|
|
|
|
Signaling and Activation of Porcine Endothelial Cells1

,2
* Molecular and Cell Nutrition Laboratory, College of Agriculture,
Graduate Center for Nutritional Sciences and
** Department of Surgery, University of Kentucky, Lexington, KY 40546-0215
2To whom correspondence should be addressed. E-mail: bhennig{at}uky.edu.
| ABSTRACT |
|---|
|
|
|---|
in endothelial cell dysfunction and the role of zinc in the modulation of PPAR
signaling, cultured porcine pulmonary artery endothelial cells were exposed to the membrane-permeable zinc chelator N,N,N'N'-tetrakis (2-pyridylmethyl)-ethylene diamine (TPEN), thiazolidinedione (TZD; PPAR
agonist) or bisphenol A diglycidyl ether (BADGE; PPAR
antagonist). Subsequently, endothelial cells were activated by treatment with linoleic acid (90 µmol/L) for 6 h. Zinc chelation by TPEN increased the DNA binding activity of nuclear factor (NF)-
B and activator protein (AP)-1, decreased PPAR
expression and activation as well as up-regulated interleukin (IL)-6 expression and production. These effects were fully reversed by zinc supplementation. In addition, exposure to TZD down-regulated linoleic acid-induced DNA binding activity of NF-
B and AP-1, whereas BADGE further induced activation of these oxidative stress-sensitive transcription factors. Most importantly, the TZD-mediated down-regulation of NF-
B and AP-1 and reduced inflammatory response were impaired during zinc chelation. These data suggest that zinc plays a critical role in PPAR
signaling in linoleic acid-induced endothelial cell activation and indicate that PPAR
signaling is impaired during zinc deficiency.
KEY WORDS: zinc PPAR
endothelial cells linoleic acid inflammation
The mechanisms underlying the protective function(s) of zinc in the pathogenesis of atherosclerosis, including vascular cell injury/dysfunction and the inflammatory response, are not clear. Epidemiologic studies suggest that in some population groups, lower serum levels of zinc are inversely associated with coronary artery disease (1). There is evidence suggesting that zinc can act as an endogenous protective factor against atherosclerosis by inhibiting the oxidation of LDL by cells or transition metals (2). In fact, compared with zinc-adequate rats, zinc-deficient rats fed a highly unsaturated fat diet (linseed oil) had increased plasma levels of total lipids and cholesterol and increased susceptibility of LDL to copper-induced lipid peroxidation (3). Zinc also has been shown to attenuate oxidative stress-sensitive transcription factors and IL-8 expression in activated endothelial cells (4). Because of its antioxidant and membrane-stabilizing properties, zinc appears to be crucial for the protection against cell-destabilizing agents such as inflammatory cytokines and polyunsaturated lipids (5,6).
Peroxisome proliferator-activated receptors (PPAR)2 appear to possess potent anti-inflammatory signaling properties (7). PPAR are transcription factors that regulate gene expression by binding with the retinoid X receptor (RXR) as a heterodimeric partner to specific DNA sequence elements termed PPAR-responsive elements (7). PPAR
and PPAR
are expressed in both endothelial (8,9) and smooth muscle cells (1012). Although there is general agreement in the literature that PPAR have anti-inflammatory actions (1315), the cell and tissue specificity of PPAR signaling is not fully understood.
In addition to regulating gene transcription via PPAR responsive elements, PPAR have recently been shown to modulate gene expression by interfering with other transcription factor pathways (15). PPAR have been shown to downregulate inflammatory response genes by negatively interfering with the nuclear factor (NF)-
B, activator protein (AP)-1, and signal transducers and activators of transcription (STAT) transcriptional pathways (13,15). Furthermore, by regulating antioxidant enzyme activities, such as catalase (16), PPAR activators may inhibit NF-
B activation by reducing oxidative stress. PPAR activators also may antagonize NF-
B activation through the expression of I
B
, the inhibitory subunit of NF-
B (17).
