Journal of Nutrition

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D. K.
Right arrow Articles by Andrews, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D. K.
Right arrow Articles by Andrews, G. K.

© 2003 The American Society for Nutritional Sciences J. Nutr. 133:45-50, January 2003


Nutrient-Gene Interactions

Pancreatic Metallothionein-I May Play a Role in Zinc Homeostasis during Maternal Dietary Zinc Deficiency in Mice1

Dae Kee Lee2, Jim Geiser, Jodi Dufner-Beattie and Glen K. Andrews3

Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, KS 66160-7421

3To whom correspondence should be addressed. E-mail: gandrews{at}kumc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Herein, the function of pancreatic metallothionein (MT)-I during zinc deficiency in pregnancy was examined using transgenic mice, which constitutively express the mouse MT-I gene driven by the rat elastase I promoter. Pancreatic MT protein levels and zinc levels were elevated significantly in the transgenic mice compared with those in control mice. Pregnant transgenic and control mice were fed zinc-deficient (1 µg/g beginning at d 8) or zinc-adequate (50 µg/g) diets during pregnancy, and the effects on the morphology of embryos were determined at d 14 of pregnancy (d 1 = vaginal plug). As other indicators of zinc deficiency, maternal pancreatic MT levels, as well as the expression of zinc-regulated genes in the embryonic visceral yolk sac were examined. Under these experimental conditions of moderate dietary zinc deficiency, 21.3% of the embryos in control mice exhibited morphological defects, whereas only 5.8% of the embryos in the elastase-MT-I transgenic females had developed abnormally by d 14. Surprisingly, dietary zinc deficiency caused a >95% decrease in pancreatic MT protein concentration in these transgenic mice. This suggests the post-transcriptional control of MT protein levels during zinc deficiency because the rat elastase I promoter is not metal-regulated. The decrease in pancreatic MT protein levels was paralleled by a dramatic decrease in the relative abundance of MT-I mRNA and a dramatic increase in the relative abundance of the zinc/iron regulated transporter-related zinc transporter-4 (ZIP4) mRNA in the embryonic visceral yolk sac. Thus, the constitutive overexpression of pancreatic MT-I in these mice attenuated, but did not prevent the effects of maternal or embryonic zinc deficiency under these conditions. Overall, these findings are consistent with the hypothesis that mouse pancreatic MT-I may participate in providing a labile pool of maternal zinc for the developing embryo during periods of zinc deficiency.


KEY WORDS: • mice • metallothionein • pregnancy • transgenic • pancreas • zinc homeostasis

Understanding the mechanisms by which zinc homeostasis is achieved is an area of active investigation. A deficiency of this essential trace element in humans and laboratory rodents impairs many fundamental biological processes (1Citation –3Citation ) including embryonic and fetal development (4Citation –8Citation ), the ability to fight disease (8Citation –11Citation ), carcinogenesis (12Citation ), and taste, vision and other brain functions (13Citation –16Citation ). The diverse effects of zinc deficiency reflect the fact that this metal is important for the proper structure and function of a large number of proteins.

All organisms have adapted mechanisms to regulate the uptake, efflux and storage of zinc, and several mammalian genes involved in these processes have been identified (17Citation –19Citation ). Integral membrane proteins, members of a zinc transporter superfamily (ZnT1–6),4 which efflux zinc from cells or function in the vesicular storage of zinc inside of cells have been reported (19Citation –21Citation ). In addition, members of the ZIP family of membrane-spanning zinc transporters are also found in mammals and appear to be responsible for zinc uptake (18Citation ). The human genetic disease of zinc metabolism, acrodermatitis enteropathica (22Citation ,23Citation ), was recently mapped to the human ZIP4 gene (24Citation –26Citation ). Thus, the expression and regulation of several zinc transport proteins is central to zinc homeostasis in higher eukaryotes.

The cysteine-rich metallothioneins (MT) also play a role in mammalian zinc homeostasis (27Citation ). MT are abundant intracellular zinc-binding proteins that are isolated from normal mouse tissues as zinc7-complexes (28Citation ). Furthermore, MT-I gene expression is regulated by the zinc-dependent transcription factor MTF-1 (29Citation ). Cells exposed to zinc accumulate relatively large amounts of MT. Reciprocally, MT expression is diminished and MT protein is degraded during periods of zinc deficiency. Thus, it has been hypothesized that MT provides a biologically important labile pool of zinc in mice. This concept is supported by studies of transgenic mice that overexpress MT-I (30Citation ) or that have loss-of-function mutations (gene knockout) in the MT-I/II genes (31Citation ,32Citation ). Transgenic overexpression of MT-I in mice, under the control of its own promoter, causes increased accumulation of zinc in many maternal organs, and results in significantly increased resistance to the teratogenic effects of dietary zinc deficiency during pregnancy (33Citation ). In contrast, studies of MT-I/II knockout mice demonstrated increased sensitivity to dietary zinc deficiency during pregnancy (34Citation ), as well as during the neonatal period (35Citation ). The ability to maintain zinc homeostasis during pregnancy was impaired in these mice (36Citation ), as was intestinal secretion of zinc (37Citation ,38Citation ) and the ability of the pancreas to retain zinc (39Citation ).

