|
|
|
|
Is Rapidly Reversed by Zinc Repletion1,2
Food Science and Human Nutrition Department and Center for Nutritional Sciences, University of Florida, Gainesville, FL 32611-0370
4To whom correspondence should be addressed. E-mail: cousins{at}ufl.edu.
| ABSTRACT |
|---|
|
|
|---|
and zinc repletion on these changes. IL-1
has been shown to have a role in the intestinal inflammation that occurs with bacterial infection. Our results showed a permissive effect of zinc deficiency on both UG and iNOS expression. Specifically, UG expression was responsive to zinc deficiency and IL-1
challenge, which were additive when combined, whereas iNOS expression was upregulated by IL-1
only during the deficiency. Immunohistochemistry showed that the increase in UG was limited to enterocytes of the upper villus but, in contrast, the increase in iNOS was principally in cells of the lamina propria of IL-1
treated rats. Cells exhibiting UG upregulation did not co-express serotonin. Repletion with zinc reversed upregulation of the iNOS gene within 1 d, whereas UG upregulation required 34 d to return to normal. This differential response to repletion suggests that mechanisms of UG and iNOS dysregulation are different. Dysregulation of both genes may contribute to the severity of zinc-responsive diarrheal disease and intestinal inflammatory disease.
KEY WORDS: zinc deficiency diarrheal disease interleukin 1 inflammation gene regulation rats
Diarrheal disease has long been recognized as a major international health problem and is one of the major causes of infant mortality, especially in developing countries (1
). Diarrhea occurs in humans with zinc deficiency (1
3
), and zinc supplementation markedly decreases the incidence of diarrhea (4
,5
). The causes of diarrhea are diverse and include infection, genetic disorders and malabsorption; however, for many of these causes, the exact mechanisms responsible for regulating the hypersecretion of fluid into the intestinal lumen are unknown.
A number of factors may contribute to the effects of zinc deficiency on intestinal pathophysiology (6
), including nitric oxide (NO),4 which is an important regulatory factor in physiologic processes (7
). Inducible nitric oxide synthase (iNOS), one of three isoforms of the nitric oxide synthase (NOS) family, is responsible for a large portion of NO production, which results in damage to both epithelial cell structure and altered intestinal motor function. Chronic administration of a NOS inhibitor attenuates the intestinal damage induced by severe zinc deficiency (8
). That finding suggests a role for iNOS in the pathogenesis of zinc-related diarrhea, particularly as it relates to predisposing or concomitant intestinal inflammation. In contrast, uroguanylin (UG) is an intestinal natriuretic hormone (9
) that stimulates transepithelial secretion of both Cl- and HCO3- anions in the intestine through binding to the guanylate cyclase-C type receptor (GC-C) and subsequent activation of the cystic fibrosis transmembrane conductance regulator (10
,11
). UG may regulate intestinal cell proliferation (12
). The upregulation of preprouroguanylin mRNA and UG peptides in the small intestine during zinc deficiency (13
15
) suggests a potential mechanistic link between zinc deficiency and the fluid secretion of secretory diarrhea. However, the response of UG expression to specific cytokines that produce or contribute to the intestinal inflammation that usually accompanies diarrheal disease has not been investigated in normal subjects or in zinc-deficient subjects in whom UG is upregulated.
