![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Obesity Research Center, Departments of Biophysics and Medicine, Boston University School of Medicine, Boston, MA 02118
2To whom correspondence should be addressed. E-mail: wguo{at}bu.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
KEY WORDS: • medium-chain fatty acids • triglyceride synthesis • adipocytes
Medium-chain fatty acids (FA) are stored less efficiently in adipocytes than long-chain FA (1). Nevertheless, they are recovered in adipocytes from both visceral and subcutaneous depots in animals and humans fed medium-chain triglycerides (MCT) (2–4). Recent clinical trials showed that MCT diets effectively reduce fat mass in humans (5–9). In light of this new evidence, a better understanding of the mechanisms by which MCT influence fat tissue metabolism is clearly warranted. Early work in this area attributed the MCT effects to rapid absorption and hepatic oxidation of medium-chain FA (10–13). However, this might be only one of many possible mechanisms. Using a modified FA analysis protocol, we found that medium-chain FA accumulated to nearly 30 mol/100 mol in adipose triglycerides (TG) in MCT-fed animals (14). Because medium-chain FA have been shown to mobilize more quickly than long-chain FA (15–17), a moderate accumulation of medium-chain FA in adipocytes would indicate a substantial influx of these FA into cells in vivo. Hence, they might have a greater effect on adipocyte metabolism than previously appreciated. Elucidation of these effects in vitro will be an important step toward understanding the metabolic roles of MCT in vivo.
Early studies in this area focused on how medium-chain FA are metabolized rather than how they affect overall fuel metabolism (1,18). Poor long-term viability of isolated adipocytes made it difficult to study the effects of medium-chain FA on cellular function in vitro. In this work, we used 3T3-L1 adipocytes to investigate how medium-chain octanoate affected different aspects of energy metabolism. Some of the findings were also tested in primary cultured human adipocytes. Compared with directly isolated fat cells, cultured adipocytes can tolerate metabolic manipulations for longer periods of time and might yield new information that is otherwise difficult to acquire from isolated fat cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
3T3-L1 preadipocytes were prepared as described previously (19), except that insulin was withdrawn 6 d before the experiments were conducted. Human subcutaneous adipocytes differentiated in primary culture were purchased from Zen-Bio (Chapel Hill, NC), and maintained using vendor-provided medium and protocol.
Incorporation of glucose, lactate and H2O into cellular lipids.
Cells were washed with warm PBS and incubated in DMEM for 60 min before use. [U-14C] glucose (5 mmol/L, 2 mCi/L) or [U-14C] lactate (10 mmol/L, 5 mCi/L) was added with fresh medium with appropriate FA concentrations (see below) and incubated for 3 h. Preliminary tests showed that the amount of glucose and lactate incorporated into cellular lipids was linear for at least 6 h. By the end of 3 h incubation, the recovery rate in the cellular lipids was <1% of the total glucose or lactate present in the medium. Hence, the substrate concentration was considered to be constant during the incubation period.
Cellular TG were isolated, and FA were separated from glycerol as described (19). The incorporation of 14C into each phase was quantified by scintillation counting. Incorporation of 3H2O into FA was measured similarly, except that 3H2O was used as the tracing isotope.
Incorporation of exogenous FA into cellular lipids.
Octanoate and oleate solutions were prepared in complex with bovine serum albumin (BSA; 5:1, mol:mol) (19). This ratio was used to promote net transfer of oleate from BSA-binding sites to cells (20). BSA has a weak affinity for octanoate (21) and changing the FA/BSA ratio from 2.0 to 10.0 did not affect the esterification of octanoate (data not shown).
3T3-L1 adipocytes were incubated with FA for 5 h in Krebs-Ringer bicarbonate (KRB) buffer (pH 7.4, 5 mmol/L glucose). [1-13C] FA were used to label the esterification products, predominantly TG, in 3T3-L1 adipocytes (19). Human adipocytes were incubated with FA for 5 h in the vendor-provided medium, and [1-14C] FA was used for isotope tracing. At the end of the incubation, cells were washed with PBS containing 10 g/L BSA and the lipid fraction was extracted and quantified by NMR or by scintillation counting as described (19). The 5-h incubation time was within the linear range (19).
