QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chung, F.-L. Articles by Yang, Y.-M. Search for Related Content PubMed PubMed Citation Articles by Chung, F.-L. Articles by Yang, Y.-M.

---

Supplement: Proceedings of the Third International Scientific Symposium on Tea and Human Health

Tea and Cancer Prevention: Studies in Animals and Humans¹

American Health Foundation Cancer Center, Institute for Cancer Prevention, Valhalla, NY 10595

²To whom correspondence should be addressed. E-mail: chungahf{at}aol.comfchung@ifcp.us.

	ABSTRACT

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 
The role of tea in protection against cancer has been supported by ample evidence from studies in cell culture and animal models. However, epidemiological studies have generated inconsistent results, some of which associated tea with reduced risk of cancer, whereas others found that tea lacks protective activity against certain human cancers. These results raise questions about the actual role of tea in human cancer that needs to be addressed. This article is intended to provide a better perspective on this controversy by summarizing the laboratory studies in animals and humans with emphasis on animal tumor bioassays on skin, lung, mammary glands and colon, and the molecular and cellular mechanisms affected by tea. Finally, a recent small pilot intervention study with green tea in smokers is presented.

KEY WORDS: • green tea • black tea • lung cancer • oral cancer • smokers • antioxidant

The role of tea in cancer prevention is supported by results from a large number of studies in cell culture and tumor bioassays in animal models carried out over more than a decade. However, results of epidemiological studies on tea and cancer have been inconsistent; some show consumption of tea is protective, whereas others show it either has no association with cancer or even increases the risk of certain cancers (1). Clearly, there is a gap between population-based studies and animal studies. These discrepancies between laboratory and epidemiological studies raise questions on whether consumption of tea can really reduce the risk of human cancers. The purpose of this paper is to review animal tumor bioassay studies published in the past decade or so with a focus on four major cancer sites: colon, mammary, skin and lung; and to outline a summary of the known mechanisms of action of tea. Our previous studies of green and black tea and lung tumorigenesis are also briefly discussed. To bridge the gap of information between the animal and human studies, the mechanisms of action of tea established in cell culture and animal studies were verified in humans by a recent intervention trial in which the effects of green tea were investigated in the oral cells of smokers. The intervention study, although preliminary, is also discussed. The background information presented here is needed for a proper perspective of the role of tea in cancer prevention.

	Tumor bioassays in rodents

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 
Over the past decade, there have been >80 published studies showing protective effects of tea, including both green and black tea, against tumorigenesis in animal models. Table 1 indicates the number of these studies according to the organ site. The most extensively studied organ site for the potential protective effect of tea is skin, followed by lung, liver, forestomach, mammary gland and colon. Table 2 summarizes the animal models, tumor bioassay protocols, tumor outcome and stages of tumorigenesis based on the organ sites in which tea appeared to work. In all the models, various carcinogens, including the environmentally relevant or synthetic, were used to induce tumors. Tea preparations included green tea and black tea (both caffeinated and decaffeinated), or total extracts of tea polyphenols. Sometimes the purified compound, such as epigallocatechin gallate (EGCG)² of green tea was used. Tea, in most of the studies, was administered in place of drinking water. In the study of skin tumorigenesis, tea preparation was also applied topically. Both adenomas and adenocarcinomas were examined in all organ sites. Treatment with tea appeared to inhibit tumor multiplicity (number of tumors/animal) as well as incidence (percentage of tumor bearing animals) in these models. Although some bioassays do not distinguish the stages, i.e., initiation, promotion and progression, in which tumorigenesis is inhibited by tea, it is safe to say that in the majority of these studies, if not all, tea has been shown to block tumorigenesis in at least one of the multiple stages of tumorigenesis.

	Inhibition of lung tumorigenesis

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

The carcinogen used in our animal studies was NNK, a nicotine-derived nitrosamine, which is formed during tobacco curing and smoking. NNK has been shown to be a potent lung carcinogen in rodents whose target organ specificity toward the lung is independent of the route of administration (3). The two most commonly used animal models to study NNK-induced lung tumorigenesis are the A/J mouse and the F344 rat. The broader spectrum of tumor sites and the development of adenocarcinomas and adenosquamous carcinomas upon chronic administration of NNK are the important features of the F344 rat model. Therefore, whereas the A/J mouse model is more economical and practical, the F344 rat is considered to be a more important and relevant model for lung cancer in smokers.