In the present study, we used a moderate zinc deficiency model, thus eliminating possible changes in intestinal structure caused by secondary effects of the deficiency, and proinflammatory conditions established using interleukin (IL)-1
challenge to examine their individual and combined effects on expression of the UG and iNOS genes. Repletion with adequate dietary zinc was used to examine the sensitivity of each gene to zinc intake. Collectively, these data support the hypothesis that zinc deficiency exacerbates proinflammatory responses of the intestine and could contribute to gastrointestinal disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Male, 5- to 6-wk-old Sprague-Dawley rats (Harlan, Indianapolis, IN), weighing 150175 g were housed individually in hanging, stainless steel cages, and fed an AIN-76Abased pelleted diet as described previously (15
). After being fed the normal zinc diet with 30 mg Zn/kg for 1 wk, the rats were randomly divided into two groups. One group continued to consume the zinc-adequate (30 mg Zn/kg; +Zn) diet, whereas the other group received a zinc-deficient (<1 mg Zn/kg; Zn) diet for 14 d. A pair-fed group was not included because prior research has shown that UG expression is not significantly influenced by food intake (14
). To test the effects of a proinflammatory intestinal condition, rats from both dietary groups were injected intraperitoneally with either recombinant human (rh)IL-1
(2 x 108 U/kg in PBS) or an equivalent volume of PBS. The rhIL-1
was donated by Hoffmann-La Roche (Nutley, NJ), and had a specific activity of 8.8 x 108 U/mg protein. In one series of experiments, each PBS- or IL-1
treated rat was placed into a separate, suspended cage to allow for the collection of all fecal material excreted, basically as described by Ciancio et al. (16
). Ten hours after the injections, the fecal pellets were counted and weighed, and the rats were anesthetized with halothane and killed by exsanguination via cardiac puncture. To test the responsiveness of the UG and iNOS genes to repletion of dietary zinc status, some rats that had been fed the Zn diet for 14 d were returned to the +Zn (adequate) diet for up to 4 d, whereas other rats continued to consume the Zn diet during this time. The serum zinc concentration and body weight changes were measured as indices of zinc status (15
). All animal procedures were approved by the University of Florida Institutional Animal Care and Use Committee.
Quantitative polymerase chain reaction (PCR).
Sections of duodenum and jejunum were quickly excised, freed of pancreatic attachments and fat, and the lumen was flushed with ice-cold PBS. Mucosa scraped from the intestine or regions of intact intestine was immediately homogenized in Tripure (Roche, Indianapolis, IN) and total RNA was extracted and stored in diethyl pyrocarbonate-treated water for subsequent analyses. Real-time quantitative PCR (Q-PCR) was employed to determine relative metallothionein (MT) 1, preprouroguanylin and iNOS mRNA quantities. Henceforth, preprouroguanylin mRNA (the initial transcript) is referred to as uroguanylin (UG) mRNA. The oligonucleotide primers and probes for the Q-PCR were designed using primer express software (Ver. 1.0; Applied Biosystems, Foster City, CA). Sequences for cDNAs were obtained from GenBank, and the rat MT 1 (J00750) and UG (U75186) primers and probes were described previously (17
). iNOS (NM012611) forward and reverse primers and TaqMan probe are AGCTGGGCTGTGCAAACC, TGCAATGTTTGCTTCGAACATC and FAM-AACGTCTCACAGGCTGCCCGGA-BHQ1, respectively (BioSources International, Camarillo, CA). Q-PCR was performed with TaqMan chemistries using one-step reverse-transcriptase PCR reactions and fluorescence monitored with a GeneAmp 5700 Sequence Detection System (Applied Biosystems). A universal 18S rRNA primer/probe-set (Applied Biosystems) was used to normalize all of the assays. Standard curves were run in duplicate, yielding a linear region with a 4 to 5-log range. Relative quantities were calibrated to the normal zinc, vehicle-injected (+ZnPBS) RNA sample. Details of the standard curves and reaction plots are available at http://cousins.ifas.ufl.edu.
Immunohistology.