These studies demonstrate that MT is important for proper zinc homeostasis in mice and imply possible tissue-specific roles of MT in this process. In mice, the MT genes are expressed in a cell-type specific manner in maternal and embryonic tissues (40Citation ,41Citation ). Among the adult organs, there are particularly high concentrations of MT in the pancreas (42Citation ,43Citation ), and MT has been detected in pancreatic exocrine secretions (43Citation ). The pancreas has been implicated in zinc homeostasis (44Citation ), and a large amount of zinc is released from the pancreas into the intestinal tract (45Citation ). The objective of these studies was to address the roles of pancreatic MT in zinc homeostasis during pregnancy. Specifically, we sought to determine whether genetic manipulation of pancreatic MT-I levels in mice could alter the detrimental effects of maternal dietary zinc deficiency during pregnancy on embryonic development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Animals and diets.

All experiments involving animals were conducted in accordance with NIH guidelines for the care and use of experimental animals, and all animal experiments were approved by our Institutional Animal Care and Use Committee. Transgenic mice were created as described below, using eggs obtained from C57Bl/6 females bred with SJL males. Transgenic mice were bred to CD-1 females (48–60 d old; Charles River Breeding Laboratories, Raleigh, NC) for three generations. The heterozygous transgenic mice obtained were then inbred to yield homozygous transgenic mice and nontransgenic control littermates. Those mice were then inbred to create a working colony of animals, and age-matched mice of each strain were compared.

Mouse diets were all purchased from Harlan Teklad (Madison, WI) and have been described in detail previously (33Citation ). Zinc levels in the diets were as follows: zinc-deficient (Zn-D), 7.7–15.4 µmol/L (1 µg/g); zinc-adequate (Zn-A), 769 µmol/L (50 µg/g). These diets each contained ~18 µg/g Cu, and were otherwise identical.

Experimental designs.

Experiments were initially designed to examine the organ specificity and extent of overexpression of MT-I in transgenic mice relative to control mice. In addition, the effects of pancreatic overexpression of MT-I on zinc levels in the pancreas were determined. Mice in these experiments were fed the Zn-A diet. At least six female mice per group (age 40–60 d) were killed and each pancreas, kidney, liver and intestine was harvested, rapidly frozen in liquid nitrogen and later assayed in sextuplet for Cd-binding activity (MT) and zinc content. Similarly, liver, intestine and kidney were harvested from at least 6 mice per group, and samples were pooled and frozen in liquid nitrogen for subsequent RNA extraction and Northern blot analysis. Also, pancreas samples from these mice were processed immediately for RNA extraction and Northern blotting rather than being frozen.

Experiments were then designed to determine whether pancreatic overexpression of MT-I in these transgenic mice attenuates the detrimental effects of maternal dietary zinc deficiency on embryonic development. These experiments were conducted according to Experimental Design 4 published previously (34Citation ). Homozygous transgenic female mice and control female mice (40–60 d old) were mated with CD-1 male mice. On d 1 (vaginal plug) of pregnancy, mice were placed in pairs in cages with stainless steel false bottoms to reduce recycling of zinc (46Citation ). Mice had free access to the Zn-A feed and deionized-distilled water. Water bottles were washed in 4 mol/L HCl and rinsed in deionized water to remove zinc (46Citation ). On d 8, the diet was changed to the Zn-D diet (or where indicated, mice continued to consume the Zn-A diet), and effects on embryonic development were examined on d 14. The total number of implantation sites and the number of resorbed and nonresorbed implantation sites per uterus were determined visually, and the morphology of nonresorbed fetuses was determined by examination under a dissecting microscope.

Further experiments were designed to determine whether pancreatic overexpression of MT-I in these transgenic mice attenuates other sensitive measures of zinc deficiency, such as the loss of maternal pancreatic MT and alterations in the expression of zinc-regulated genes in the embryonic visceral yolk sac. Tissues were collected on d 14 of pregnancy from transgenic mice (Zn-A or Zn-D; n = 6), treated as described above. Individual maternal pancreata were frozen in liquid nitrogen and later assayed in sextuplet for Cd-binding activity. Embryonic visceral yolk sacs were collected and pooled from implantation sites, frozen in liquid nitrogen and later assayed by Northern blot hybridization for relative levels of MT-I and ZIP4 mRNAs, as measures of embryonic zinc status (33Citation ,47Citation ).