Although a normal plasma FA concentration is 
0.5–0.8 mmol/L and higher with fasting (22), much higher FA levels might exist in local regions during acute hydrolysis of TG. Therefore, we used FA of 0.25–4 mmol/L to encompass the possible physiological range (23).
Measurement of oxidation products.
Cells were incubated with [U-14C] glucose in DMEM (5 mmol/L glucose) for 2 h without (control) or with added FA. CO2 production from cell respiration was measured (19). To measure the oxidation of endogenous FA, cells were incubated with a trace amount of [9,10-3H] palmitate for 24 h. Cells were then maintained in normal medium for an additional 7 d to allow equilibration between the labeled and unlabeled pools. Cells were then incubated in KRB buffer for 5 h with or without added FA. The 3H2O liberated from endogenous palmitate was measured (24).
O2 consumption measurement.
Differentiated 3T3-L1 adipocytes were dissociated from culture plates using an enzyme-free cell dissociation solution containing 2 mmol/L glucose. The same solution was used as the buffer throughout the respiration measurements. O2 consumption was measured as described previously (25). About 1 x 105 cells were used for each experiment. After recording the basal O2 consumption, FA were added by injection through a pinhole while the O2 consumption was monitored continuously. At the end of the experiment, 2 nmol of carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone (FCCP) was added to uncouple the oxidative phosphorylation, and the maximum O2 consumption was recorded. Results were calculated by dividing the O2 consumption rate before and after adding FCCP as the percentage of maximum respiration.
Membrane potential measurement.
The mitochondrial membrane potential was estimated by incubating the cells for 15 min with a depolarizing buffer (pH 7.4) containing 3H-tetraphenylphosphonium (TPP+; 5 nmol/L, 0.01 mCi/L) (26). Cells were then washed with ice-cold PBS solution and solubilized with 0.1 mol/L NaOH. Because TPP+ partitions into the mitochondrial and cytosolic compartments in adipocytes in a potential-dependent fashion by dipolarizing the plasma membrane, the amount of TPP+ retained in the cells represents the amount entrapped in the mitochondria, and reflects the changes in mitochondrial membrane potential.
Assays for acyl CoA:1,2-diacylglycerol acyltransferase (DGAT) and acetyl CoA carboxylase (ACC).
DGAT activity was measured using a protocol modification of an assay of Berge et al. (27). The reaction buffer was combined with 30 µmol/L acyl CoA oleoyl CoA, 250 µmol/L 1,2-dioleoyl-sn-glycerol (25 mmol/L stock in ethanol/water, 1:1, v/v), and 30 µg crude protein, in a total volume of 0.5 mL. The concentration of [1-14C] oleoyl CoA was kept stable in all experiments (0.2 mCi/L). Preliminary tests confirmed the reaction linearity to crude protein between 25 to 50 µg, incubation time between 10 to 30 min and acyl CoA between 25 to 40 µmol/L. After incubation at 37°C for 15 min, 2.5 mL stop solution (heptane/isopropanol/NH2SO4; 40:10:1) was added, followed by 3 mL water and 3 mL heptane. The organic phase was then washed 3 times with 5 mL washing solution (isopropanol/water, 2:3). After the final wash, >95% of the background radioactivity was removed, and the incorporation of [1-14C] oleoyl CoA into TG was measured by scintillation counting.
ACC activity was determined using a modified protocol of Thampy et al. (28). The reaction was initiated by adding 25 µg cell crude protein (25 µL) to the 140 µL assay buffer (pH 7.4) containing 67 mmol/L Tris, 5 mmol/L EDTA, 5 mmol/L dithiothreitol, 20 mmol/L Mg-acetate, 0.4 g/L lactate dehydrogenase, 1 mmol/L NADH, 5 g/L FA-free BSA, 5 mmol/L ATP, 0.5 mmol/L acetyl CoA, 20 mmol/L 14C-NaHCO3 (20 mCi/L) and 13.2 mmol/L sodium citrate. The reaction was allowed to proceed for 8 min at 37°C. The incorporation of 14C bicarbonate into malonyl CoA was measured.
RNA analysis.
