 254 nm.
Myosin heavy chain isoform proportion assessment. Myofibrillar proteins were separated by centrifuging crude homogenate at 1000 x g in a 20-mmol/L Tris buffer (pH 8.7) with 1% Triton X-1000 (Union Carbide, Sigma Chemical) as previously described (14). Aliquots of myofibrillar protein were separated by SDS-PAGE as previously described (15,16) after total protein was measured (DC Assay; BioRad), and equal amounts of protein were loaded onto the gel for each sample. In repeated analyses of a single sample, the mean intrasubject coefficient of variation for the MHC IIx proportion was 0.055 (range 0.029 to 0.9).
Quantitative RT-PCR analysis of MHC mRNA content. The level of MHC isoform expression was determined by real-time quantitative RT-PCR analysis with SYBR Green detection, using a LightCycler thermocycler (Roche Diagnostics). Total RNA was extracted from 10 to 20 mg of skeletal muscle, from the same biopsy used for MHC composition, using TRIzol reagent (Invitrogen) (17). We used 100 ng of RNA as a template for a one-step RT-PCR reaction using the LightCycler RNA Amplificaton kit with SYBR Green (Roche Diagnostics). Quantification of the RT-PCR reaction was based on a series of in vitro transcribed mRNA standards prepared for each gene being analyzed and assessed concurrently to develop a standard curve, as previously described (18). The reaction conditions for the reverse transcriptase were 55°C for 15 min, followed by a four-step PCR amplification at 95°C for 1 s, 55°C for 10 s, 72°C for 13 s, and fluorescence signal acquisition at 80 to 89°C for 2 s, (depending on the melting temperature for each PCR product determined by melting curve analysis), for 45 cycles. The second derivative maximum (log linear phase) for each amplification curve was determined and plotted against the standard curve to calculate the amount of product. Samples were normalized against glyceraldehyde phosphate dehydrogenase (GAPDH) expression to ensure equal loading. The primers used were designed against the 3'-untranslated region in order to distinguish between the myosin isotypes. A common forward primer was used for both, along with isotype-specific reverse primers. The primer sequences were as follows: Myosin heavy chain IIa: (F) GCCAAGAAGGCCATCAC (R) GCTTTATTTCCTTTGCAACAGGGTAGAATACACAATAATTACAGAGGG (Genebank accession AF111784). Myosin heavy chain IIx: (F) GCCAAGAAGGCCATCAC (R) TGGAGTGACAAAGATTTTCACATTTTGTGCATTTCTTTGGTCACC (Genebank accession AF111785). Glyceraldehyde-3-phosphate dehydrogenase: (F) GTGGACCTGACCTGCCGTCTA (R) GCTTGACAAAGTGGTCGTTGA (Genebank accession NM002046).
Myosin heavy chain and actin fractional synthesis rate. We analyzed the incorporation of L-[1-13C]-leucine into MHC and actin proteins using gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS), as previously described (19). Briefly, the myofibrillar protein extract was separated by SDS-PAGE at 4°C in a single-wide lane using a 7% separating gel and a 4% stacking gel on a BioRad Protean II xi vertical slab electrophoresis unit (BioRad), then excised and hydrolyzed to component amino acids. The amino acids were converted to their N-acetyl, n-propyl ester derivatives for analysis of 13C-leucine by GC-C-IRMS. The intensity of the CO2 signal from the leucine isolated by GC serves as an internal standard and must match the intensity of the CO2 signal from reference CO2 gas (4-V signal of known 13CO2:12CO2 content). Typically, each sample is analyzed in triplicate.
The 13C enrichment in the precursor pool for protein synthesis was assayed using the 13C-leucine enrichment in skeletal muscle tissue fluid as a surrogate for the true precursor for protein synthesis, tRNA-bound leucine. The surrogate provides good approximations of true fractional synthesis rates when small tissue samples preclude the measurement of tRNA-bound amino acid isotope enrichment (2022). We measured enrichment muscle tissue 13C-leucine enrichment as its t-butyl, dimethylsilyl derivative, using electronic-ionization gas chromatographymass spectrometry (Shimadzu QP-5000; Shimadzu), as previously described (23,24).