Sections of the duodenum and jejunum were fixed with 4% paraformaldehyde in PBS (pH 7.4) overnight, cryoprotected in 300 g/L sucrose in PBS, frozen in embedding medium for frozen tissue specimens (Tissue-Tek O.C.T. Compound; Ted Pella, Redding, CA) and sectioned into 6 µm-thick slices. Triple fluorescence labeling for UG, serotonin and nuclei was carried out sequentially on the same sections by using established protocols. After treatment with a blocking solution, 4% normal goat serum in PBS-T (PBS; 0.05% Tween-20, pH 7.5) for 1 h, the sections were incubated overnight at 4°C with affinity-purified rabbit anti-rat UG antibody (1:100) (15
) diluted in 4% normal goat serum in PBS-T. The unbound immunoglobulin (Ig)G fraction from affinity purification (nonimmunoreactive flow through) was used as a negative control. After three rinses with PBS-T, the secondary antibody, Alexa 488 goat anti-rabbit IgG (1:200, Molecular Probes, Eugene, OR) was applied for visualization. Then, the tissue sections were processed again as described above, except that the primary antibody was mouse anti-rat serotonin antibody (DAKO, Carpinteria, CA), and the fluorescent secondary antibody was Alexa 594 goat anti-mouse IgG (1:200, Molecular Probes). Normal mouse IgG (1:800; DAKO) was used as a negative control. Serotonin-containing cells were probed to determine whether UG and serotonin are produced by the same cells. 4', 6-Diamidio-2-phenylindole (DAPI) was applied for the visualization of nuclei (18
). Sections were examined for fluorescent signals using excitation and barrier filters appropriate for selectively visualizing fluorescein isothiocyanate, Texas Red or DAPI, respectively.
Immunohistochemical detection of iNOS protein was performed using a Histostain Kit (Zymed Laboratories, South San Francisco, CA). The sections were gradually hydrated, rinsed in PBS-T and incubated in 3% H2O2 in methanol (1:9). Next, the sections were blocked with 10 g/L bovine serum albumin and 10% normal goat serum before overnight incubation at 4°C with rabbit anti-iNOS/NOS Type II antibody (1:100) or negative control antibody (Zymed Laboratories, South San Francisco, CA). After washing with PBS, sections were incubated with biotinylated goat anti-rabbit IgG at room temperature followed by streptavidin-peroxidase conjugate to develop the red 3-amino-9-ethylcarbazole chromogen. Hematoxylin counterstaining was performed before mounting. Microscopy and image analysis was performed with a Zeiss Axiovert S100 microscope (Carl Zeiss, Thornwood, NY) fitted with a SPOT digital CCD camera (Diagnostic Instruments, Sterling Heights, MI). For quantitation, the digital images were printed, and labeled cells within grids were counted visually.
Statistical analysis.
Data are expressed as means ± SEM. Logarithmic transformations were performed on iNOS and MT data to achieve homogeneity of variances. Differences between groups were determined using factorial ANOVA or one-way ANOVA with post-hoc testing using the Student-Newman-Keuls method. Differences of P < 0.05 were considered to be significant.
| RESULTS |
|---|
|
|
|---|
(+Zn, 13 ± 3 vs. Zn, 4 ± 2 µmol/L; P < 0.05). Other indices of zinc status were comparable to previous experiments with this animal and dietary model (8
(P < 0.05). Output was not different in the +Zn rats.
Dietary zinc deficiency reduced MT mRNA quantities by 3.5- and 2.0-fold in the duodenum and jejunum of the PBS-treated rats, respectively (Fig. 1
A, C). IL-1
induction of MT mRNA quantities in these intestinal sections was markedly reduced in the Zn rats. In marked contrast, Q-PCR analysis revealed that the relative UG mRNA quantities in intestinal mucosa were higher in Zn rats than in +Zn rats (Fig. 1
B, D). The Zn rats had 2.2- and 2.6-fold greater UG mRNA levels in the duodenum and jejunum, respectively, than +Zn rats. IL-1
administration increased UG mRNA levels 2.0- and 1.4-fold in the duodenum and jejunum of Zn rats (P < 0.05), whereas it produced 1.4- and 1.6-fold increases (not significant) in the duodenum and jejunum of +Zn rats. No significant interactions between zinc intake and IL-1
administration were observed for either MT mRNA or UG mRNA.