Total RNA was prepared and analyzed as previously described (29). The primer sequences used were (sense, ss) TGAGGAGGACCGCATTTATC and (antisense, as) GAAGCTTCCTTCGTGACCAG for ACC; (ss) CTCTACACTGCCCTCTTCGG and (as) AGACATGTCCAGTTTTCCGC for SCD-1; (ss) GGCTACTGGGATCTGAGGTG and (as) GAGACAGCTTTGGCCTTGAC for DGAT1; (ss) TCTCAGCCCTCCAAGACATC and (as) GATGCCTCCAGACATCAGGT for DGAT2; (ss) TTGCTGGCACTACAGAATGC and (as) AACAGCCTCAGAGCGACAAT for fatty acid synthase (FAS); (ss) CTGACAAGCCAGAAAAAGCC and (as) TTTGGGGTTGCCTGTAGTTC for acyl CoA synthase; (ss) GAAGGCTCCTCACTTTGCAC and (as) ACATTCAATGCCCAATCGTT for lipoprotein lipase.
Materials.
Unless otherwise indicated, all cell culture supplies were purchased from Fisher (Agawa, MA), radioisotopes from NEN (Boston, MA), 13C-labeled FA from CIL (Cambridge, MA) and other chemicals from Sigma (St. Louis, MO).
Statistics.
Data are shown as means ± SEM. Two groups were compared using Student’s t test (see Fig. 3B). Other results were analyzed using one-way ANOVA and Duncan’s multiple comparison tests. Differences were considered significant when P < 0.05.
|
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
When added to the exogenous medium, both octanoate and oleate suppressed the oxidation of glucose (Fig. 1A). The suppression by octanoate was greater at 1 mmol/L than at 0.5 mmol/L (P < 0.05), whereas there was no difference between the two concentrations of oleate. At 0.5 mmol/L, octanoate suppressed glucose oxidation to about the same extent as oleate. Similarly, both octanoate and oleate suppressed the oxidation of endogenous palmitate (Fig. 1B). Suppression by octanoate, but not oleate, was greater at the higher concentration.
|
|
Esterification of oleate increased linearly with its concentration from 0.25 to 1.5 mmol/L, with or without insulin (Fig. 3A). Any further linear increase in oleate esterification required insulin. Without insulin, esterification of oleate at high concentrations was saturated. In contrast, octanoate esterified less than oleate, and was not affected by its concentration, but was substantially increased by insulin at all FA concentrations (Fig. 3A).
A direct metabolic consequence of insulin was increased glucose uptake and increased glucose incorporation into de novo synthesized FA (data not shown). To test whether this was associated with insulin-stimulated esterification of octanoate, lactate was tested as an insulin-independent substrate for de novo FA synthesis. The addition of lactate substantially increased the esterification of octanoate but had little effect on oleate (Fig. 3B). In parallel, lactate-derived isotope was largely incorporated into de novo synthesized FA with a minor fraction into the glycerol moiety (Fig. 3C). Both octanoate and oleate suppressed the utilization of lactate in the lipid synthesis, and octanoate reduced the FA synthesis from lactate slightly more than oleate (Fig. 3C).
Octanoate caused a concentration-dependent suppression of oleate esterification (Fig. 4A). To test the physiological relevance of this finding, we repeated this experiment using human adipocytes. Similar to that in 3T3-L1 adipocytes, esterification of medium-chain FA (octanoate, decanoate and laurate) into human adipocytes was much less compared with oleate (data not shown). Octanoate suppressed the esterification of oleate in human adipocytes similar to that found in 3T3-L1 adipocytes (Fig. 4B). Such suppression reached a plateau beyond the molar ratio of octanoate:oleate of 2:1.
|
Inhibition of DGAT activity by octanoate.