Calculations.
We calculated the fractional synthesis rate (FSR) of MHC and actin proteins using the precursor-product model, as follows:
![]() |
where t1 and t2 are the first and second skeletal muscle biopsies, respectively;
t is the time interval between biopsies; and E is the 13C-leucine enrichment in either MHC or actin protein.
Statistical analysis.
The effects of the assigned diet were assessed by a two-tailed t test (acceptable
= 0.05) for unpaired data. Welchs correction was used when variances were not comparable, and Mann-Whitney testing was used for nonparametric data. Repeated measurements of nitrogen excretion were analyzed by ANOVA with Bonferroni post-testing. Multivariate analysis was used to ascertain the effect of gender on the MHC composition and mRNA data. Where data represent related proportions totaling 1 (i.e., MHC isoform proportions), results were analyzed using simplicial analysis of the compositional data (25). The simplicial analysis requires the transformation of measurements expressed as proportions to expression as numbers, retaining the vector characteristics of the original relations (i.e., the simplex) among the MHCs. Because the simplicial analysis removes the constraints on the myosin isoform proportions to total 1, the directional changes in myosin components can better be discerned, and multivariate relationships can legitimately be explored. The transformation is as follows:
![]() |
where xi is the proportion of myosin that is MHC I, IIa, or IIx, and yi is the transformed proportion. The 1/3 multiplier reflects the existence of 3 proportions (MHC I, IIa, and IIx) for each MHC measurement.
Data are expressed as means ± SEM.
| RESULTS |
|---|
|
|
|---|
|
|
Myosin isoform proportions. The MHC IIx proportion was 49% lower in those subjects consuming the low-protein diet than in those consuming the high-protein diet (12.56 ± 2.13 vs. 24.63 ± 3.88%, respectively, P = 0.013; Table 4; Fig. 2). Gender did not affect the MHC IIx proportion (P = 0.46) or the logarithmically transformed proportion (P = 0.59) in multivariate analysis. The simplicial analysis by logarithmic transformation (i.e., log ratio) highlighted the selective decrease in the MHC IIx proportion and the relative increase in the representation of MHC I (Table 3). Gender-specific differences in raw or transformed proportions between dietary treatments were not significant, presumably due to smaller numbers and statistical power, although trends paralleled those in the combined analyses. Conversion of the MHC proportions to log ratios allowed legitimate examination of the bivariate relations between MHC isoforms in both diet groups. The transformed proportions of MHC IIx and MHC I were inversely related in both diet groups (high-protein diet, r = -0.97, P = 0.001; low-protein group, r = -0.71, P = 0.05). By contrast, there was no relationship between the MHC I and MHC IIa log ratios in either diet group (high-protein diet, r = -0.005, P = 0.99; low-protein group, r = -0.006, P = 0.99). The MHC IIx and MHC IIa log ratios were inversely related only in the low-protein diet group (high-protein diet, r = -0.24, P = 0.64; low-protein diet, r = -0.70, P = 0.05).
|
|
Myosin mRNA. Although the MHC IIx proportion was lower in the restricted-protein diet group than in the ample-protein diet group, the expression of the MHC IIx gene, indicated by the steady-state mRNA content indexed to the GAPDH mRNA, did not differ (MHC IIx:GAPDH: 0.271 ± 0.115 vs. 0.237 ± 0.154 for low- and high-protein diet, respectively, P = 0.87). The same phenomenon was illustrated, perhaps more dramatically, with MHC IIa, for which the proportion was unchanged, but the gene expression (mRNA content) was 2.3 times that in the low-protein diet group (MHC IIa:GAPDH: 0.492 ± 0.095 vs. 0.212 ± 0.051 for low- and high-protein diet, respectively, P = 0.05). The GAPDH mRNA steady-state levels did not differ between groups. Gender did not affect MHC IIx mRNA content in multivariate analyses. The MHC IIa mRNA levels were higher in male than in female subjects, but differences between treatments were similar for both genders [MHC IIa:GAPDH: 0.61 ± 0.16 vs. 0.26 ± 0.027 (males) and 0.29 ± 0.11 vs. 0.027 ± 0.00 (females) for low-protein vs. high-protein diet, P = 0.02 (diet effect), P = 0.05 (gender effect)].