The DNA binding domains of PPAR consist of two sets of zinc fingers (18). The specificity and polarity of PPAR-DNA binding seem to be due at least in part to features in the zinc finger domains of PPAR (19). The binding partner of PPAR, the RXR, also has a DNA binding domain with two zinc fingers involved (20). Because zinc is an essential constituent of the DNA binding domains of both PPAR and RXR, zinc deficiency could impair the function of this transcription factor complex. Thus, the objective of the present study was to explore the role of zinc in PPAR signaling. We hypothesize that zinc is a critical component of successful PPAR signaling and protection against endothelial cell activation and inflammation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Endothelial cells were isolated from porcine pulmonary arteries and cultured as described by Hennig et al. (21). Cultures were verified as endothelial cells by uniform cobblestone morphology and by quantitative determination of angiotensin-converting enzyme activity or by their uptake of fluorescent-labeled acetylated LDL (Dil-Ac-LDL; Molecular Probes, Eugene, OR). The cells were cultured in M199 medium (GIBCO Laboratories, Grand Island, NY) containing 10% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT) and exposed to the experimental media composed of M199 with 5% FBS and containing the membrane-permeable zinc chelator N,N,N'N'-tetrakis (2-pyridylmethyl)-ethylene diamine (TPEN; 2 µmol/L) with or without zinc supplementation (12 µmol/L) or a PPAR
agonist 2,4-thiazolidinedione (TZD; 10 µmol/L) or the PPAR
antagonist bisphenol A diglycidyl ether (BADGE; 10 µmol/L) for 24 h. Subsequently, endothelial cells were activated by treatment with linoleic acid (90 µmol/L) for up to 6 h. Linoleic acid (>99% pure) was obtained from Nu-Chek-Prep (Elysian, MN). Preparations of experimental media with linoleic acid were performed as described earlier (21,22).
Determination of labile zinc.
Endothelial cells were grown on chamber culture slides (Becton Dickinson, Franklin, NJ), and the labile pool of zinc was measured using Zinquin fluorophore as described by Pearce et al. (23) with slight modifications. Briefly, after treatment with the zinc chelator TPEN or supplementation with zinc, cells were incubated with 25 µmol/L Zinquin ethyl ester (Sigma, St. Louis, MO) in PBS for 30 min at 37°C. After being washed with PBS, slides were mounted in aqueous media and covered with coverslips. Specimens were evaluated under an epifluorescence Nikon Eclipse E600 microscope (Melville, NY) (excitation at 362 nm, emission at 485 nm), and the images were captured using a Spot CCD (Diagnostic Instruments, Sterling Heights, MI) camera system.
Electrophoretic mobility shift assays.
Nuclear extracts from endothelial cells were prepared according to the method of Beg et al. (24). Binding reactions were performed in a 20-µL volume containing 5 µg of nuclear protein extracts, 10 mmol/L Tris-HCl, pH 7.5, 50 mmol/L NaCl, 1 mmol/L EDTA, 0.1 mmol/L dithiothreitol, 1 mol/L glycerol with 0.5 µg of poly[dI-dC] (nonspecific competitor) and incubated at room temperature for 10 min. A 32P-labeled specific oligonucleotide probe (40,000 cpm) was added to the reaction and incubated for 20 min at room temperature. Double-stranded oligonucleotides of NF-
B (5'-GTTGAGGGGACTTTCCCAGGC-3') and AP-1 (5'-CGCTTGATGACTCAGCCGGAA-3') were purchased from Promega (Madison, WI). These consensus sequences are highly conservative and can be used to study NF-
B and AP-1 DNA binding in a variety of species. The sequence used for PPAR
was a double-stranded 23-bp oligonucleotide (5' GGACCAGGACAAAGGTCACGTTC 3'), which was synthesized from the sequence of rat acyl-CoA oxidase for detection of DNA binding of the PPAR response element (25). The oligonucleotides were end labeled with [
-32P]-ATP (Amersham Pharmacia Biotech, Piscataway, NJ) using a T4 polynucleotide kinase (Promega). The protein-DNA complexes were then resolved on native 5% polyacrylamide gels using Tris/borate/EDTA buffer. Competition studies were performed by the addition of a molar excess of unlabeled oligonucleotide to the binding reaction. Rabbit polyclonal anti-NF-
B p65 (Santa Cruz Biotechnology, Santa Cruz, CA) was used in supershift experiments.
IL-6 assay.