Effect of green tea, EGCG and caffeine on lung cancer in the A/J mouse.

In this bioassay, we examined the effects of green tea and its major constituents, EGCG and caffeine, on lung tumor development in A/J mice treated with NNK (4). The treatment protocol included chronic administration of NNK by gavage three times per week from wk 2 to wk 12, at a total dose of 11.7 mg/kg of body weight. Animals were divided into groups shown in Table 3. Green tea (2%) and EGCG and caffeine at the concentrations found in the tea, 560 and 1120 mg/kg, respectively, were given in drinking water to the NNK-treated groups 2, 3, and 4, from wk 0 to wk 13. The bioassay was terminated after wk 18. The average body weights for groups 2 and 5, given green tea, were consistently lower than groups 1 and 3 that drank water, and water containing EGCG, respectively. This loss in body weight was likely due to caffeine in green tea, because similar weight losses were observed in the groups given caffeine (groups 4 and 7) in drinking water. The results of this bioassay showed that the 2% green tea inhibited NNK-induced lung tumors per mouse by 45% as compared with the NNK group given only water. EGCG appeared to be the major active ingredient in green tea because it reduced lung tumor multiplicity by 30%. Interestingly, caffeine also inhibited lung tumor formation slightly, but significantly. The inhibitory effect of caffeine may be in part associated with its negative effect on body weight.

View larger version (60K): [in this window] [in a new window]   FIGURE 1 Effects of green tea and epigallocatechin gallate (EGCG) on the 8-hydroxydeoxyguanosine (8-OHdG) levels in lung and liver DNA of A/J mice 2 h after 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) treatment. *Statistically different from the control group; **statistically different from the NNK group.

Most animal studies on tea and cancer reported in the literature involve the study of the effects of green tea. Relatively few studies have investigated the potential of black tea as an inhibitor against carcinogenesis, even though black tea production accounts for >75% of total tea production worldwide (5). The chemical composition of black tea differs significantly from that of green tea because of the extensive oxidation of catechins during manufacturing. The oxidation products found in black tea, thearubigins and theaflavins also possess antioxidant activity (6), suggesting that black tea may inhibit NNK-induced lung tumorigenesis. Indeed, bioassays in A/J mice have shown that black tea, given as drinking water, retarded the development of lung cancer caused by treatment with NNK as described above (4). However, there has been a lack of data on the effect of tea on lung tumorigenesis in F344 rats. A two-year lifetime bioassay in F344 rats was conducted to examine the effects of black tea and caffeine on lung tumorigenesis induced by NNK (7).

In this bioassay, animals were divided into six groups, as shown in Table 4. Beginning at age 7 wk, animals in group 1 were given only deionized water; those in groups 2a, 2b, and 2c were given tea as drinking water at three dose levels, 2, 1 and 0.5%, respectively. Rats in groups 3a and 3b were given water containing caffeine at 680 and 170 mg/kg, respectively, concentrations identical to those found in 2 and 0.5% tea infusions. One week later, animals in groups 1 to 3 were administered NNK at a dose of 1.5 mg/kg body weight by subcutaneous injection three times weekly for 20 wk for a total of 90 mg/kg body weight. Animals received tea or caffeine for 22 wk, beginning one week before to one week after the NNK treatment. In groups 4 and 5, rats were given 2% tea and 680 ppm caffeine in drinking water, respectively, without carcinogen. Group 6 served as the control without any treatment. The bioassay was terminated during week 101; all major organs and gross lesions were harvested during necropsy and fixed in 10% buffered formalin solution. Representative sections were obtained and processed for microscopic examination. Tumor incidence was determined by dividing the number of animals with tumors by the number of animals in each group.