| DISCUSSION |
|---|
|
|
|---|
The relative sparing of slow-twitch myosin and sacrifice of fast-twitch myosin is also reported in animal models of undernutrition. Restricted intake increases slow-twitch myosin expression and oxidative capacity of muscle in postnatal pigs (10) and reverses the progression toward fast-twitch myosin expression with senescence in rats by increasing the expression of MHC I and IIa relative to IIx (28). The present study extends these previous reports by showing that protein undernutrition, in particular, produces similar effects in humans.
The implications of the restricted-protein dietinduced transition to a lower MHCIIx fiber proportion in skeletal muscle are not certain, but the alterations are likely to produce muscle contraction with lower energy cost because of the increased representation of myosin (I and IIa) associated with oxidative metabolism, lower ATP hydrolysis rate, and lower energy utilization for tension development (2931). The mathematical transformation of MHC isoform proportions into log ratios allowed a comparison of the bivariate relationships among the isoforms, revealing significant inverse relations between MHC IIx and both MHC I and MHC IIa in subjects consuming the low-protein diet. Although this analysis must be viewed with caution because it was done at a single point in time and not longitudinally, it suggests that decreased representation of MHC IIx in the low-protein diet group is compensated by both slower-twitch alternative isoforms during dietary protein deprivation.
The conversion of skeletal muscle from a more energy costly to a less energy costly isoform composition during energy deprivation is intuitive and teleologically sensible. However, it is not clear why the altered myosin composition occurred during dietary protein deprivation, particularly because the protein-restriction model used in the present study was isoenergetic. This observation suggests that caution is warranted in attributing the effects of undernutrition on protein dynamics to energy deprivation alone. Furthermore, predictions regarding the effect of nutrition on muscle should be tempered by the understanding that the effects of protein nutrition can be subordinated to other potent determinants of myosin composition, such as functional load (32).
The mechanism by which low dietary protein intake induces diminished MHC protein synthesis is not certain but likely involves responses of the mammalian target of rapamycin pathway. This pathway is known to mediate the actions of amino acids (particularly branched-chain amino acids) on muscle protein synthesis through its ability to stimulate translation of mRNA via phosphorylation of eIF-4E-BP1 and p70s6k (4,33,34). The latter may also enhance global protein synthesis through the stimulation of elongation factor production (3), ribosome gene transcription, and ribosome production (7). However, what mechanism might explain the selectively augmented suppression of MHC IIx relative to other myosin isoforms, should the differences noted in MHC isoform composition between dietary treatment groups be the result of impaired MHC IIx synthesis, is unknown.
It is important to note that in the present study, 3-methylhistidine excretion, an indicator of myofibrillar protein degradation, was also lower in the low-protein diet group. Although myofibrillar protein breakdown is not the exclusive source of 3-methylhistidine excreted in the urine (35), because the gut and skin also contribute, muscle constitutes the largest contributor (i.e.,
75%) (36,37). It is therefore possible that both skeletal muscle myosin synthesis and degradation rates are diminished when protein intake is restricted. The diminished proportion of MHC IIx in myosin in vastus lateralis muscle in the low-protein diet group could be the result of differential myosin isoform degradation as well as synthesis.