Creation of elastase-MT-I transgenic mice.

The rat elastase I promoter and the human growth hormone 3'-untranslated region (UTR) and polyadenylation signal were provided by Dr. Ray MacDonald (University of Texas Health Sciences Center, Dallas, TX). The proximal 500-bp of this promoter is sufficient to direct cell-specific gene expression in pancreatic acinar cells in transgenic mice (48Citation –50Citation ). The mouse MT-I gene was provided by Dr. Richard Palmiter (University of Washington, Seattle, WA). This gene is ~1 kb in length and the protein coding region is divided into three exons (51Citation ). A rat elastase promoter/MT-I gene/human growth hormone 3'-UTR fusion gene was engineered. In this construct, the rat elastase promoter (-500 to + 8 bp) was ligated to the mouse MT-I gene at +17. The 617-bp human growth hormone 3'-UTR and polyadenylation signal (+1540 to +2157) (50Citation ) was ligated to the MT-I gene at +953 bp, just after the translation stop codon (Fig. 1Citation ). This ~2-kb fusion gene was released from the plasmid vector and purified from an agarose gel using a Qiagen Gel Extraction Kit (Valencia, CA) and further purified by phenol/chloroform/isoamyl alcohol extractions. DNA was ethanol-precipitated and redissolved in microinjection buffer (10 mmol/L Tris-HCl, 0.25 mmol/L EDTA, pH 7.4). DNA concentration was measured by fluorometry and diluted to 1 ng/µL for microinjection. DNA microinjection and manipulation were conducted at the Institutional Transgenic and Gene Targeting Facility at the University of Kansas Medical Center.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 1 Structure of a fusion gene consisting of the rat elastase I promoter-mouse metallothionein (MT)-I gene-human growth hormone 3' untranslated region (UTR) and polyadenylation signal. The rat elastase I promoter (-500 to +8 bp) (48Citation ) was ligated to the mouse MT-I gene (53Citation ) at +17. The human growth hormone 3'-UTR and polyadenylation signal (+1540 to +2157) (50Citation ) was ligated to the MT-I gene at +953 bp, just after the translation stop codon in exon III. This DNA was gel purified and used for microinjection to create transgenic mice. The presence of the transgene was confirmed by polymerase chain reaction (PCR) of genomic DNA using a primer in the rat elastase I promoter (-219 bp) and a primer in the mouse MT-I gene (+88 bp). Homozygosity was confirmed by outbreeding to CD-1 mice and analysis of the genotype of the offspring.

 
Polymerase chain reaction (PCR) genotyping of transgenic mice.

PCR was used to determine the genotype of DNA from mice using reaction conditions described previously (52Citation ). Genotyping of elastase-MT-I transgenic mice was performed using antisense-strand primer (GAGTCTTACCGGTGGAGCAGGAG) beginning at +88 bp in the mouse MT-I gene (53Citation ) and a sense-strand primer (CTTGGGTTAACTGAGTGCCGGCC) beginning at -219 bp in the rat elastase I promoter (48Citation ). Homozygosity of transgenic mice was confirmed by outbreeding to CD-1 mice and PCR genotyping of the offspring.

Northern blot detection of MT-I and ZIP4 mRNAs.

Tissue RNAs were isolated as described in detail previously (47Citation ,54Citation ). Total RNA (3 µg) was size fractionated by agarose-formaldehyde gel electrophoresis, transferred and cross-linked to nylon membranes (55Citation ). Northern blots membranes were hybridized and washed under stringent conditions as described (33Citation ,54Citation ,55Citation ). Hybrids were detected by autoradiography with intensifying screens at -70°C, and quantitated by radioimage analysis (Molecular Dynamics, Sunnyvale, CA). Although not shown, duplicate gels were stained with acridine orange or the same membrane was rehybridized with a glyceraldehyde phosphate dehydrogenase (GAPDH) probe to monitor RNA loading and integrity (54Citation ).

Mouse MT-I probe was as described (33Citation ). The mouse GAPDH probe was cloned by reverse transcription (RT)-PCR (see below) of the protein coding region (Genbank accession number M32599) using mouse liver RNA. The mouse ZIP4 cDNA was identified by homology with human ZIP4 (25Citation ) in the GenBank mouse nonredundant data base on the NCBI server as a 2264-bp cDNA (accession number AK005535). The protein coding region of ZIP4 mRNA was amplified by RT-PCR from mouse intestinal RNA using the Improm-II Reverse Transcriptase kit (Promega, Madison, WI) and Pfu polymerase (Stratagene, La Jolla, CA) for PCR. The sense primer began at +86 and the antisense primer began at + 2156 in this cDNA. Each primer was 26 bp in length. The RT-PCR product was cloned and the DNA sequence confirmed. Probes were labeled using the Random Primers DNA Labeling System according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Probes had specific activities ranging from 10 to 30 GBq/µg.