|
treatment to identify and quantitate UG-producing intestinal cells. Dual immunofluorescence markers were used for covisualization of UG (stained green) and serotonin (stained red). As shown in duodenal sections (Fig. 2
(Fig. 2B)
treatment (Fig. 2A)
treatment fluorescence was localized mainly in the center of the villus. Very few cells exhibited double fluorescence (yellow; indicative of colocalization of UG and serotonin). Intestinal sections from the +Zn rats showed that UG immunoreactivity increased after IL-1
challenge and in cells not showing serotonin immunoreactivity (Fig. 2
challenge significantly elevated the number of UG-labeled cells from duodenum and jejunum of the Zn rats compared with untreated -Zn rats (Fig. 3
challenge significantly increased the serotonin-labeled cell count in both dietary groups (Fig. 3
|
|
challenge (Fig. 4
challenge, whereas +Zn rats displayed no change after IL-1
administration. The mRNA levels did not differ between Zn and +Zn PBS-treated rats. There was an interaction between zinc intake and IL-1
administration (P < 0.04 and <0.01, for duodenum and jejunum, respectively). These data were obtained with total RNA prepared from mucosa scraped from the intestine. In total RNA derived from sections of whole intestine, Zn rats had elevated iNOS mRNA levels when all iNOS expressing cells were included in the initial samples (Fig. 5B
|
|
challenge. Moreover, sections of duodenum and jejunum from Zn rats (Fig. 6
administration, iNOS-containing cells were localized primarily to the lamina propria of the duodenum and jejunum in +Zn rats (Fig. 6
treatment (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
requires a predisposing moderate zinc deficiency, as shown in the present study with both Q-PCR and immunohistochemical data. Of further interest is the finding in this study that IL-1
also upregulates UG expression and to a much greater extent in zinc-deficient rats, thus accentuating the increased UG expression this deficiency produces (14
than were used in the present study upregulate UG expression but do not reproducibly induce iNOS expression.
UG has unique biochemical properties and physiologic actions similar to the Escherichia coli heat-stable enterotoxin (STa), which causes secretory diarrhea through a GC-C signaling mechanism (27
). Although strongly implicated as a water balance hormone, the exact physiologic role of intestinal UG remains to be clarified. Recent research suggests that UG may also regulate intestinal cell proliferation by delaying progression of the cell cycle (12
). The present experiments demonstrate that the number of UG-producing cells increased in response to proinflammatory conditions initiated by IL-1
challenge. This finding indicates that UG upregulation must be considered within the context of intestinal inflammation. The latter could be a consequence of proinflammatory cytokines, e.g., IL-1
, induced by infection with enteric pathogens (28
). The changes reported here in the proximal intestine may or may not be the only factors that influence water balance leading to diarrhea, events produced primarily in the large intestine and colon. Without surgical removal of the cecum, the rat is not a good model with which to examine altered intestinal fluid dynamics (29
); thus, direct connections to diarrhea in humans will require another animal model. Nevertheless, UG is expressed in the colon (14
); therefore, that part of the gastrointestinal tract should be a focus of future research on the zinc-diarrhea connection.
The molecular mechanisms responsible for the upregulation of the UG gene by zinc deprivation and IL-1
have yet to be established. Cytokine-regulated genes have been studied extensively, as have the common mechanisms that change transcription rates (30
). Similar signal transduction processes are likely to be involved in the pathway by which zinc regulates UG expression. In this regard, zinc has been shown to have anti-inflammatory activity (31
); although conditions necessary for that activity may not be operative in the moderate zinc deficiency used in our study, they may be operative during zinc repletion conditions.
Zinc deficiency may have an effect on NO signaling. It has been proposed that the ratio of MT to thionein, the apo form of this metalloprotein, mediates labile cellular Zn(II) levels induced by NO (32
,33
). Zinc deficiency downregulates MT expression, and that would be expected to alter the Zn(II) pool that interacts with NO. Reduced MT might increase NO availability to activate GC-S and intestinal sensitivity to enteric bacteria (25
). The decrease in intestinal MT could have an influence on UG upregulation, but such a notion is premature due to the current paucity of information on UG gene signaling mechanisms.