Although the lung is the major target organ, NKK also induces tumors in the liver and nasal cavity. In group 1, 11 out of 32 animals developed hepatic tumors (34%). All of the tumor-bearing animals had adenomas and only two developed hepatocellular carcinomas. The only group that showed a significant decrease in liver tumor incidence was group 2a with a 12% incidence (P < 0.05). A total of 11 animals developed liver adenomas in group 1, whereas there were only two rats with liver tumors in group 2a (P < 0.05). In the nasal mucosa, 19% of the animals in group 1 developed tumors, all of which were benign. The incidences of nasal cavity tumors in all treatment groups were not significantly different from one another.

	Mechanisms of tumor inhibition by tea

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 
Studies have been conducted to understand the in vivo mechanisms of tumor inhibition by tea in skin, lung, colon and prostate. Lu et al. showed that green tea and caffeine enhance UV-induced apoptosis and p53 positive and p21waf1-positive skin cells in SKH-1 mice (8). Administration of green tea as drinking water induces apoptosis in lung adenomas that developed in A/J mice after exposure to NNK (9). August et al. showed that green tea causes a significant reduction in prostaglandine E synthesis in rectal mucosa of human volunteers, suggesting the active compounds in tea inhibit the cycloxygenases (10). Gupta et al. showed that green tea polyphenols inhibit cell growth and induce apoptosis of prostate cancer cells in TRAMP mice (11). These studies point to a common underlying mechanism of tea, i.e., tea polyphenols seem able to modulate cell growth by arresting the cell cycle or inducing apoptosis. Both of these cellular effects may result in protection against tumor development.

p53 plays a pivotal role in protecting cells from various stresses including DNA damage, oncogene stimulation and changes in cellular redox potential (12). It regulates cell cycle arrest and apoptosis in response to certain stresses in its role as a tumor suppressor. EGCG and theaflavin digallate are inhibitors of cell growth, and both agents induce a significant antiproliferative and proapoptotic effect on various cell types including human oral epithelial cells (13–18). As mentioned above, studies in animals indicate that tea polyphenols increase p53 levels and concomitant induction of apoptosis by stresses such as UVB, which are known to activate p53-mediated apoptosis (8,14,17). Caffeine also sensitizes cells to the effects of genotoxic agents and has been shown to concomitantly increase p53 activity (8). Tea polyphenols are antioxidants and their effects on cell growth and apoptosis may be mediated by this activity. Certain antioxidants, such as N-acetylcysteine, have been shown to increase p53 biosynthesis because of their effects on the redox potential of the cell (19). Antioxidants alter the redox potential in a way that mimics hypoxia, which is also known to activate p53 (20,21). These activities may account in part for an enhanced p53 response in cells exposed to tea. The activity of tea on p53 may provoke growth arrest or apoptosis in exposed cells, which constitutes an additional mechanism for the observed protective effect against tumorigenesis by tea through the sensitization of DNA-damaged cells to apoptosis.

Previous studies have also shown that tea polyphenols inhibit AP-1 activity (18,22,23). AP-1 is a multifaceted transcription factor, which affects a range of biologic responses and its role in apoptosis is complex (24,25). It has been shown to activate the transcription of the proapoptotic death ligand Fas/APO-1 (26), which would promote apoptosis, while it also directly represses p53 gene transcription (24). Downregulation of AP-1 by tea polyphenols may therefore alleviate this repression, contributing to the increased p53 levels and increased sensitivity to stress induction of apoptosis seen in tea-treated cells. It is possible that smoking-related carcinogens and tea cooperate or synergize to enhance the growth arrest and apoptotic response mediated by the p53 pathways, which they have been shown to activate independently. We have conducted a small intervention study in smokers to delineate these interactions in the oral mucosa as a model to study potential mechanisms of chemoprevention by tea in humans (see below).

In addition to the effects of tea on the signal pathways-mediated cell growth, tea polyphenols are known to have antioxidant activities. As described above, administration of EGCG in drinking water or of green tea resulted in reduced levels of 8-OHdG in the lung DNA of A/J mice. Other studies have also shown that green tea inhibited the activity of phase I enzymes and induced phase II enzymes. Therefore, it appears that tea and its polyphenolic compounds are versatile compounds capable of exerting effects on various enzymes and cellular pathways. Together, these mechanisms may be responsible for the protective effects of tea against carcinogenesis.