After exposure of endothelial cells to the zinc chelator TPEN and enrichment with zinc and PPAR
ligands, the media were removed from the culture plates and frozen immediately at -80°C until IL-6 analysis. IL-6 levels and release into the medium were determined by an ELISA using anti-porcine IL-6 antibody (Duoset, R&D Systems, Minneapolis, MN) according to the manufacturers protocol. The optical density was measured at 450 nm using a microplate reader (Molecular Devices, Sunnyvale, CA) and the wavelength corrected at 540 nm.
RT-PCR.
Total RNA was extracted using RNA-STAT-60 (Tel TEST, Friendswood, TX) according to the manufacturers protocol and reverse transcribed at 42°C for 60 min using a reverse transcription system (Promega). The sequences used for RT-PCR were of porcine origin taken from the Nucleotide database (AF103946). The forward primer was the sequence from 200 to 221 bp (5'-AGCCCTTCACCACTGTTGATTT-3'), and the reverse primer was the complementary sequence from 755 to 778 bp (5'-GCGGGAAGGACTTTATGTATGAGT-3') (26). The oligonucleotide primers used to amplify the porcine housekeeping gene ß-actin were as published by Barchowsky et al. (27). The PCR mixture consisted of a Taq PCR master mix (Qiagen, Valencia, CA), 2 µL of the reverse-transcribed product and 20 pmol of primer pairs in a total volume of 50 µL. Thermocycling was performed with the annealing temperature of 61°C for 40 cycles. The primer sequences for PPAR
resulted in a product size of 579 bp. Cycling times were optimized to ensure that the amplification cycles were below the plateau levels. The amplified PCR products were separated by electrophoresis using 2% agarose gel, stained with SYBR Gold (Molecular Probes, Eugene, OR) and visualized using phosphoimaging technology (FLA-2000, Fuji, Stamford, CT).
Western blotting.
Cellular protein (10 µg) was electrophoresed using 7.5% SDS polyacrylamide gel. Protein samples were transferred to a nitrocellulose membrane and blocked with 5% nonfat dried milk overnight at 4°C in Tris-buffered saline (pH 7.6) containing 0.1% Tween (TBS-T). The membranes were incubated with a 1:1000 dilution of PPAR
-rabbit polyclonal IgG (Santa Cruz Biotechnology). The membranes were then incubated with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase. After incubation with each antibody, the membranes were washed 4 times with TBS-T at each step to minimize the background. Signals of the immunoreactive bands were measured using the enhanced chemiluminescence detection system (Amersham Pharmacia Biotech).
Statistical analysis.
The data were analyzed using SYSTAT 7.0 (SPSS, Chicago, IL). Comparisons between treatments were made by one-way ANOVA with post-hoc comparisons of the means made by Bonferroni least significance difference procedure. Differences were considered significant at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
expression.
The effect of zinc deficiency induced by TPEN chelation and zinc supplementation on PPAR
gene and protein expression was studied. Compared with control cultures, zinc deficiency (cells treated with the zinc chelator TPEN) markedly suppressed both the mRNA (Fig. 2A) and protein (Fig. 2B) expression of PPAR
. Cells treated with zinc and TPEN had PPAR
mRNA and protein levels that did not differ from the control.
|
signaling.
The effect of zinc deficiency and supplementation on linoleic acid-induced DNA binding activity of PPAR
was studied. Even though linoleic acid is a natural ligand for PPAR
, its ligand activity and subsequent PPAR
activation are dependent on the presence of sufficient zinc. Linoleic acid induced activation of PPAR
, which was markedly reduced during zinc chelation, but recovered after supplementation with zinc (Fig. 3).
|
modulates fatty acid-induced activation of redox-responsive transcription factors.
PPAR may be critical transcriptional regulators of oxidative stress-sensitive transcription factors such as NF-
B and AP-1. Linoleic acid markedly increased DNA binding activity of NF-
B. (Fig. 4) Cellular enrichment with the PPAR
agonist TZD blocked the fatty acid-induced activation of NF-
B.
|
B data, the PPAR
agonist TZD markedly down-regulated linoleic acid-induced activation of AP-1 (Fig. 5A). The PPAR
antagonist BADGE further increased the fatty acid-induced AP-1 activity compared to cells treated with fatty acid alone. Similarly, the PPAR
antagonist increased the linoleic acid induced DNA binding of NF-
B (Fig. 5B).
|
Zinc chelation markedly increased linoleic acid-mediated DNA binding activity of AP-1 (Fig. 6). Treatment of cultures with the PPAR
agonist TZD blocked the fatty acid-induced AP-1 activation in the presence of adequate zinc. In contrast, during zinc chelation, the PPAR
agonist TZD was not able to block the fatty acid-induced AP-1 activation.
|
signaling and IL-6 levels induced by fatty acids.