Because octanoate is esterified primarily in the sn3 position in TG, especially in the presence of long-chain FA [(19) and data not shown], the above results suggest that DGAT might be the site at which octanoate interferes with oleate esterification. DGAT activity was indeed substantially reduced by the presence of octanoyl CoA (Fig. 5A). Preincubating cells with octanoate, but not oleate, for 24 h also reduced DGAT activity (Fig. 5B). This suggests that octanoate had both an acute and a sustained inhibitory effect on DGAT. The latter is probably related to a down-regulation of DGAT expression.
|
TG synthesis in adipocytes uses FA from exogenous supply, de novo synthesis, or endogenous turnover (31). Because glucose plays a key role in all of these processes, we measured the incorporation of glucose into cellular TG in the presence of different exogenous FA. Net TG synthesis (glucose incorporated into TG-glycerol) was not affected by octanoate, but was substantially increased by oleate or palmitate (Fig. 6A). Replacement of part of the oleate or palmitate with octanoate reduced net TG synthesis (data not shown). On the other hand, glucose incorporation into de novo synthesized FA was not affected by oleate or palmitate but was substantially reduced by octanoate (Fig. 6B). A similar result was found when 3H2O was used as the substrate for de novo synthesis (not shown).
|
To further determine whether the inhibitory effects of octanoate on TG synthesis were sustained, cells were pretreated with octanoate or oleate for 24 h. This did not affect the subsequent incorporation of glucose into TG-glycerol (Fig. 7A) or the esterification of exogenous oleate (data not shown). However, de novo FA synthesis was largely reduced by pretreatment with octanoate, but not oleate (Fig. 7B).
|
For cells preincubated with various FA, oleate had no effect, whereas octanoate and palmitate slightly but significantly inhibited ACC activity (Fig. 8A). Adding octanoyl CoA or oleoyl CoA to the assay mixture had no effect on ACC activity (Fig. 8B), nor did the addition of free FA (data not shown). Palmitoyl CoA, on the other hand, suppressed ACC activity substantially, as previously reported (32–34).
|
Cells pretreated with octanoate had reduced lipid metabolic enzyme activities (Figs. 5B and 7B). Because these experiments were performed after the removal of octanoate, we speculated that such inhibitory effects occurred at the enzyme expression level. To test this possibility, we measured the mRNA levels of several key enzymes involved in adipocyte lipid synthesis, Octanoate pretreatment significantly down-regulated the expression of a number of the key enzymes in lipid synthesis, including DGAT and ACC, which might correspond to the reduced enzyme activities in cells pretreated with octanoate (Table 1; Fig. 5B).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
-glycerolphosphate synthesis. This enabled a continuous linear relationship between oleate esterification and its exogenous concentration. On the other hand, insulin nearly doubled the amount of octanoate esterified into TG, independent of its concentration. This insulin effect was partially mimicked by lactate (Fig. 3B).
In normal adipocytes, most TG synthesis is catalyzed sequentially by -glycerophosphate acyltransferase, lysophosphatidate acyltransferase and DGAT. Because octanoate has no affinity for glycerophosphate acyltransferase (35), we suggest that the availability of long-chain FA to initiate the TG synthesis cascade might be an important regulatory factor for octanoate esterification into TG. Insulin stimulates de novo FA synthesis and increases the production of diacylglycerol, the precursor that reacts with octanoyl CoA to complete the final step in TG synthesis. Supplementing lactate might serve a similar purpose by increasing substrates for de novo FA synthesis (Fig. 3B,C). Similarly, adding oleate also increased octanoate esterification (Fig. 4), likely a result of oleate-stimulated diacylglycerol synthesis. At higher oleate concentrations, octanoate esterification became saturated (Fig. 4A) or even suppressed [Fig. 4B and (1)].
In spite of its low esterification rate, octanoate substantially inhibited the esterification of oleate (Fig. 4, A,B). Our data suggest that the octanoate-mediated reduction in DGAT activity might play an important role (Fig. 5A). Although octanoyl CoA has a certain affinity for DGAT [Fig. 3 (19,35)[, this affinity is nevertheless weaker than that of long-chain acyl CoA. This is caused in part by the mismatch between the strong hydrophobicity of neutral lipids (diacylglycerol and TG) and the strong hydrophilicity of octanoyl CoA. DGAT catalyzed the acylation reaction primarily at the surface of the endoplasmic reticulum (Fig. 9) (36). This requires that both substrates are bound to the enzyme and also that the substrates are suitably stabilized in the membrane. Assuming that octanoyl CoA binds to DGAT similarly to long-chain CoA, it would less stably fit into the microsomal membrane due to its poor hydrophobicity. For this reason, it esterified less efficiently than long-chain CoA, but might serve as a competitive inhibitor for the enzyme. This view is supported by the fact that all other known natural inhibitors of DGAT, including eicosapentaenoic acid, also have highly hydrophilic molecular segments that prevent a stable fit in the membranes (27,37,38).