	Intervention trial in smokers

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 
A double-blind intervention trial was conducted in which 64 patients of both sexes, mostly smokers with oral leukoplakia, a preneoplastic lesion, took daily capsules containing a total of 0.38 g of green tea extract, green tea polyphenols and black tea polyphenols (theaflavins and thearubigins), roughly equivalent to the consumption of 800 mL of brewed tea per day for six months (27). During the study period, tea mix in glycerin was also topically applied to the lesions. The placebo group received the same amount of capsules containing only starch and coloring agents with only glycerin. Results showed that oral lesions were significantly reduced in 38% of patients treated with tea mix as compared with 10% of patients in the placebo group. This study also reported that the incidence of micronucleated exfoliated oral mucosal cells was significantly lowered in the tea-treated group (5.4/1000 cells) as compared with that of the control placebo group (11.3/1000 cells). The cell proliferative index in the oral mucosal cell nuclei also appeared to be lower than in the control placebo group. To the best of our knowledge, this study is the first clinical trial to provide direct evidence of the protective effect of tea against human cancer, and provides a unique opportunity for the investigation of mechanisms of cancer prevention by tea in humans. Based on this model, we conducted a pilot study to examine the effects of green tea on the DNA damage induced by smoking and the molecular/cellular response in oral cells of smokers.

Molecular/cellular effects of green tea in oral cells of smokers.

A pilot study was conducted with three smokers using a 4-wk treatment protocol. Each subject was provided with 35 bags of green tea powder per week after the first visit for baseline sample collection and each bag contained 400 mg of green tea powder (provided by Dr. Agarwal of Lipton, Bestfoods). They were asked to use two bags in the morning, two in the afternoon, and one after dinner. On wk 0 (baseline), wk 1, 2, 3 and 4, oral cells were harvested using a nylon bristle cytobrush of medium stiffness and stored at -80°C. Subjects showed no signs of any side effects during the tea treatment. Oral cells collected at each visit were divided into portions for apoptosis, p21 (RT-PCR), p53 and DNA adduct assays.

    Enhanced apoptosis of oral cells in smokers after drinking green tea. Our previous studies, using flow cytometric analysis based on fragmented nuclear DNA, number and size, showed that the oral tissue of smokers contains a higher percentage of apoptotic cells than nonsmokers. We observed a trend of increasing apoptotic cells by tea treatment. This was confirmed in the current study using the Mebstain (TUNEL) assay with laser scanning cytometry and fluorescence detection which indicated that the number of oral cells undergoing apoptosis, expressed as apoptotic index, increased as tea treatment progressed (Fig. 2). A 2.5-fold individual variation was seen among three smokers during the final week of treatment. These results showed a trend of increasing apoptosis in oral cells of smokers by the green tea treatment.

View larger version (24K): [in this window] [in a new window]   FIGURE 2 Mebstain (TUNEL) assay of oral cells obtained from a smoker following administration of green tea. Scatter plot analysis using laser scanning cytometry, number of threshold-determined cells averaging 10,000 per sample and percentage of stained cells using TUNEL (Mebstain) is indicated from low to high in comparison to the area (low to high).

View larger version (40K): [in this window] [in a new window]   FIGURE 3 RT-PCR analysis of p21 induction in the oral mucosa of a smoker during tea consumption. 1, cells collected 3 d prior to tea consumption; 2, cells collected 3 d after tea consumption began; 3, cells 10 d after tea consumption began; 4, cells 14 d after tea consumption began; 5, cells 21 d after tea consumption began. GADPH expression controls for RNA level in each reaction. PCR primers used are (5'-3'): p21F CCCAAGCTCTACCTTCCCAC; p21R CGACCCTGAGAGTCTCCAGG; GADPH1F GTATTGGGCGCCTGGTCACC; GADPH1R CAGTGGACTCCACGACGTAC.

	Future studies

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 
To provide additional evidence to support the role of tea in cancer prevention is an important future research goal. Several study areas could be emphasized. More detailed molecular/cellular mechanism studies in animals and humans are needed because the results of these studies will help to verify the effects of tea in humans by comparison with studies in animals. The interactions between tea polyphenols and environmental carcinogens have not been extensively investigated; this is an important area requiring additional data. Furthermore, the potential interactions of active compounds in tea with other dietary active components and the roles of polymorphisms on the protective effects of tea need to be examined in future studies. Ultimately, clinical intervention trials should be conducted to verify the mechanisms of action of tea observed in animal studies in which tea is protective.