In zinc-adequate cells, the PPAR
agonist TZD markedly down-regulated linoleic acid-induced IL-6 production (Fig. 7A), whereas zinc chelation with TPEN not only increased IL-6 levels, but also impaired the PPAR
agonist mediated down-regulation of IL-6 production (Fig. 7B). These results suggest that normal zinc status is required to promote the anti-inflammatory properties of the PPAR
agonist.
|
| DISCUSSION |
|---|
|
|
|---|
Little is known about the requirements and functions of zinc in maintaining the integrity of the vasculature and particularly the vascular endothelium. Because zinc is required for normal cellular repair processes, and because atherosclerosis is believed to begin with vessel wall injury or dysfunction, a low zinc concentration may be involved in either the initiation of cell injury or inadequate tissue repair, which may have important implications in the pathogenesis of atherosclerosis (33). We showed that zinc is vital to endothelial integrity and that zinc deficiency causes a severe impairment of endothelial barrier function (34,35). Media supplemented with physiologic concentrations of zinc completely restored cell integrity. Supplementation with calcium or magnesium, however, did not restore this function, indicating a unique role of zinc in maintaining normal endothelial integrity. We also demonstrated previously that using our two zinc deficiency models (either TPEN chelation or long-term culture in low zinc media) resulted in similar metabolic changes in endothelial cells (36). There is evidence that a critical sign of zinc "deficiency" may be a compromised control of activation of transcription factors, cytokine activity and an endothelial cell inflammatory response (4). Our data support the concept that zinc can have distinct protective properties during the inflammatory response in atherosclerosis (5,37).
In addition, as a critical component of the cells antioxidant defense system, zinc appears to be important for maintaining an environment that facilitates normal protein-protein interaction. Zinc deficiency can induce alterations in the intracellular redox state that lead to the oxidation of thiol groups, thus impairing protein function (38). This might be relevant for optimal functioning of zinc-dependent proteins and transcription factors dependent on zinc fingers such as the PPAR/RXR protein complex.
PPAR are members of the nuclear steroid hormone receptor superfamily and function to transduce a variety of environmental, nutritional and inflammatory signals into a defined set of cellular responses (39). Recent studies demonstrated that PPAR
is present in macrophage foam cells, endothelial cells and vascular smooth muscle cells of human and murine atherosclerotic lesions and that it can suppress the expression of inflammatory cytokines and acute phase proteins (11,13,14,40,41). Furthermore, much of the function of PPAR appears through antagonizing oxidative stress-sensitive signaling pathways, such as NF-
B, AP-1 and STAT (1315). In fact, adenovirus-mediated expression of a constitutively active mutant of PPAR
resulted in suppressed expression of vascular adhesion molecules in endothelial cells, suggesting that activation of endothelial PPAR
has a potent anti-inflammatory role (42). Our data demonstrate that the proinflammatory fatty acid, linoleic acid, can increase activation of endothelial NF-
B and AP-1. In contrast, the PPAR
agonist TZD decreased the linoleic acid-induced activation of NF-
B and AP-1, whereas the PPAR
antagonist BADGE increased the binding activity of these transcription factors. Even though linoleic acid is a natural ligand for PPAR
, this fatty acid can induce oxidative stress, leading to activation of redox-sensitive transcription factors and an inflammatory response. Our data demonstrate that activation of PPAR
by TZD may be sufficient to limit the linoleic acid-induced endothelial inflammatory response by down-regulating signaling of oxidative stress-sensitive transcription factors.