The inferences drawn from the present study are subject to certain limitations. First, although attenuation in MHC protein synthesis appears to be regulated through post-transcriptional processes, we cannot be certain that steady-state mRNA levels did not fluctuate throughout the course of the 4-wk dietary treatment. High levels of MHC IIa and IIx mRNA in subjects consuming a low-protein diet could reflect acute increases and not chronically increased transcription. Second, present technology and sample size requirements for isotopic analysis do not permit assessment of fractional synthesis rates of individual myosin isoforms in percutaneous human muscle biopsies. The magnitude of difference in the aggregate MHC synthesis rate between the low- and high-protein diet groups makes it unlikely that the synthesis rate of any of the component isoforms was higher in the low-protein diet group, but this possibility must be considered. Third, our measurements were made in the postabsorptive state. Synthesis rate measurements are likely to be quantitatively different in the fed state, because translational efficiency is low in the fasting state. Postabsorptive measurements were taken because of the higher variability of synthesis rate calculations in the fed state, owing to more variable isotopic enrichment of the amino acid precursor pool. We do not know whether differences between the low- and high-protein dietary treatments would be augmented or diminished in the fed state. Finally, we did not examine histologic correlates of the myosin isoform measurements. Thus, we cannot determine whether myosin isoform differences between dietary treatment groups represent different expression of the MHC IIx isoform broadly among fibers, or represent the selective atrophy of type II fast-twitch fibers (in which MHC IIa and IIx are highly represented) in favor of type I fibers (in which MHC I and IIa are represented). The latter scenario could certainly account for the increase in the MHC IIa:MHC IIx ratio seen in the present data.
In conclusion, isoenergetic dietary protein deprivation produced reduced rates of MHC synthesis in the vastus lateralis muscle of healthy young men and women. In addition, dietary protein restriction produced fast-to-slow transition in MHC isoform proportions. The inhibition of MHC synthesis appears to occur post-transcription, but further study is required to elucidate the mechanism by which protein intake selectively regulates MHC isoform composition.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
3 Abbreviations used: eIF-4E-BP1, eukaryotic initiation factor 4E binding protein 1; ffm, fat-free mass; FSR, fractional synthesis rate; GAPDH, glyceraldehyde phosphate dehydrogenase; GC-C-IRMS, gas chromatography-combustion-isotope ratio mass spectrometry; GCRC, General Clinical Research Center; MHC, myosin heavy chain; mRNA, messenger RNA; mTOR, mammalian target of rapamycin; p70S6k, p70 ribosomal protein S6 kinase; PTC, phenylthiocarbamyl. ![]()
Manuscript received 10 June 2003. Initial review completed 11 July 2003. Revision accepted 27 October 2003.
| LITERATURE CITED |
|---|
|
|
|---|
1. Smith, C. K., Durschlag, R. P. & Layman, D. K. (1982) Responses of skeletal muscle protein synthesis and breakdown to levels of dietary protein and fat during growth in weaning rats. J. Nutr. 112:255-262.
2. Garlick, P. J., Millward, D. J., James, W. P. & Waterlow, J. C. (1975) The effect of protein deprivation and starvation on the rate of protein synthesis in tissues of the rat. Biochim. Biophys. Acta 414:71-84.[Medline]
3. Kimball, S. R., Shantz, L. M., Horetsky, R. L. & Jefferson, L. S. (1999) Leucine regulates translation of specific mRNAs in L6 myoblasts through mTOR-mediated changes in availability of eIF4E and phosphorylation of ribosomal protein S6. J. Biol. Chem. 274:11647-11652.
4. Kimball, S. R., Jefferson, L. S., Nguyen, H. V., Suryawan, A., Bush, J. A. & Davis, T. A. (2000) Feeding stimulates protein synthesis in muscle and liver of neonatal pigs through an mTOR-dependent process. Am. J. Physiol. Endocrinol. Metab. 279:E1080-E1087.
5. Beugnet, A., Tee, A. R., Taylor, P. M. & Proud, C. G. (2003) Regulation of targets of mTOR signalling by intracellular amino acid availability. Biochem. J. 372:555-566.[Medline]
6. Liu, Z., Jahn, L. A., Wei, L., Long, W. & Barrett, E. J. (2002) Amino acids stimulate translation initiation and protein synthesis through an Akt-independent pathway in human skeletal muscle. J. Clin. Endocrinol. Metab. 87:5553-5558.
7. Kawasome, H., Papst, P., Webb, S., Keller, G. M., Johnson, G. L., Gelfand, E. W. & Terada, N. (1998) Targeted disruption of p70(s6k) defines its role in protein synthesis and rapamycin sensitivity. Proc. Natl. Acad. Sci. U.S.A. 95:5033-5038.