	FOOTNOTES

 
¹ Presented as part of "The Third International Scientific Symposium on Tea and Human Health: Role of Flavonoids in the Diet," given at the United States Department of Agriculture, September 23, 2002. This conference was sponsored by the American Cancer Society, American College of Nutrition, American Health Foundation, American Society for Nutritional Sciences, Food and Agriculture Organization, and the Linus Pauling Institute at Oregon State University and was supported by a grant from the Tea Council of the U.S.A. Guest editor for this symposium was Jeffrey Blumberg, PhD, Jean Mayer USDA Human Nutrition Research Center on Aging, Tufts University, Boston, MA 02111.

³ Abbreviations used: BaP, buno(a)pyrene; EGCG, epigallocatechin gallate; 8-OHdG, 8-hydroxydeoxyguanosine; NNK, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone; PAH, polyaromatic hydrocarbon.

	LITERATURE CITED

TOP ABSTRACT Tumor bioassays in rodents Inhibition of lung tumorigenesis Mechanisms of tumor inhibition... Intervention trial in smokers Future studies LITERATURE CITED

 

1. Yang, C. S., Chung, J. Y., Yang, G., Chhabra, S. K. & Lee, M. J. (2000) Tea and tea polyphenols in cancer prevention. J. Nutr. 130:472S-478S.

2. Wynder, E. L., Taioli, E. & Fujita, Y. (1992) Ecologic study of lung cancer risk factors in the U.S. and Japan, with special reference to smoking and diet. Jpn. J. Cancer Res. 83:418-423.[Medline]

3. Hoffmann, D., Rivenson, A., Chung, F. L. & Hecht, S. S. (1991) Nicotine-derived N-nitrosamines (TSNA) and their relevance in tobacco carcinogenesis. CRC Crit. Rev. Toxicol. 21:305-311.

4. Xu, Y., Ho, C. T., Amin, S. G., Han, C. & Chung, F. L. (1992) Inhibition of tobacco-specific nitrosamine-induced lung tumorigenesis in A/J mice by green tea and its major polyphenol as antioxidants. Cancer Res. 52:3875-3879.[Abstract/Free Full Text]

5. International Tea Committee (1989) 1989 Annual Bulletin of Statistics London .

6. Ho, C. T., Chen, C. W., Wanasundara, U. N. & Shahidi, F. (1997) Natural antioxidants from tea. Shahidi, F. eds. Natural Antioxidants: Chemistry, Health Effects and Applications 1997 American Oil Chemists, Society Press Champaign, IL. .

7. Chung, F. L., Wang, M., Rivenson, A., Iatropoulos, M. I., Reinhardt, J., Pittman, B., Ho, C. T. & Amin, S. G. (1998) Inhibition of lung carcinogenesis by black tea in Fischer rats treated with a tobacco-specific carcinogen: caffeine as an important constituent. Cancer Res. 58:4096-4101.[Abstract/Free Full Text]

8. Lu, Y. P., Lou, Y. R., Li, X. H., Xie, J. G., Brash, D., Huang, M. T. & Conney, A. H. (2000) Stimulatory effect of oral administration of green tea or caffeine on ultraviolet light-induced increases in epidermal wildtype p53, p21(WAF1/CIP1), and apoptotic sunburn cells in SKH-1 mice. Cancer Res. 60:4785-4791.[Abstract/Free Full Text]

9. Liao, J., Yang, G. Y., Park, E. S., Meng, X., Ho, K.K.L., Jia, D., Seril, D. N. & Yang, C. S. (2001) Inhibition of angiogenesis and induction of cell apoptosis during lung carcinogenesis by green tea in A/J mice. Proc. Amer. Assn. Cancer Res. 42:575.