Cadmium-hemoglobin exchange assay for MT (Cd-binding proteins).

Steady-state levels of total MT were quantitated using the cadmium-hemoglobin exchange assay (56Citation ).

Atomic adsorption spectrophotometry.

Samples were weighed, vacuum dried and then digested in nitric acid. Zinc was quantitated in the acid extract using a Perkin Elmer 540 flame atomic adsorption spectrophotometer. Bovine liver (Standard Reference Material 1577b; National Institute of Standards and Technology; Gaithersburg, MD) was used as a reference standard for zinc content.

Statistical analysis.

Data were analyzed using ANOVA and Student’s t test (Student-Newman-Keuls method). Differences were considered significant when P < 0.05. Values are reported as means ± SEM.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
MT levels are elevated specifically in the pancreas of elastase-MT-I transgenic mice.

Transgenic mice in which the mouse MT-I gene is expressed under the control of the rat elastase I promoter were created (Fig. 1)Citation . The rat elastase I promoter has been shown to direct pancreatic acinar cell-specific expression of the human growth hormone gene in transgenic mice. In initial experiments, 11 transgenic founder lines were created using the intact mouse MT-I gene downstream of the elastase promoter. Although several of these transgenic lines displayed low level expression of the transgene in the pancreas, none had detectably elevated MT levels (data not shown). As shown previously (33Citation ), MT levels in the normal mouse pancreas were greater than those in the kidney, intestine and liver (Table 1Citation ).


View this table:
[in this window]
[in a new window]
 
TABLE 1 Metallothionein (MT) concentrations in various tissues of elastase-MT-I transgenic and control female mice1

 
In subsequent experiments, the 3' UTR of the MT-I gene was replaced with the 3' UTR and polyadenylation signal from the human growth hormone gene in an attempt to circumvent any potential contribution of that region of the MT-I mRNA to its stability or processing. Four separate transgenic lines were created with this construct (Fig. 1)Citation and one line displayed increased MT concentration in the pancreas (Table 1)Citation . This transgenic mouse strain was bred to homozygosity and examined in detail. The transgenic mice had elevated MT levels in the pancreas, but not in the liver, intestine or kidney compared with the control, nontransgenic mice. MT levels in the pancreas of the transgenic mice varied among individuals, but were five to seven times higher than those in the control pancreas (also see Fig. 2Citation ). Northern blot hybridization suggested that MT-I mRNA in the pancreas was also more abundant in the transgenic than in the control mice (Fig. 2)Citation , but was not more abundant in the other organs examined. In this experiment, MT-I mRNA levels in the liver of the transgenic mice also appeared elevated relative to those in the liver of the nontransgenic control mice. However, this was not reproducible and MT protein levels were not elevated in the liver of these transgenic mice. Among the organs examined, MT mRNA was most abundant in the pancreas of the transgenic mice. No further attempt was made to determine the relative abundance of the endogenous MT-I mRNA transcripts compared with the transgene transcripts in these mice.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 2 Northern blot detection of metallothionein (MT)-I mRNA in organs from nontransgenic control and elastase-MT-I transgenic mice. The pancreas, liver, intestine and kidney were recovered from control (+/+) and homozygous transgenic (Tg/Tg) female mice (n = 6 each). Total RNA was isolated and subjected to Northern blot analysis using an MT-I probe. Hybrids were detected by autoradiography and quantitated by radioimage analysis. A duplicate gel was stained with acridine orange and this membrane was also hybridized with a glyceraldehyde phosphate dehydrogenase (GAPDH) probe (data not shown) as controls for RNA integrity, loading and blotting. (A) Tissue blot. (B) Pancreatic RNA from two individual nontransgenic control (+/+) mice and elastase-MT-I transgenic (Tg/Tg) mice.

 
Analysis of pancreatic zinc concentration, using flame atomic adsorption spectrophotometry suggested a 100% increase (P = 0.02) in zinc in the pancreas of transgenic mice (3.6 ± 0.66 µmol/g ash weight, n = 7) relative to the pancreas of the control mice (1.78 ± 0.17 µmol/g ash weight, n = 7). The higher levels of pancreatic MT in these transgenic mice accounted for the increase in the zinc concentration in the pancreas.

Pancreatic overexpression of MT-I correlates with decreased sensitivity to dietary zinc deficiency during pregnancy.