IL-1
treatment altered the intestinal distribution of UG-labeled cells in both zinc-adequate and -deficient rats, in which a subset of cells in the basement membrane of the villi showed immunoreactivity. It could be argued, on the basis of the location and morphology of the UG-labeled cells, that the antibody was possibly detecting lymphoguanylin (LGN) in addition to UG. Because LGN exhibits an 84% amino acid sequence homology to UG, there could be some crossreactivity of LGN with the UG antibody. IL-1
might trigger an inflammatory process in which lymphocytes produce LGN, but the cytokine responsiveness of the LGN gene remains unexplored. However, because UG mRNA quantities increased so markedly, as did UG peptides in response to IL-1
, that possibility is remote.
Serotonin is a neurotransmitter and a potent intestinal secretagogue that plays an important role in the pathogenic mechanisms of diarrhea, such as that induced by cholera toxin (20
,34
). The present experiments demonstrated that serotonin-labeled cell numbers were similar in zinc-adequate and -deficient rats without IL-1
challenge, and that IL-1
injection caused similar increases in Zn and +Zn cells showing reactivity to serotonin antibody. These findings essentially rule out the possibility that intestinal serotonin levels are influenced by zinc deficiency.
In conclusion, expression of both UG and iNOS genes is upregulated in the intestine in response to IL-1
challenge. Zinc deficiency plays a permissive role in enhancing the upregulation of both genes in response to IL-1
, either augmenting the effect in the case of UG or being necessary for the response in the case of iNOS. Repletion with zinc rapidly decreased expression of both genes, but temporal differences suggest that different mechanisms of gene regulation by zinc were operative. The results also provide a link between zinc deficiency and supplementation and inflammatory conditions of the intestinal tract and their clinical manifestations.
| FOOTNOTES |
|---|
2 Real-time PCR data for the uroguanylin and iNOS mRNA assays are available as supplemental data from the online posting of this article at www.nutrition.org. ![]()
3 Present address: Department of Neuroscience, Mayo Clinic Jacksonville, Jacksonville FL 32224. ![]()
5 4 Abbreviations used: DAPI, 6-diamidio-2-phenylindole; GC-C, guanylate cyclase type C; GC-S, soluble guanylate cyclase; IL-1
, interleukin 1
; iNOS, inducible nitric oxide synthase; LGN, lymphoguanylin; MT, metallothionein; NO, nitric oxide; Q-PCR, real-time quantitative polymerase chain reaction; rh, recombinant human; UG, uroguanylin; +Zn, zinc adequate; Zn, zinc deficient. ![]()
Manuscript received 19 August 2002. Initial review completed 10 September 2002. Revision accepted 30 September 2002.
| LITERATURE CITED |
|---|
|
|
|---|
1. Golden, M. H. & Golden, B. E. (1981) Effect of zinc supplementation on the dietary intake, rate of weight gain, and energy cost of tissue deposition in children recovering from severe malnutrition. Am. J. Clin. Nutr. 34:900-908.
2. Hambidge, K. M. (1992) Zinc and diarrhea. Acta Paediatr. Suppl. 381:82-83.[Medline]
3. Okada, A., Takagi, T., Itakura, T., Satani, M., Manabe, H., Iida, Y., Tanigaki, T., Iwasaki, M. & Kasahara, N. (1976) Skin lesions during intravenous hyperalimentation: zinc deficiency. Surgery 80:629-635.[Medline]
4. Rosado, J. L., Lopez, P., Munoz, E., Martinez, H. & Allen, L. (1997) Zinc supplementation reduced morbidity, but neither zinc nor iron supplementation affected growth or body composition of Mexican preschoolers. Am. J. Clin. Nutr. 65:13-19.
5. Sazawal, S., Black, R. E., Bhan, M. K., Bhandari, N., Sinha, A. & Jalla, S. (1995) Zinc supplementation in young children with acute diarrhea in India. N. Engl. J. Med. 333:839-844.