|
The reduction in citrate-activated ACC activity in cells pretreated with octanoate was only moderate (Fig. 8A), and appeared not to be a direct inhibition by octanoyl CoA (Fig. 8B). Such a change might not be sufficient to account for the large decrease in de novo FA synthesis found in intact cells (Figs. 6,7). It is possible that the enzyme activity was substantially lower in live cells in which additional suppressive factors might be mediated by octanoate. For instance, intracellular ACC can be phosphorylated and inactivated by AMP kinase (48), and octanoate has been found to activate AMP kinase in hepatocytes (49). If this also applies to adipocytes, it might explain in part the suppression of de novo FA synthesis by octanoate. In addition, octanoate might suppress pyruvate dehydrogenase through a feedback inhibition by accumulation of octanoate-derived acetyl CoA as reported in hepatocytes (50). However, this would inhibit de novo synthesis only from glucose, not from 3H2O. Because we found that the latter was also inhibited, our data did not suggest inhibition of pyruvate dehydrogenase as a major mechanism for octanoate-mediated inhibition on de novo FA synthesis (1). On the other hand, although palmitoyl CoA substantially inhibited ACC activity in vitro (Fig. 8B), palmitate did not suppress de novo FA synthesis in intact cells (Fig. 6B). Palmitate also increased TG synthesis similarly to oleate (Fig. 6A). Therefore, although octanoate and palmitate are both saturated FA, the antilipogeneic effects of octanoate in adipocytes appear to be related to the acyl chain length rather than its saturation.
An unexpected result in this work is that although we observed suppression of the oxidation of glucose or endogenous palmitate by octanoate, such suppression was not drastic (Fig. 1) and did not affect cellular respiration or the mitochondrial membrane potential (Fig. 2). This was in contrast to earlier studies showing that octanoate potently increased O2 consumption and diminished the mitochondrial membrane potential in hepatocytes (30,51), thus suggesting different metabolic roles of octanoate and oleate in the two cell types.
In summary, we showed that octanoate markedly inhibited TG synthesis in both 3T3-L1 and human adipocytes, both acutely and long term. These findings increase our knowledge of the mechanisms by which an MCT diet may mediate body fat mass reduction.
|
FOOTNOTES |
|---|
3 Abbreviations used: ACC, acetyl CoA carboxylase; BSA, bovine serum albumin; DGAT, acyl CoA:1,2-diacylglycerol acyltransferase; FA, fatty acid(s); FAS, fatty acid synthase; FCCP, carbonyl cyanide p-(trifluoromethoxy)phenylhydrazone; KRB, Krebs-Ringer bicarbonate; MCT, medium-chain triglycerides; TG, triglycerides; TPP, tetraphenylphosphonium.
Manuscript received 31 January 2003. Initial review completed 24 February 2003. Revision accepted 5 May 2003.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
1. Maragoudakis, M. E., Kalinsky, H. J. & Lennane, J. (1975) Metabolism of octanoate and its effect on glucose and palmitate utilization by isolated fat cells. Proc. Soc. Exp. Biol. Med. 148:606-610.[Abstract]
2. Sarda, P., Lepage, G., Roy, C. C. & Chessex, P. (1987) Storage of medium-chain triglycerides in adipose tissue of orally fed infants. Am. J. Clin. Nutr. 45:399-405.