In either transgenic or control mice fed the Zn-A diet during pregnancy, essentially no abnormal embryos were detected on d 14 (data shown for control mice only). In contrast, the zinc deficiency created in this experiment resulted in impaired growth, delayed and/or abnormal development and separation of the digits in the d-14 mouse embryo. In the control mice, 21.3% of the embryos exhibited morphological defects (Table 2Citation ). In contrast, only 5.8% of the embryos in the elastase-MT-I transgenic females had developed abnormally by d 14.


View this table:
[in this window]
[in a new window]
 
TABLE 2 Teratogenic effects of dietary zinc deficiency (1 µg/g) beginning on d 8 of pregnancy in elastase metallothionein (MT)-I transgenic and control mice

 
Pancreatic overexpression of MT-I in elastase-MT-I transgenic mice does not ameliorate the effects of dietary zinc deficiency during pregnancy.

MT levels in the pancreas of the transgenic mice declined >95% during zinc deficiency (Fig. 3ACitation ). MT levels were highly variable but were detectable in the transgenic zinc-deficient mice. MT levels in the pancreas from control mice also declined >95% under these conditions (data not shown), as reported previously (33Citation ).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3 Effects of dietary zinc deficiency on maternal metallothionein (MT) protein levels in the pancreas (A), and the relative abundance of MT-I and zinc/iron regulated transporter-related zinc transporter (ZIP)4 mRNAs in the embryonic visceral yolk sac (B) from pregnant elastase-MT-I transgenic mice. Pregnant transgenic (Tg/Tg) mice were fed a zinc adequate (Zn-A) or a zinc deficient (Zn-D) diet beginning on d 8 of pregnancy, and the maternal pancreas and/or embryonic visceral yolk sacs were recovered on d 14. (A) Values are means ± SEM, n = 6. *Different from the ZnA group (P < 0.0001). (B) Total RNA was isolated from the visceral yolk sacs (pooled from 6 pregnant mice) collected from pregnant transgenic mice, and subjected to Northern blot hybridization simultaneously with a mouse MT-I and a mouse ZIP4 probe. Hybrids were detected by autoradiography and their positions are indicated by the arrows.

 
Another measure of zinc deficiency during pregnancy is the expression of zinc-regulated genes in the embryonic visceral yolk sac (47Citation ). As shown in Figure 3Citation B, MT-I mRNA levels were depressed and ZIP4 mRNA levels were elevated in the visceral yolk sacs taken from transgenic mice during maternal dietary zinc deficiency.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Studies of mice genetically engineered to overexpress MT-I (30Citation ) or not to express MT-I/II genes (31Citation ,32Citation ) suggest that one of the multitude of functions of these proteins is in zinc metabolism (27Citation ). Involvement in the secretion, retention and tissue distribution of zinc in various organs has been reported. For example, MT may reduce the efficiency of zinc uptake by the intestine (38Citation ,57Citation ), but increase pancreatic and hepatic retention of this essential metal (39Citation ,58Citation ). In the absence of MT, more zinc is released into the gut. Thus, although the MT-I/II genes are nonessential, they serve to protect mice against periods of zinc excess and deficiency (33Citation –36Citation ,59Citation ).

Although the consequences of global alterations in MT-I/II gene expression in mice have been examined in some detail, as discussed above, the effects of tissue-specific alterations in the expression of these genes have not. It has been reported that overexpression of MT-III, a predominantly neuronal member of the MT family of genes, inhibits the growth of cultured cells (60Citation ), and ectopic expression in the pancreas of transgenic mice causes necrosis of that organ (61Citation ). This is not the case for MT-I, as reported herein. Ectopic expression of MT-I in the pancreas leads to increased zinc and MT levels with no detrimental effects on that organ. This is not unexpected because the growth inhibitory activity of MT-III does not reflect its metal-binding activity but rather its unique structure (62Citation ,63Citation ), and transgenic mice that overexpress the MT-I gene accumulate very high levels of MT-I in the pancreas (33Citation ) with no detrimental effects.

The pancreas is important for zinc homeostasis (44Citation ,64Citation –66Citation ), and a significant amount of zinc is released from the pancreas into the intestinal tract (45Citation ). In mice, the MT-I/II genes are expressed in a cell-type specific manner in several maternal and embryonic tissues (40Citation ,41Citation ), and particularly high concentrations of MT are found in the pancreas (42Citation ,43Citation ) and its exocrine secretions (43Citation ). In control mice, MT-bound zinc represents ~20% of the total tissue zinc pool in the pancreas (33Citation ). In addition, pancreatic MT gene expression and protein levels are remarkably responsive to dietary zinc (33Citation ), and the loss of MT from the pancreas is pronounced during the organogenic period if maternal dietary zinc is limiting (33Citation ). These findings suggest that pancreatic MT may play a role in zinc homeostasis. Results reported herein provide direct evidence in support of that concept. Overexpression of MT-I specifically in the pancreas provided measurable protection for the embryo against the effects of moderate dietary zinc deficiency during pregnancy. However, the extent of protection against zinc deficiency was relatively modest compared with that provided by the transgenic overexpression of MT-I throughout the animal (33Citation ). In the latter transgenic mice, embryos were essentially completely protected against the effects of severe dietary zinc deficiency by midgestation. Thus, as is expected, pancreatic MT-I represents only one component of the zinc homeostatic mechanism in mice.