6. Wapnir, R. A. (2000) Zinc deficiency, malnutrition and the gastrointestinal tract. J. Nutr. 130:1388S-1392S.
7. Vallance, P. & Moncada, S. (1994) Nitric oxidefrom mediator to medicines. J. R. Coll. Physicians Lond. 28:209-219.[Medline]
8. Cui, L., Takagi, Y., Wasa, M., Sando, K., Khan, J. & Okada, A. (1999) Nitric oxide synthase inhibitor attenuates intestinal damage induced by zinc deficiency in rats. J. Nutr. 129:792-798.
9. Greenberg, R. N., Hill, M., Crytzer, J., Krause, W. J., Eber, S. L., Hamra, F. K. & Forte, L. R. (1997) Comparison of effects of uroguanylin, guanylin, and Escherichia coli heat stable enterotoxin STa in mouse intestine and kidney: evidence that uroguanylin is an intestinal natriuretic hormone. J. Investig. Med. 45:276-282.[Medline]
10. Forte, L. R. (1999) Guanylin regulatory peptides: structures, biological activities mediated by cyclic GMP and pathobiology. Regul. Pept. 81:25-39.[Medline]
11. Joo, N. S., London, R. M., Kim, H. D., Forte, L. R. & Clarke, L. L. (1998) Regulation of intestinal Cl- and HCO3- secretion by uroguanylin. Am. J. Physiol. 274:G633-G644.
12. Pitari, G. M., Di Guglielmo, M. D., Park, J., Schulz, S. & Waldman, S. A. (2001) Guanylyl cyclase C agonists regulate progression through the cell cycle of human colon carcinoma cells. Proc. Natl. Acad. Sci. U.S.A. 98:7846-7851.
13. Blanchard, R. K. & Cousins, R. J. (1996) Differential display of intestinal mRNAs regulated by dietary zinc. Proc. Natl. Acad. Sci. U.S.A. 93:6863-6868.
14. Blanchard, R. K. & Cousins, R. J. (1997) Upregulation of rat intestinal uroguanylin mRNA by dietary zinc restriction. Am. J. Physiol. 272:G972-G978.
15. Cui, L., Blanchard, R. K., Coy, L. M. & Cousins, R. J. (2000) Prouroguanylin overproduction and localization in the intestine of zinc-deficient rats. J. Nutr. 130:2726-2732.
16. Ciancio, M. J., Vitiritti, L., Dhar, A. & Chang, E. B. (1992) Endotoxin-induced alterations in rat colonic water and electrolyte transport. Gastroenterology 103:1437-1443.[Medline]
17. Blanchard, R. K., Moore, J. B., Green, C. L. & Cousins, R. J. (2001) Modulation of intestinal gene expression by dietary zinc status: effectiveness of cDNA arrays for expression profiling of a single nutrient deficiency. Proc. Natl. Acad. Sci. U.S.A. 98:13507-13513.
18. Villanueva, A., Stockert, J. C. & Armas-Portela, R. (1984) A simple method for the fluorescence analysis of nucleic acid-dye complexes in cytological preparations. Histochemistry 81:103-104.[Medline]
19. Mourelle, M., Vilaseca, J., Guarner, F., Salas, A. & Malagelada, J. R. (1996) Toxic dilatation of colon in a rat model of colitis is linked to an inducible form of nitric oxide synthase. Am. J. Physiol. 270:G425-G430.
20. Singer, I. I., Kawka, D. W., Scott, S., Weidner, J. R., Mumford, R. A., Riehl, T. E. & Stenson, W. F. (1996) Expression of inducible nitric oxide synthase and nitrotyrosine in colonic epithelium in inflammatory bowel disease. Gastroenterology 111:871-885.[Medline]
21. Alican, I. & Kubes, P. (1996) A critical role for nitric oxide in intestinal barrier function and dysfunction. Am. J. Physiol. 270:G225-G237.
22. Currie, M. G., Fok, K. F., Kato, J., Moore, R. J., Hamra, F. K., Duffin, K. L. & Smith, C. E. (1992) Guanylin: an endogenous activator of intestinal guanylate cyclase. Proc. Natl. Acad. Sci. U.S.A. 89:947-951.