10. August, D. A., Landau, J. M., Caputo, D., Hong, J., Lee, M. & Yang, C. S. (1999) Ingestion of green tea rapidly decreases prostaglandin E₂ levels in rectal mucosa in humans. Cancer Epidemiol. Biomark. Prev. 8:709-713.[Abstract/Free Full Text]

11. Gupta, S., Hastak, K., Ahmad, N., Lewin, J. S. & Mukhtar, H. (2001) Inhibition of prostate carcinogenesis in TRAMP mice by oral infusion of green tea polyphenols. Proc. Natl. Acad. Sci. U.S.A. 8:10350-10355.

12. Vogelstein, B., Lane, D. & Levine, A. J. (2000) Surfing the p53 network. Nature 408:307-310.[Medline]

13. Ahmad, N., Cheng, P. & Mukhtar, H. (2000) Cell cycle dysregulation by green tea polyphenol epigallocatechin-3-gallate. Biochem. Biophys. Res. Commun. 275:328-334.[Medline]

14. Ahmad, N., Feyes, D. K., Nieminen, A. L., Agarwal, R. & Mukhtar, H. (1997) Green tea constituent epigallocatechin-3-gallate and induction of apoptosis and cell cycle arrest in human carcinoma cells. J. Natl. Cancer Inst. 89:1881-1886.[Abstract/Free Full Text]

15. Liang, Y. C., Lin-Shiau, S. Y., Chen, C. F. & Lin, J. K. (1999) Inhibition of cyclin-dependent kinases 2 and 4 activities as well as induction of cdk inhibitors p21 and p27 during growth arrest of human breast carcinoma cells by EGCG, J. Cell Biochem. 75:1-12.

16. Katdare, M., Osborne, M. P. & Telang, N. T. (1998) Inhibition of aberrant proliferation and induction of apoptosis in pre-neoplastic human mammary epithelial cells by natural phytochemicals. Oncol. Rep. 5:311-315.[Medline]

17. Yang, G. Y., Liao, J., Kim, K., Yurkow, E. J. & Yang, C. S. (1998) Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols. Carcinogenesis 19:611-616.[Abstract/Free Full Text]

18. Yang, G. Y., Liao, J., Li, C., Chung, J., Yurkow, E. J., Ho, C. T. & Yang, C. S. (2000) Effect of black and green tea polyphenols on c-jun phosphorylation and H₂O₂ production in transformed and non-tranformed human bronchial cell lines: possible mechanisms of cell growth inhibition and apoptosis induction. Carcinogenesis 21:2035-2039.[Abstract/Free Full Text]

19. Liu, M., Pelling, J. C., Ju, J., Chu, E. & Brash, D. E. (1998) Antioxidant action via p53-mediated apoptosis. Cancer Res. 58:1723-1729.[Abstract/Free Full Text]

20. Jayaraman, L., Murthy, K. G., Zhu, C., Curran, T., Xanthoudakis, S. & Prives, C. (1997) Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev. 11:558-570.[Abstract/Free Full Text]

21. Graeber, T. G., Osmanian, C., Jacks, T., Housman, D. E., Koch, C. J., Lowe, S. W. & Giaccia, A. J. (1996) Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumors. Nature 379:88-91.[Medline]

22. Chung, J. Y., Huang, C., Meng, X., Dong, Z. & Yang, C. S. (1999) Inhibition of activator protein 1 activity and cell growth by purified green tea and black tea polyphenols in H-ras-transformed cells: structure-activity relationship and mechanisms involved. Cancer Res. 15:4610-4617.

23. Chen, W., Dong, Z., Valcic, S., Timmermann, B. N. & Bowden, G. T. (1999) Inhibition of ultraviolet B-induced c-fos gene expression and p38 mitogen-activated protein kinase activation by (-)-epigallocatechin gallate in a human keratinocyte cell line. Mol. Carcinog. 24:79-84.[Medline]

24. Leppa, S. & Bohmann, D. (1999) Diverse functions of JNK signaling and c-Jun in stress response and apoptosis. Oncogene 18:6158-6162.[Medline]

25. Karin, M. (1995) The regulation of AP-1 activity by mitogen-activated protein kinases. J. Biol. Chem. 270:16483-16486.[Free Full Text]