The mechanisms and regulation of PPAR signaling remain mostly unknown. Our data clearly show that zinc is critical for normal and constitutive PPAR activity and that zinc deficiency can lead to dysfunction of PPAR signaling. We reported previously that zinc has antioxidant and anti-inflammatory properties (43), and we found that zinc deficiency can decrease the protein and gene expression of PPAR
and inhibit the activation of PPAR
induced by linoleic acid. Our results show that zinc may be required for the expression of PPAR
as a zinc finger protein (44,45) because the DNA binding domain of PPAR
contains a zinc finger motif, which plays a critical role in the specificity and polarity of PPAR receptor DNA binding. Furthermore, it was reported that an endothelial zinc finger protein-2 can regulate the promoter activity of a scavenger receptor expressed by endothelial cells (46). Another zinc finger-containing transcription factor, called vascular endothelial zinc finger1 (Vezf1)/DB1, has been shown to potently and specifically activate transcription mediated by the human endothelin-1 promoter (47). Although many such zinc finger transcription factors play an important role in the regulation of genes, the mechanism of zinc deficiency in the expression and function of these and other zinc finger proteins is not known.
The direct involvement of zinc as a functional component of zinc fingers in the regulation of PPAR
is supported by our data, which clearly demonstrate that the PPAR
agonist-mediated down-regulation of the transcription factors NF-
B and AP-1 and reduced inflammatory response were impaired during zinc deficiency. However, in our endothelial cells, it cannot be ruled out that zinc can also act as an antioxidant or redox stabilizing element (43).
In conclusion, our results demonstrate that zinc plays a critical role in the expression and activation of PPAR
either as a functional component of zinc fingers in DNA binding domains or as an antioxidant in the prevention of oxidative stress (Fig. 8). These data also indicate that zinc plays a critical role in PPAR
signaling during endothelial cell activation and that PPAR signaling is impaired during zinc deficiency. This may explain in part the protective mechanisms of zinc against endothelial cell dysfunction and atherosclerosis.
|
| FOOTNOTES |
|---|
3 Abbreviations used: AP, activator protein; BADGE, bisphenol A diglycidyl ether; FBS, fetal bovine serum; NF, nuclear factor; PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor; STAT, signal transducers and activators of transcription; TPEN, N,N,N'N'-tetrakis (2-pyridylmethyl)-ethylene diamine; TZD, thiazolidinedione. ![]()
Manuscript received 1 May 2003. Initial review completed 19 May 2003. Revision accepted 10 July 2003.
| LITERATURE CITED |
|---|
|
|
|---|
1. Singh, R. B., Gupta, U. C., Mittal, N., Niaz, M. A., Ghosh, S. & Rastogi, V. (1997) Epidemiologic study of trace elements and magnesium on risk of coronary artery disease in rural and urban Indian populations. J. Am. Coll. Nutr. 16:62-67.[Abstract]
2. Wilkins, G. M. & Leake, D. S. (1994) The oxidation of low density lipoprotein by cells or iron is inhibited by zinc. FEBS Lett. 341:259-262.[Medline]
3. Eder, K. & Kirchgessner, M. (1997) Concentrations of lipids in plasma and lipoproteins and oxidative susceptibility of low-density lipoproteins in zinc-deficient rats fed linseed oil or olive oil. J. Nutr. Biochem. 8:461-468.
4. Connell, P., Young, V. M., Toborek, M., Cohen, D. A., Barve, S., McClain, C. J. & Hennig, B. (1997) Zinc attenuates tumor necrosis factor-mediated activation of transcription factors in endothelial cells. J. Am. Coll. Nutr. 16:411-417.[Abstract]
5. Hennig, B., Toborek, M. & McClain, C. J. (1996) Antiatherogenic properties of zinc: implications in endothelial cell metabolism. Nutrition 12:711-717.[Medline]
6. ODell, B. L. (2000) Role of zinc in plasma membrane function. J Nutr. 130(suppl.):1432S-1436S.
7. Tedgui, A. & Mallat, Z. (2001) Anti-inflammatory mechanisms in the vascular wall. Circ. Res. 88:877-887.
8. Delerive, P., Martin-Nizard, F., Chinetti, G., Trottein, F., Fruchart, J. C., Najib, J., Duriez, P. & Staels, B. (1999) Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway. Circ. Res. 85:394-402.
9. Marx, N., Bourcier, T., Sukhova, G. K., Libby, P. & Plutzky, J. (1999) PPAR
activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPAR
as a potential mediator in vascular disease. Arterioscler. Thromb. Vasc. Biol. 19:546-551.