How pancreatic MT-I functions in zinc homeostasis is suggested by the findings that it provides a mechanism to maintain zinc in the pancreas (39Citation ), and that its overexpression leads to increased zinc levels in this organ (33Citation ). This pancreatic zinc-MT provides a labile pool of zinc. During periods of zinc deficiency, the pancreatic zinc-MT pool is degraded and/or excreted, which contributes to zinc efflux either into the blood stream or into the intestinal lumen. Evidence in support of the latter concept is provided by the detection of MT protein in pancreatic secretions (43Citation ), and the observation that nearly as much zinc is lost in bile-pancreatic secretions as is absorbed by the intestine under normal dietary conditions (44Citation ,67Citation ). During periods of zinc deficiency, the intestinal absorption of zinc is increased (68Citation –70Citation ). Thus, although the amount of pancreatic zinc-MT is small relative to that in the entire animal, it is uniquely positioned to provide a pool of zinc that can be directly secreted into and then reabsorbed by the intestines during periods of zinc deficiency (71Citation ).

During the course of these studies, we found that MT levels in the pancreas of these transgenic mice were severely depleted by dietary zinc deficiency. This was unexpected because expression of the MT-I transgene was under control of the rat elastase-I promoter rather than the metal-regulated MT-I promoter. Thus, our studies suggest that post-transcriptional mechanisms can play an important role in regulating MT protein levels. Whether this mechanism involves destabilization of MT-I mRNA and/or protein was not examined. The stability of MT mRNA does increase during exposure of cells to zinc or cadmium (72Citation ), and that mechanism is not understood. However, protein stability also plays a role in regulating MT levels. The turnover of MT has been shown to increase in vivo in cadmium-treated rats and cultured cells (73Citation ), and apo-MT is more susceptible to protease cleavage than is the metallated protein (74Citation ). During zinc deficiency, MT may be demetallated and actively degraded. Overall, these studies suggest that MT protein levels are ultimately regulated by several mechanisms, transcriptional and post-transcriptional, which may reflect a fundamental role of this protein in zinc homeostasis.


    ACKNOWLEDGMENTS
 
We are indebted to Steve Eklund for technical assistance, and to Ray MacDonald and Richard Palmiter for providing reagents essential for these experiments. We also thank Wenhao Xu in the Institutional Transgenic and Gene Targeting Facility at KUMC.


    FOOTNOTES
 
1 Supported, in part, by National Institutes of Health grant CA-61262 to G.K.A. J.D.-B. was supported, in part, by NICHD 07455 Back

2 Present address: Department of Genetics, University of North Carolina, Chapel Hill, NC 27599-7264 Back

4 Abbreviations used: GAPDH, glyceraldehyde phosphate dehydrogenase; MT, metallothionein; RT-PCR, reverse transcription-polymerase chain reaction; UTR, untranslated region; Zn-A, zinc-adequate diet; Zn-D, zinc-deficient diet; ZnT, zinc transporter; ZIP, zinc/iron regulated transporter-related zinc transporter. Back

Manuscript received 15 August 2002. Initial review completed 13 September 2002. Revision accepted 30 September 2002.


    LITERATURE CITED
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Beyersmann, D. & Haase, H. (2001) Functions of zinc in signaling, proliferation and differentiation of mammalian cells. Biometals 14:331-341.[Medline]

2. Prasad, A. S. (1984) Discovery and importance of zinc in human nutrition. Fed. Proc. 43:2829-2834.[Medline]

3. Prasad, A. S. (1998) Zinc deficiency in humans: a neglected problem. J. Am. Coll. Nutr. 17:542-543.[Free Full Text]

4. Hurley, L. S., Gowen, J. & Swenerton, H. (1971) Teratogenic effects of short-term and transitory zinc deficiency in rats. Teratology 4:199-204.

5. Hurley, L. S. & Shrader, R. E. (1975) Abnormal development of preimplantation rat eggs after three days of maternal dietary zinc deficiency. Nature (Lond.) 254:427-429.[Medline]

6. Jankowski, M. A., Uriu-Hare, J. Y., Rucker, R. B., Rogers, J. M. & Keen, C. L. (1995) Maternal zinc deficiency, but not copper deficiency or diabetes, results in increased embryonic cell death in the rat: implications for mechanisms underlying abnormal development. Teratology 51:85-93.[Medline]

7. Gilabert, E. R., Ruiz, E., Osorio, C. & Ortega, E. (1996) Effect of dietary zinc deficiency on reproductive function in male rats: biochemical and morphometric parameters. J. Nutr. Biochem. 7:403-407.