3. Hill, J. O., Peters, J. C., Lin, D., Yakubu, F., Greene, H. & Swift, L. (1993) Lipid accumulation and body fat distribution is influenced by type of dietary fat fed to rats. Int. J. Obes. Relat. Metab. Disord. 17:223-236.[Medline]
4. Kinkela, T., Chanussot, F., Bach, A., Max, J. P., Schirardin, H. & Debry, G. (1983) Effects of diets containing medium-chain and long-chain triacylglycerols in the genetically obese Zucker fa/fa rat. Composition of fatty acids and triacylglycerols of the liver and adipose tissues. Ann. Nutr. Metab. 27:404-414.[Medline]
5. St-Onge, M.-P., Ross, R., Parsons, W. D. & Jones, P.J.H. (2003) Consumption of a functional oil containing medium chain triglycerides by overweight men increases energy. Obes. Res. 11:395-402.[Medline]
6. Papamandjaris, A. A., White, M. D., Raeini-Sarjaz, M. & Jones, P. J. (2000) Endogenous fat oxidation during medium chain versus long chain triglyceride feeding in healthy women. Int. J. Obes. Relat. Metab. Disord. 24:1158-1166.[Medline]
7. Krotkiewski, M. (2001) Value of VLCD supplementation with medium chain triglycerides. Int. J. Obes. Relat. Metab. Disord. 25:1393-1400.[Medline]
8. Stubbs, R. J., Johnstone, A. M., Harbron, C. G. & Reid, C. (1998) Covert manipulation of energy density of high carbohydrate diets in ‘pseudo free-living’ humans. Int. J. Obes. Relat. Metab. Disord. 22:8885-8892.
9. Tsuji, H., Kasai, M., Takeuchi, H., Nakamura, M., Okazaki, M. & Kondo, K. (2001) Dietary medium-chain triacylglycerols suppress accumulation of body fat in a double-blind, controlled trial in healthy men and women. J. Nutr. 131:2853-2839.
10. Bach, A. C., Ingenbleek, Y. & Frey, A. (1996) The usefulness of dietary medium-chain triglycerides in body weight control: fact or fancy?. J. Lipid Res. 37:708-726.[Abstract]
11. Hamosh, M., Bitman, J., Liao, T. H., Mehta, N. R., Buczek, R. J., Wood, D. L., Grylack, L. J. & Hamosh, P. (1989) Gastric lipolysis and fat absorption in preterm infants: effect of medium-chain triglyceride or long-chain triglyceride-containing formulas. Pediatrics 83:86-92.
12. Hashim, S. A. (1967) Medium-chain triglycerides—clinical and metabolic aspects. J. Am. Diet. Assoc. 51:221-227.[Medline]
13. Greenberger, N. J., Rodgers, J. B. & Isselbacher, K. J. (1966) Absorption of medium and long chain triglycerides: factors influencing their hydrolysis and transport. J. Clin. Investig. 45:217-227.
14. Han, J., Hamilton, J. A., Kirkland, J. L., Corkey, B. E. & Guo, W. (2003) Dietary medium chain oil reduces adipose tissue mass and down regulates expression of adipogenic genes in rats. Obes. Res. in press.
15. Crozier, G., Bois-Joyeux, B., Chanez, M., Girard, J. & Peret, J. (1987) Metabolic effects induced by long-term feeding of medium-chain triglycerides in the rat. Metab. Clin. Exp. 36:807-814.
16. Knittle, J. J. & Hirsch, J. (1965) Effects of chain length on rates of uptake of free fatty acids during in vitro incubation of rat adipose tissue. J. Lipid Res. 6:565-571.[Abstract]
17. Christensen, E., Hagve, T. A., Gronn, M. & Christophersen, B. O. (1989) Beta-oxidation of medium chain (C8–C14) fatty acids studied in isolated liver cells. Biochim. Biophys. Acta 1004:187-195.[Medline]
18. Harper, R D. & Saggerson, E. D. (1976) Factors affecting fatty acid oxidation in fat cells isolated from rat white adipose tissue. J. Lipid Res. 17:516-526.[Abstract]
19. Guo, W., Choi, J. K., Kirkland, J. L., Corkey, B. E. & Hamilton, J. A. (2000) Esterification of free fatty acids in adipocytes: a comparison between octanoate and oleate. Biochem. J. 349:463-471.[Medline]
20. Kamp, F. & Hamilton, J. A. (1993) Movement of fatty acids, fatty acid analogues, and bile acids across phospholipid bilayers. Biochemistry 32:11074-11086.[Medline]
21. Cistola, D., Small, D. & Hamilton, J. A. (1987) Carbon 13NMR studies of saturated fatty acids bound to bovine serum albumin. I. The filling of individual fatty acid binding sites. J. Biol. Chem. 262:10971-10979.