26. Eichhorst, S. T., Muller, M., Li-Weber, M., Schulze-Bergkamen, H., Angel, P. & Krammer, P. H. (2000) A novel AP-1 element in the CD95 ligand promoter is required induction of apoptosis in hepatocellular carcinoma cells upon treatment with anticancer drugs. Mol. Cell Biol. 20:7826-7837.[Abstract/Free Full Text]

27. Li, N., Sun, Z., Han, C. & Chen, J. (1999) The chemopreventive effects of tea on human oral precancerous mucosa lesions. Proc. Soc. Exp. Biol. Med. 220:218-224.[Medline]

28. Chacko, M. & Gupta, R. C. (1988) Evaluation of DNA damage in the oral mucosa of tobacco users and non-users by ³²P-adduct assay. Carcinogenesis 9:2309-2313.[Abstract/Free Full Text]

This article has been cited by other articles:

				H. Xiao, X. Hao, B. Simi, J. Ju, H. Jiang, B. S. Reddy, and C. S. Yang Green tea polyphenols inhibit colorectal aberrant crypt foci (ACF) formation and prevent oncogenic changes in dysplastic ACF in azoxymethane-treated F344 rats Carcinogenesis, January 1, 2008; 29(1): 113 - 119. [Abstract] [Full Text] [PDF]

				C. A. Rowe, M. P. Nantz, J. F. Bukowski, and S. S. Percival Specific Formulation of Camellia sinensis Prevents Cold and Flu Symptoms and Enhances {gamma}{delta} T Cell Function: A Randomized, Double-Blind, Placebo-Controlled Study J. Am. Coll. Nutr., October 1, 2007; 26(5): 445 - 452. [Abstract] [Full Text] [PDF]

				J. R. Carlson, B. A. Bauer, A. Vincent, P. J. Limburg, and T. Wilson Reading the Tea Leaves: Anticarcinogenic Properties of (-)-Epigallocatechin-3-Gallate Mayo Clin. Proc., June 1, 2007; 82(6): 725 - 732. [Abstract] [Full Text] [PDF]

				W. Liang, C. W. Binns, L. Jian, and A. H. Lee Does the Consumption of Green Tea Reduce the Risk of Lung Cancer Among Smokers? Evid. Based Complement. Altern. Med., March 1, 2007; 4(1): 17 - 22. [Abstract] [Full Text] [PDF]

				G. Lu, J. Liao, G. Yang, K. R. Reuhl, X. Hao, and C. S. Yang Inhibition of Adenoma Progression to Adenocarcinoma in a 4-(Methylnitrosamino)-1-(3-Pyridyl)-1-Butanone-Induced Lung Tumorigenesis Model in A/J Mice by Tea Polyphenols and Caffeine Cancer Res., December 1, 2006; 66(23): 11494 - 11501. [Abstract] [Full Text] [PDF]

				L. H. Kushi, T. Byers, C. Doyle, E. V. Bandera, M. McCullough, T. Gansler, K. S. Andrews, M. J. Thun, and The American Cancer Society 2006 Nutrition and Phy American Cancer Society Guidelines on Nutrition and Physical Activity for Cancer Prevention: Reducing the Risk of Cancer With Healthy Food Choices and Physical Activity CA Cancer J Clin, September 1, 2006; 56(5): 254 - 281. [Abstract] [Full Text] [PDF]

				K. Rezai-Zadeh, D. Shytle, N. Sun, T. Mori, H. Hou, D. Jeanniton, J. Ehrhart, K. Townsend, J. Zeng, D. Morgan, et al. Green Tea Epigallocatechin-3-Gallate (EGCG) Modulates Amyloid Precursor Protein Cleavage and Reduces Cerebral Amyloidosis in Alzheimer Transgenic Mice J. Neurosci., September 21, 2005; 25(38): 8807 - 8814. [Abstract] [Full Text] [PDF]

				J. D Lambert, J. Hong, G.-y. Yang, J. Liao, and C. S Yang Inhibition of carcinogenesis by polyphenols: evidence from laboratory investigations Am. J. Clinical Nutrition, January 1, 2005; 81(1): 284S - 291S. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chung, F.-L. Articles by Yang, Y.-M. Search for Related Content PubMed PubMed Citation Articles by Chung, F.-L. Articles by Yang, Y.-M.