8. Santidrian, S., Young, V. R. & Munro, H. N. (1980) Effect of diabetes and protein malnutrition on the rate of muscle protein breakdown in rats. Rev. Esp. Fisiol. 36:255-263.[Medline]
9. Dwyer, C. M. & Stickland, N. C. (1992) Does the anatomical location of a muscle affect the influence of undernutrition on muscle fibre number?. J. Anat. 181:373-376.
10. White, P., Cattaneo, D. & Dauncey, M. J. (2000) Postnatal regulation of myosin heavy chain isoform expression and metabolic enzyme activity by nutrition. Br. J. Nutr. 84:185-194.[Medline]
11. Brodsky, I. G., Robbins, D. C., Hiser, E., Fuller, S. P., Fillyaw, M. & Devlin, J. T. (1992) Effects of low-protein diets on protein metabolism in insulin-dependent diabetes mellitus patients with early nephropathy. J. Clin. Endocrinol. Metab. 75:351-357.[Abstract]
12. Young, V. R. & Munro, H. N. (1978) N tau-methylhistidine (3-methylhistidine) and muscle protein turnover: an overview. Fed. Proc. 37:2291-2300.[Medline]
13. Shahinian, A. H. & Reinhold, J. G. (1971) Application of the phenol-hypochlorite reaction to measurement of ammonia concentrations in Kjeldahl digests of serum and various tissues. Clin. Chem. 17:1077-1080.[Abstract]
14. Solaro, R. J., Pang, D. C. & Briggs, F. N. (1971) The purification of cardiac myofibrils with Triton X-100. Biochim. Biophys. Acta 245:259-262.[Medline]
15. Bamman, M. M., Clarke, M. S., Talmadge, R. J. & Feeback, D. L. (1999) Enhanced protein electrophoresis technique for separating human skeletal muscle myosin heavy chain isoforms. Electrophoresis 20:466-468.[Medline]
16. Talmadge, R. J. & Roy, R. R. (1993) Electrophoretic separation of rat skeletal muscle myosin heavy-chain isoforms. J. Appl. Physiol. 75:2337-2340.
17. Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.[Medline]
18. Alden, K. J., Goldspink, P. H., Ruch, S. W., Buttrick, P. M. & Garcia, J. (2002) Enhancement of L-type Ca(2+) current from neonatal mouse ventricular myocytes by constitutively active PKC-betaII. Am. J. Physiol. Cell. Physiol. 282:C768-C774.
19. Hasten, D. L., Morris, G. S., Ramanadham, S. & Yarasheski, K. E. (1998) Isolation of human skeletal muscle myosin heavy chain and actin for measurement of fractional synthesis rates. Am. J. Physiol. 275:E1092-E1099.[Medline]
20. Baumann, P. Q., Stirewalt, W. S., ORourke, B. D., Howard, D. & Nair, K. S. (1994) Precursor pools of protein synthesis: a stable isotope study in a swine model. Am. J. Physiol. 267:E203-E209.
21. Watt, P. W., Lindsay, Y., Scrimgeour, C. M., Chien, P. A., Gibson, J. N., Taylor, D. J. & Rennie, M. J. (1991) Isolation of aminoacyl-tRNA and its labeling with stable-isotope tracers: Use in studies of human tissue protein synthesis. Proc. Natl. Acad. Sci. U.S.A. 88:5892-5896.
22. Ljungqvist, O. H., Persson, M., Ford, G. C. & Nair, K. S. (1997) Functional heterogeneity of leucine pools in human skeletal muscle. Am. J. Physiol. 273:E564-E570.
23. Brodsky, I. G. & Devlin, J. T. (1996) Effects of dietary protein restriction on regional amino acid metabolism in insulin-dependent diabetes mellitus. Am. J. Physiol. 270:E148-E157.[Medline]
24. Mawhinney, T. P., Robinett, R. S., Atalay, A. & Madson, M. A. (1986) Analysis of amino acids as their tert.-butyldimethylsilyl derivatives by gas-liquid chromatography and mass spectrometry. J. Chromatogr. 358:231-242.[Medline]
25. Aitchison, J. A. (1986) The Statistical Analysis of Compositional Data 1986 Chapman & Hall London, UK.
26. Heymsfield, S. B., Arteaga, C., McManus, C., Smith, J. & Moffitt, S. (1983) Measurement of muscle mass in humans: validity of the 24-hour urinary creatinine method. Am. J. Clin. Nutr. 37:478-494.