22. Clore, J. N., Allred, J., White, D., Li, J. & Stillman, J. (2002) The role of plasma fatty acid composition in endogenous glucose production in patients with type 2 diabetes mellitus. Metabolism 51:1471-1477.[Medline]
23. Harper, R. D. & Saggerson, E. D. (1975) Some aspects of fatty acid oxidation in isolated fat-cell mitochondria from rat. Biochem. J. 152:485-494.[Medline]
24. Wang, T., Lin, W. H., Corkey, B. E. & Guo, W. (2003) Regulation of adipocyte fatty acid oxidation. Obes. Res. in press.
25. Civelek, V. N., Deeney, J. T., Shalosky, N. J., Tornheim, K., Hansford, R. G., Prentki, M. & Corkey, B. E. (1996) Regulation of pancreatic beta-cell mitochondrial metabolism: influence of Ca2+, substrate and ADP. Biochem. J. 318:615-621.
26. Zhang, H., Bolton, T. B., Piekarska, A. E. & McPherson, G. A. (1998) The electrophysiological effects of tetraphenylphosphonium on vascular smooth muscle. Eur. J. Pharmacol. 347:119-123.[Medline]
27. Berge, R. K., Madsen, L., Vaagenes, H., Tronstad, K. J., Gottlicher, M. & Rustan, A. C. (1999) In contrast with docosahexaenoic acid, eicosapentaenoic acid and hypolipidaemic derivatives decrease hepatic synthesis and secretion of triacylglycerol by decreased diacylglycerol acyltransferase activity and stimulation of fatty acid oxidation. Biochem. J. 343:191-197.
28. Thampy, G. K., Haas, M. J. & Mooradia, A. D. (2000) Troglitazone stimulates acetyl-CoA carboxylase activity through a post-translational mechanism. Life Sci. 68:699-708.[Medline]
29. Han, J., Farmer, S. R., Kirkland, J. L., Corkey, B. E., Yoon, R., Pirtskhalava, T., Ido, Y. & Guo, W. (2002) Octanoate attenuates adipogenesis in 3T3–L1 preadipocytes. J. Nutr. 132:904-910.
30. Soboll, S., Grundel, S., Schwabe, U. & Scholz, R. (1984) Influence of fatty acids on energy metabolism. 2. Kinetics of changes in metabolic rates and changes in subcellular adenine nucleotide contents and pH gradients following addition of octanoate and oleate in perfused rat liver. Eur. J. Biochem. 141:231-236.[Medline]
31. Green, H. & Kehinde, O. (1975) An established preadipose cell line and its differentiation in culture. II. Factors affecting the adipose conversion. Cell 5:19-27.[Medline]
32. Ogiwara, H., Tanabe, T., Nikawa, J. & Numa, S. (1978) Inhibition of rat-liver acetyl-coenzyme-A carboxylase by palmitoyl-coenzyme A. Formation of equimolar enzyme-inhibitor complex. Eur. J. Biochem. 89:33-41.[Medline]
33. Halestrap, A. P. & Denton, R. M. (1973) Insulin and the regulation of adipose tissue acetyl-coenzyme A carboxylase. Biochem. J. 132:509-517.[Medline]
34. Goodridge, A. G. (1972) Regulation of the activity of acetyl coenzyme A carboxylase by palmitoyl coenzyme A and citrate. J. Biol. Chem. 247:6946-6952.
35. Mayorek, N. & Bar-Tana, J. (1983) Medium chain fatty acids as specific substrates for diglyceride acyltransferase in cultured hepatocytes. J. Biol. Chem. 258:6789-6792.