10. Marx, N., Schonbeck, U., Lazar, M. A., Libby, P. & Plutzky, J. (1998) Peroxisome proliferator-activated receptor gamma activators inhibit gene expression and migration in human vascular smooth muscle cells. Circ. Res. 83:1097-1103.
11. Ricote, M., Huang, J., Fajas, L., Li, A., Welch, J., Najib, J., Witztum, J. L., Auwerx, J., Palinski, W. & Glass, C. K. (1998) Expression of the peroxisome proliferator-activated receptor
(PPAR
) in human atherosclerosis and regulation in macrophages by colony stimulating factors and oxidized low density lipoprotein. Proc. Natl. Acad. Sci. U.S.A. 95:7614-7619.
12. Chinetti, G., Gbaguidi, F. G., Griglio, S., Mallat, Z., Antonucci, M., Poulain, P., Chapman, J., Fruchart, J. C., Tedgui, A., Najib-Fruchart, J. & Staels, B. (2000) CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors. Circulation 101:2411-2417.
13. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J. & Glass, C. K. (1998) The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature (Lond.) 391:79-82.[Medline]
14. Jiang, C., Ting, A. T. & Seed, B. (1998) PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature (Lond.) 391:82-86.[Medline]
15. Barbier, O., Torra, I. P., Duguay, Y., Blanquart, C., Fruchart, J. C., Glineur, C. & Staels, B. (2002) Pleiotropic actions of peroxisome proliferator-activated receptors in lipid metabolism and atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 22:717-726.
16. Girnun, G. D., Domann, F. E., Moore, S. A. & Robbins, M. E. (2002) Identification of a functional peroxisome proliferator-activated receptor response element in the rat catalase promoter. Mol. Endocrinol. 16:2793-2801.
17. Delerive, P., Gervois, P., Fruchart, J. C. & Staels, B. (2000) Induction of I
B
expression as a mechanism contributing to the anti-inflammatory activities of peroxisome proliferator-activated receptor-
activators. J. Biol. Chem. 275:36703-36707.
18. Hihi, A. K., Michalik, L. & Wahli, W. (2002) PPARs: transcriptional effectors of fatty acids and their derivatives. Cell Mol. Life Sci. 59:790-798.[Medline]
19. Hsu, M. H., Palmer, C. N., Song, W., Griffin, K. J. & Johnson, E. F. (1998) A carboxyl-terminal extension of the zinc finger domain contributes to the specificity and polarity of peroxisome proliferator-activated receptor DNA binding. J. Biol. Chem. 273:27988-27997.
20. Lee, M. S., Kliewer, S. A., Provencal, J., Wright, P. E. & Evans, R. M. (1993) Structure of the retinoid X receptor alpha DNA binding domain: a helix required for homodimeric DNA binding. Science (Washington, D.C.) 260:1117-1121.
21. Hennig, B., Shasby, D. M., Fulton, A. B. & Spector, A. A. (1984) Exposure to free fatty acid increases the transfer of albumin across cultured endothelial monolayers. Arteriosclerosis 4:489-497.
22. Toborek, M., Lee, Y. W., Kaiser, S. & Hennig, B. (2002) Measurement of inflammatory properties of fatty acids in human endothelial cells. Methods Enzymol. 352:198-219.[Medline]
23. Pearce, L. L., Wasserloos, K., St. Croix, C. M., Gandley, R., Levitan, E. S. & Pitt, B. R. (2000) Metallothionein, nitric oxide and zinc homeostasis in vascular endothelial cells. J Nutr. 130(suppl.):1467S-1470S.
24. Beg, A. A., Finco, T. S., Nantermet, P. V. & Baldwin, A. S., Jr (1993) Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for NF-kappa B activation. Mol. Cell Biol. 13:3301-3310.