27. Svanberg, E., Ennion, S., Isgaard, J. & Goldspink, G. (2000) Postprandial resynthesis of myofibrillar proteins is translationally rather than transcriptionally regulated in human skeletal muscle. Nutrition 16:42-46.[Medline]
28. Ameredes, B. T., Rogers, R. M., Donahoe, M. P., Rosas, J. F., Daood, M. J. & Watchko, J. F. (1998) Diaphragm myosin heavy chain composition shifts in aging chronically-undernourished Fischer 344 male rats. Aging (Milan) 10:112-119.
29. He, Z.-H., Bottinelli, R., Pellegrino, M. A., Ferenczi, M. A. & Reggiani, C. (2000) ATP consumption and efficiency of human single muscle fibers with different myosin isoform composition. Biophys. J. 79:945-961.[Medline]
30. Bottinelli, R. & Reggiani, C. (2000) Human skeletal muscle fibres: molecular and functional diversity. Prog. Biophys. Mol. Biol. 73:195-262.[Medline]
31. Reggiani, C., Bottinelli, R. & Stienen, G. J. (2000) Sarcomeric myosin isoforms: fine tuning of a molecular motor. News Physiol. Sci. 15:26-33.
32. Almurshed, K. S. & Grunewald, K. K. (2000) Dietary protein does not affect overloaded skeletal muscle in rats. J. Nutr. 130:1743-1748.
33. Liu, Z., Jahn, L. A., Long, W., Fryburg, D. A., Wei, L. & Barrett, E. J. (2001) Branched chain amino acids activate messenger ribonucleic acid translation regulatory proteins in human skeletal muscle, and glucocorticoids blunt this action. J. Clin. Endocrinol. Metab. 86:2136-2143.
34. Anthony, J. C., Yoshizawa, F., Anthony, T. G., Vary, T. C., Jefferson, L. S. & Kimball, S. R. (2000) Leucine stimulates translation initiation in skeletal muscle of postabsorptive rats via a rapamycin-sensitive pathway. J. Nutr. 130:2413-2419.
35. Millward, D. J., Bates, P. C., Grimble, G. K., Brown, J. G., Nathan, M. & Rennie, M. J. (1980) Quantitative importance of non-skeletal-muscle sources of N tau-methylhistidine in urine. Biochem. J. 190:225-228.[Medline]
36. Afting, E. G., Bernhardt, W., Janzen, R. W. & Rothig, H. J. (1981) Quantitative importance of non-skeletal-muscle N tau-methylhistidine and creatine in human urine. Biochem. J. 200:449-452.[Medline]
37. Sjolin, J., Stjernstrom, H., Henneberg, S., Andersson, E., Martensson, J., Friman, G. & Larsson, J. (1989) Splanchnic and peripheral release of 3-methylhistidine in relation to its urinary excretion in human infection. Metabolism 38:23-29.[Medline]
This article has been cited by other articles:
![]() |
G. D'Antona, F. Lanfranconi, M. A. Pellegrino, L. Brocca, R. Adami, R. Rossi, G. Moro, D. Miotti, M. Canepari, and R. Bottinelli Skeletal muscle hypertrophy and structure and function of skeletal muscle fibres in male body builders J. Physiol., February 1, 2006; 570(3): 611 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Carroll, I. M. Fearnley, J. M. Skehel, M. J. Runswick, R. J. Shannon, J. Hirst, and J. E. Walker The Post-translational Modifications of the Nuclear Encoded Subunits of Complex I from Bovine Heart Mitochondria Mol. Cell. Proteomics, May 1, 2005; 4(5): 693 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-M. Iresjo, E. Svanberg, and K. Lundholm Reevaluation of amino acid stimulation of protein synthesis in murine- and human-derived skeletal muscle cells assessed by independent techniques Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E1028 - E1037. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||