23. Fan, X., Wang, Y., London, R. M., Eber, S. L., Krause, W. J., Freeman, R. H. & Forte, L. R. (1997) Signaling pathways for guanylin and uroguanylin in the digestive, renal, central nervous, reproductive, and lymphoid systems. Endocrinology 138:4636-4648.
24. Medvedev, A., Bussygyna, O., Pyatakova, N., Glover, V. & Severina, I. (2002) Effect of isatin on nitric oxide-stimulated soluble guanylate cyclase from human platelets. Biochem. Pharmacol. 63:763-766.[Medline]
25. Closs, E. I., Enseleit, F., Koesling, D., Pfeilschifter, J. M., Schwarz, P. M. & Forstermann, U. (1998) Coexpression of inducible NO synthase and soluble guanylyl cyclase in colonic enterocytes: a pathophysiologic signaling pathway for the initiation of diarrhea by gram-negative bacteria?. FASEB J. 12:1643-1649.
26. Podolsky, D. K. (2002) Inflammatory bowel disease. N. Engl. J. Med. 347:417-429.
27. Hamra, F. K., Forte, L. R., Eber, S. L., Pidhorodeckyj, N. V., Krause, W. J., Freeman, R. H., Chin, D. T., Tompkins, J. A., Fok, K. F., Smith, C. E., Duffin, K. L., Siegel, N. R. & Currie, M. (1993) Uroguanylin: structure and activity of a second endogenous peptide that stimulates intestinal guanylate cyclase. Proc. Natl. Acad. Sci. U.S.A. 90:10464-10468.
28. Dube, P. H., Revell, P. A., Chaplin, D. D., Lorenz, R. G. & Miller, V. L. (2001) A role for IL-1
in inducing pathologic inflammation during bacterial infection. Proc. Natl. Acad. Sci. U.S.A. 98:10880-10885.
29. Fondacaro, J. D., Kolpak, D. C., Burnham, D. B. & McCafferty, G. P. (1990) Cecectomized rat. A model of experimental secretory diarrhea in conscious animals. J. Pharmacol. Methods 24:59-71.[Medline]
30. Ben-Neriah, Y. (2002) Regulatory functions of ubiquitination in the immune system. Nat. Immunol. 3:20-26.[Medline]
31. Abou-Mohamed, G., Papapetropoulos, A., Catravas, J. D. & Caldwell, R. W. (1998) Zn2+ inhibits nitric oxide formation in response to lipopolysaccharides: implication in its anti-inflammatory activity. Eur. J. Pharmacol. 341:265-272.[Medline]
32. Gow, A. & Ischiropoulos, H. (2002) NO running on MT: regulation of zinc homeostasis by interaction of nitric oxide with metallothionein. Am. J. Physiol. 282:L183-L184.
33. St. Croix, C. M., Wasserloos, K. J., Dineley, K. E., Reynolds, I. J., Levitan, E. S. & Pitt, B. R. (2002) Nitric oxide-induced changes in intracellular zinc homeostasis are mediated by metallothionein/thionein. Am. J. Physiol. 282:L185-L192.
34. Goode, H. F., Howdle, P. D., Walker, B. E. & Webster, N. R. (1995) Nitric oxide synthase activity is increased in patients with sepsis syndrome. Clin. Sci. (Lond.) 88:131-133.[Medline]
This article has been cited by other articles:
![]() |
J. P. Liuzzi, L. Guo, S.-M. Chang, and R. J. Cousins Kruppel-like factor 4 regulates adaptive expression of the zinc transporter Zip4 in mouse small intestine Am J Physiol Gastrointest Liver Physiol, March 1, 2009; 296(3): G517 - G523. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Cousins, J. P. Liuzzi, and L. A. Lichten Mammalian Zinc Transport, Trafficking, and Signals J. Biol. Chem., August 25, 2006; 281(34): 24085 - 24089. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||