25. Iijima, K., Yoshizumi, M., Ako, J., Eto, M., Kim, S., Hashimoto, M., Sugimoto, N., Liang, Y. Q., Sudoh, N., Toba, K. & Ouchi, Y. (1998) Expression of peroxisome proliferators-activated receptor gamma in rat aortic smooth muscle cells. Biochem Biophys. Res. Commun. 247:353-356.[Medline]
26. Ding, S. T., McNeel, R. L. & Mersmann, H. J. (1999) Expression of porcine adipocyte transcripts: tissue distribution and differentiation in vitro and in vivo. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 123:307-318.[Medline]
27. Barchowsky, A., Roussel, R. R., Krieser, R. J., Mossman, B. T. & Treadwell, M. D. (1998) Expression and activity of urokinase and its receptor in endothelial and pulmonary epithelial cells exposed to asbestos. Toxicol. Appl. Pharmacol. 152:388-396.[Medline]
28. Bettger, W. J. & ODell, B. L. (1981) A critical physiological role of zinc in the structure and function of biomembranes. Life Sci. 28:1425-1438.[Medline]
29. ODell, B. L. (1992) Zinc plays both structural and catalytic roles in metalloproteins. Nutr. Rev. 50:48-50.[Medline]
30. Bray, T. M. & Bettger, W. J. (1990) The physiological role of zinc as an antioxidant. Free Radic. Biol. Med. 8:281-291.[Medline]
31. Oteiza, P. I., Olin, K. L., Fraga, C. G. & Keen, C. L. (1995) Zinc deficiency causes oxidative damage to proteins, lipids and DNA in rat testes. J. Nutr. 125:823-829.
32. Bunk, M. J., Dnistrian, A. M., Schwartz, M. K. & Rivlin, R. S. (1989) Dietary zinc deficiency decreases plasma concentrations of vitamin E. Proc. Soc. Exp. Biol. Med. 190:379-384.[Medline]
33. Hennig, B., Diana, J. N., Toborek, M. & McClain, C. J. (1994) Influence of nutrients and cytokines on endothelial cell metabolism. J. Am. Coll. Nutr. 13:224-231.[Abstract]
34. Hennig, B., Wang, Y., Ramasamy, S. & McClain, C. J. (1992) Zinc deficiency alters barrier function of cultured porcine endothelial cells. J. Nutr. 122:1242-1247.
35. Clair, J., Talwalkar, R., McClain, C. J. & Hennig, B. (1995) Selective removal of zinc from cell culture media. J. Trace Elem. Exp. Med. 7:143-151.
36. Meerarani, P., Ramadass, P., Toborek, M., Bauer, H. C., Bauer, H. & Hennig, B. (2000) Zinc protects against apoptosis of endothelial cells induced by linoleic acid and tumor necrosis factor alpha. Am. J. Clin. Nutr. 71:81-87.
37. Hennig, B., Toborek, M., Cader, A. A. & Decker, E. A. (1994) Nutrition, endothelial cell metabolism, and atherosclerosis. Crit. Rev. Food Sci. Nutr. 34:253-282.[Medline]
38. Oteiza, P. I., Clegg, M. S. & Keen, C. L. (2001) Short-term zinc deficiency affects nuclear factor-
B nuclear binding activity in rat testes. J. Nutr. 131:21-26.
39. Lemberger, T., Desvergne, B. & Wahli, W. (1996) Peroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiology. Annu. Rev. Cell Dev. Biol. 12:335-363.[Medline]
40. Law, R. E., Goetze, S., Xi, X. P., Jackson, S., Kawano, Y., Demer, L., Fishbein, M. C., Meehan, W. P. & Hsueh, W. A. (2000) Expression and function of PPAR
in rat and human vascular smooth muscle cells. Circulation 101:1311-1318.
41. Chawla, A., Barak, Y., Nagy, L., Liao, D., Tontonoz, P. & Evans, R. M. (2001) PPAR-gamma dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat. Med. 7:48-52.[Medline]
42. Wang, N., Verna, L., Chen, N. G., Chen, J., Li, H., Forman, B.S.M. & Stemerman, M. B. (2002) Constitutive activation of peroxisome proliferator-activated receptor-gamma suppresses pro-inflammatory adhesion molecules in human vascular endothelial cells. J. Biol. Chem. 277:34176-34181.
43. Hennig, B., Meerarani, P., Toborek, M. & McClain, C. J. (1999) Antioxidant-like properties of zinc in activated endothelial cells. J. Am. Coll. Nutr. 18:152-158.