36. Chen, H. C. & Farese, R. V., Jr. (2000) DGAT and triglyceride synthesis: a new target for obesity treatment?. Trends Cardiovasc. Med. 10:188-192.[Medline]
37. Tabata, N., Ito, M., Tomoda, H. & Omura, S. (1997) Xanthohumols, diacylglycerol acyltransferase inhibitors, from Humulus lupulus. Phytochemistry 46:683-687.[Medline]
38. Tomoda, H., Ohyama, Y., Abe, T., Tabata, N., Namikoshi, M., Yamaguchi, Y., Masuma, R. & Omura, S. (1999) Roselipins, inhibitors of diacylglycerol acyltransferase, produced by Gliocladium roseum KF-1040. J. Antibiot. 52:689-694.[Medline]
39. Cases, S., Smith, S. J., Zheng, Y. W., Myers, H. M., Lear, S. R., Sande, E., Novak, S., Collins, C., Welch, C. B., Lusis, A. J., Erickson, S. K. & Farese, R. V., Jr. (1998) Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis. Proc. Natl. Acad. Sci. U.S.A. 95:13018-13023.
40. Cases, S., Stone, S. J., Zhou, P., Yen, E., Tow, B., Lardizabal, K. D., Voelker, T. & Farese, R. V., Jr. (2001) Cloning of DGAT2, a second mammalian diacylglycerol acyltransferase, and related family members. J. Biol. Chem. 276:38870-38876.
41. Stals, H. K., Top, W. & Declercq, P. E. (1994) Regulation of triacylglycerol synthesis in permeabilized rat hepatocytes. Role of fatty acid concentration and diacylglycerol acyltransferase. FEBS Lett. 343:99-102.[Medline]
42. Meegalla, R. L., Billheimer, J. T. & Cheng, D. (2002) Concerted elevation of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) activity through independent stimulation of mRNA expression of DGAR1 and DGAT2 by carbohydrate and insulin. Biochem. Biophys. Res. Commun. 298:317-323.[Medline]
43. Thurmond, D. C., Baillie, R. A. & Goodridge, A. G. (1998) Regulation of the action of steroid/thyroid hormone receptors by medium-chain fatty acids. J. Biol. Chem. 273:15373-15381.
44. Lee, J. J., Smith, P. J. & Fried, S. K. (1998) Mechanisms of decreased lipoprotein lipase activity in adipocytes of starved rats depend on duration of starvation. J. Nutr. 128:940-946.
45. Sul, H. S., Latasa, M. J., Moon, Y. & Kim, K. H. (2000) Regulation of the fatty acid synthase promoter by insulin. J. Nutr. 130:315S-320S.
46. Hillgartner, F. B. & Charron, T. (1997) Arachidonate and medium-chain fatty acids inhibit transcription of the acetyl-CoA carboxylase gene in hepatocytes in culture. J. Lipid Res. 38:2548-2557.[Abstract]
47. Roncero, C. & Goodridge, A. G. (1992) Hexanoate and octanoate inhibit transcription of the malic enzyme and fatty acid synthase genes in chick embryo hepatocytes in culture. J. Biol. Chem. 267:14918-14927.
48. Winder, W. W. (2001) Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle. J. Appl. Physiol. 91:1017-1028.
49. Kawaguchi, T., Osatomi, K., Yamashita, H., Kabashima, T. & Uyeda, K. (2002) Mechanism for fatty acid sparing effect on glucose-induced transcription. J. Biol. Chem. 277:3829-3835.
50. Stucki, J. W., Bravand, F. & Walter, P. (1972) Regulation of pyruvate metabolism in rat liver mitochondria by adenine nucleotides and fatty acids. Eur. J. Biochem. 27:181-186.[Medline]
51. Scholz, R., Schwabe, U. & Soboll, S. (1984) Influence of fatty acids on energy metabolism. 1. Stimulation of oxygen consumption, ketogenesis and CO2 production following addition of octanoate and oleate in perfused rat liver. Eur. J. Biochem. 141:223-230.[Medline]
This article has been cited by other articles:
|
|
 |
|
  W. Guo, S. Wong, W. Xie, T. Lei, and Z. Luo Palmitate modulates intracellular signaling, induces endoplasmic reticulum stress, and causes apoptosis in mouse 3T3-L1 and rat primary preadipocytes Am J Physiol Endocrinol Metab, August 1, 2007; 293(2): E576 - E586. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. W. Castellani, P. Gargalovic, M. Febbraio, S. Charugundla, M.-L. Jien, and A. J. Lusis Mechanisms mediating insulin resistance in transgenic mice overexpressing mouse apolipoprotein A-II J. Lipid Res., December 1, 2004; 45(12): 2377 - 2387. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