8. Black, M. M. (1998) Zinc deficiency and child development. Am. J. Clin. Nutr. 68(suppl.):464S-469S.[Abstract]

9. Black, R. E. (1998) Therapeutic and preventive effects of zinc on serious childhood infectious diseases in developing countries. Am. J. Clin. Nutr. 68(suppl.):476S-479S.[Abstract]

10. Fraker, P. J., King, L. E., Laakko, T. & Vollmer, T. L. (2000) The dynamic link between the integrity of the immune system and zinc status. J. Nutr. 130:1399S-1406S.[Abstract/Free Full Text]

11. Kupka, R. & Fawzi, W. (2002) Zinc nutrition and HIV infection. Nutr. Rev. 60:69-79.[Medline]

12. Fong, L. Y. Y. & Magee, P. N. (1999) Dietary zinc deficiency enhances esophageal cell proliferation and N-nitrosomethylbenzylamine (NMBA)-induced esophageal tumor incidence in C57BL/6 mouse. Cancer Lett. 143:63-69.[Medline]

13. Goto, T., Komai, M., Suzuki, H. & Furukawa, Y. (2001) Long-term zinc deficiency decreases taste sensitivity in rats. J. Nutr. 131:305-310.[Abstract/Free Full Text]

14. Kudo, H., Doi, Y., Nishino, T., Nara, S., Hamasaki, K. & Fujimoto, S. (2000) Dietary zinc deficiency decreases glutathione S-transferase expression in the rat olfactory epithelium. J. Nutr. 130:38-44.[Abstract/Free Full Text]

15. Gong, H. Q. & Amemiya, T. (2001) Optic nerve changes in zinc-deficient rats. Exp. Eye Res. 72:363-369.[Medline]

16. Sandstead, H. H. (2000) Causes of iron and zinc deficiencies and their effects on brain. J. Nutr. 130(suppl.):347S-349S.

17. McMahon, R. J. & Cousins, R. J. (1998) Mammalian zinc transporters. J. Nutr. 128:667-670.[Abstract/Free Full Text]

18. Gaither, L. A. & Eide, D. J. (2001) Eukaryotic zinc transporters and their regulation. Biometals 14:251-270.[Medline]

19. Harris, E. D. (2002) Cellular transporters for zinc. Nutr. Rev. 60:121-124.[Medline]

20. Huang, L., Kirschke, C. P. & Gitschier, J. (2000) Functional characterization of a novel mammalian zinc transporter, ZnT6. J. Biol. Chem. .

21. Inoue, K., Matsuda, K., Itoh, M., Kawaguchi, H., Tomoike, H., Aoyagi, T., Nagai, R., Hori, M., Nakamura, Y. & Tanaka, T. (2002) Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5. Hum. Mol. Genet. 11:1775-1784.[Abstract/Free Full Text]

22. Lorincz, A. L. (1967) Acrodermatitis enteropathica. Arch. Dermatol. 96:736-737.[Medline]

23. Desmons, F. & Walbaum, R. (1979) Genetics of hereditary cutaneous diseases associated with digestive tract involvement. Ann. Dermatol. Venereol. 106:9-12.[Medline]

24. Wang, K., Pugh, E. W., Griffen, S., Doheny, K. F., Mostafa, W. Z., al Aboosi, M. M., el Shanti, H. & Gitschier, J. (2001) Homozygosity mapping places the acrodermatitis enteropathica gene on chromosomal region 8q24.3. Am. J. Hum. Genet. 68:1055-1060.[Medline]

25. Wang, K., Zhou, B., Kuo, Y.-M. & Gitschier, J. (2002) A novel member of a zinc transporter family is defective in acrodermatitis enteropathica. Am. J. Hum. Genet. 71:66-73.[Medline]

26. Kury, S., Devilder, M. C., Avet-Loiseau, H., Dreno, B. & Moisan, J. P. (2001) Expression pattern, genomic structure and evaluation of the human SLC30A4 gene as a candidate for acrodermatitis enteropathica. Hum. Genet. 109:178-185.[Medline]

27. Coyle, P., Philcox, J. C., Carey, L. C. & Rofe, A. M. (2002) Metallothionein: the multipurpose protein. Cell Mol. Life Sci. 59:627-647.[Medline]