44. Evans-Galea, M. V., Blankman, E., Myszka, D. G., Bird, A. J., Eide, D. J. & Winge, D. R. (2003) Two of the five zinc fingers in the zap1 transcription factor DNA binding domain dominate site-specific DNA binding. Biochemistry 42:1053-1061.[Medline]
45. Bittel, D. C., Smirnova, I. V. & Andrews, G. K. (2000) Functional heterogeneity in the zinc fingers of metalloregulatory protein metal response element-binding transcription factor-1. J. Biol. Chem. 275:37194-37201.
46. Adachi, H. & Tsujimoto, M. (2002) Characterization of the human gene encoding the scavenger receptor expressed by endothelial cell and its regulation by a novel transcription factor, endothelial zinc finger protein-2. J. Biol. Chem. 277:24014-24021.
47. Aitsebaomo, J., Kingsley-Kallesen, M. L., Wu, Y., Quertermous, T. & Patterson, C. (2001) Vezf1/DB1 is an endothelial cell-specific transcription factor that regulates expression of the endothelin-1 promoter. J. Biol. Chem. 276:39197-39205.
This article has been cited by other articles:
![]() |
H. Shen, E. Oesterling, A. Stromberg, M. Toborek, R. MacDonald, and B. Hennig Zinc Deficiency Induces Vascular Pro-Inflammatory Parameters Associated with NF-{kappa}B and PPAR Signaling J. Am. Coll. Nutr., October 1, 2008; 27(5): 577 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Kang, Z. Song, C. J. McClain, Y. J. Kang, and Z. Zhou Zinc Supplementation Enhances Hepatic Regeneration by Preserving Hepatocyte Nuclear Factor-4{alpha} in Mice Subjected to Long-Term Ethanol Administration Am. J. Pathol., April 1, 2008; 172(4): 916 - 925. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shen, R. MacDonald, D. Bruemmer, A. Stromberg, A. Daugherty, X.-a. Li, M. Toborek, and B. Hennig Zinc Deficiency Alters Lipid Metabolism in LDL Receptor Deficient Mice Treated with Rosiglitazone J. Nutr., November 1, 2007; 137(11): 2339 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhou, X. Kang, Y. Jiang, Z. Song, W. Feng, C. J. McClain, and Y. J. Kang Preservation of Hepatocyte Nuclear Factor-4{alpha} Is Associated with Zinc Protection Against TNF-{alpha} Hepatotoxicity in Mice Experimental Biology and Medicine, May 1, 2007; 232(5): 622 - 628. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Wiseman, S. M. Wells, M. Hubbard, J. E. Welker, and S. M. Black Alterations in zinc homeostasis underlie endothelial cell death induced by oxidative stress from acute exposure to hydrogen peroxide Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L165 - L177. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Uzzo, P. L. Crispen, K. Golovine, P. Makhov, E. M. Horwitz, and V. M. Kolenko Diverse effects of zinc on NF-{kappa}B and AP-1 transcription factors: implications for prostate cancer progression Carcinogenesis, October 1, 2006; 27(10): 1980 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Wiseman, S. M. Wells, J. Wilham, M. Hubbard, J. E. Welker, and S. M. Black Endothelial response to stress from exogenous Zn2+ resembles that of NO-mediated nitrosative stress, and is protected by MT-1 overexpression Am J Physiol Cell Physiol, September 1, 2006; 291(3): C555 - C568. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Kelleher and B. Lonnerdal Zinc Supplementation Reduces Iron Absorption through Age-Dependent Changes in Small Intestine Iron Transporter Expression in Suckling Rat Pups J. Nutr., May 1, 2006; 136(5): 1185 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. t. Dieck, F. Doring, D. Fuchs, H.-P. Roth, and H. Daniel Transcriptome and Proteome Analysis Identifies the Pathways That Increase Hepatic Lipid Accumulation in Zinc-Deficient Rats J. Nutr., February 1, 2005; 135(2): 199 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Sung, S. Park, B. P. Yu, and H. Y. Chung Modulation of PPAR in Aging, Inflammation, and Calorie Restriction J. Gerontol. A Biol. Sci. Med. Sci., October 1, 2004; 59(10): B997 - B1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Reiterer, M. Toborek, and B. Hennig Peroxisome Proliferator Activated Receptors {alpha} and {gamma} Require Zinc for Their Anti-inflammatory Properties in Porcine Vascular Endothelial Cells J. Nutr., July 1, 2004; 134(7): 1711 - 1715. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||