28. Andrews, G. K. (1990) Regulation of metallothionein gene expression. Prog. Food Nutr. Sci. 14:193-258.[Medline]

29. Andrews, G. K. (2001) Cellular zinc sensors: MTF-1 regulation of gene expression. Biometals 14:223-237.[Medline]

30. Palmiter, R. D., Sandgren, E. P., Koeller, D. M. & Brinster, R. L. (1993) Distal regulatory elements from the mouse metallothionein locus stimulate gene expression in transgenic mice. Mol. Cell. Biol. 13:5266-5275.[Abstract/Free Full Text]

31. Masters, B. A., Kelly, E. J., Quaife, C. J., Brinster, R. L. & Palmiter, R. D. (1994) Targeted disruption of metallothionein I and II genes increases sensitivity to cadmium. Proc. Natl. Acad. Sci. U.S.A. 91:584-588.[Abstract/Free Full Text]

32. Michalska, A. E. & Choo, K.H.A. (1993) Targeting and germ-line transmission of a null mutation at the metallothionein I and II loci in mouse. Proc. Natl. Acad. Sci. U.S.A. 90:8088-8092.[Abstract/Free Full Text]

33. Dalton, T. P., Fu, K., Palmiter, R. D. & Andrews, G. K. (1996) Transgenic mice that over-express metallothionein-I resist dietary zinc deficiency. J. Nutr. 126:825-833.

34. Andrews, G. K. & Geiser, J. (1999) Expression of metallothionein-I and -II genes provides a reproductive advantage during maternal dietary zinc deficiency. J. Nutr. 129:1643-1648.[Abstract/Free Full Text]

35. Kelly, E. J., Quaife, C. J., Froelick, G. J. & Palmiter, R. D. (1996) Metallothionein I and II protect against zinc deficiency and zinc toxicity in mice. J. Nutr. 126:1782-1790.

36. Rofe, A. M., Philcox, J. C., Sturkenboom, M. & Coyle, P. (1999) Zinc homeostasis during pregnancy in metallothionein-null mice on a low zinc diet. Klaassen, C. eds. Metallothionein IV 1999:309-313 Birkhauser Verlag Basel, Switzerland .

37. Coyle, P., Philcox, J. C. & Rofe, A. M. (2000) Zn-depleted mice absorb more of an intragastric Zn solution by a metallothionein-enhanced process than do Zn-replete mice. J. Nutr. 130:835-842.[Abstract/Free Full Text]

38. Hinskens, B., Philcox, J. C., Coyle, P. & Rofe, A. M. (2000) Increased zinc absorption but not secretion in the small intestine of metallothionein-null mice. Biol. Trace Elem. Res. 78:231-240.[Medline]

39. Rofe, A. M., Winters, N., Hinskens, B., Philcox, J. C. & Coyle, P. (1999) The role of the pancreas in intestinal zinc secretion in metallothionein-null mice. Pancreas 19:69-75.[Medline]

40. Andrews, G. K., McMaster, M. T., De, S. K., Paria, B. C. & Dey, S. K. (1993) Cell-specific expression and regulation of the mouse metallothionein-I and -II genes in the reproductive tract and preimplantation embryo. Suzuki, K. T. Imura, N. Kimura, M. eds. Metallothionein III: Biological Roles and Medical Implications 1993:351-362 Birkhauser Verlag Basal/Switzerland .

41. Nishimura, H., Nishimura, N. & Tohyama, C. (1989) Immunohistochemical localization of metallothionein in developing rat tissues. J. Histochem. Cytochem. 37:715-722.[Abstract]

42. Onosaka, S., Min, K.-S., Fujita, Y., Tanaka, K., Iguchi, S. & Okada, Y. (1988) High concentration of pancreatic metallothionein in normal mice. Toxicology 50:27-35.[Medline]

43. De Lisle, R. C., Sarras, M. P., Jr, Hidalgo, J. & Andrews, G. K. (1996) Metallothionein is a component of exocrine pancreas secretion: Implications for zinc homeostasis. Am. J. Physiol. 271:C1103-C1110.[Abstract/Free Full Text]

44. McClain, C. J. (1990) The pancreas and zinc homeostasis. J. Lab. Clin. Med. 116:275-276.[Medline]

45. Van Wouwe, J. P. & Uijlenbroek, J. J. M. (1994) The role of the pancreas in the regulation of zinc status. Biol. Trace Elem. Res. 42:143-150.[Medline]

46. Cook Mills, J. M. & Fraker, P. J. (1993) Functional capacity of the residual lymphocytes from zinc-deficient adult mice. Br. J. Nutr. 69:835-848.[Medline]

47. Andrews, G. K., Lee, D. K., Ravindra, R., Lichtlen, P., Sirito, M., Sawadogo, M. & Schaffner, W. (2001) The transcription factors MTF-1 and USF1 cooperate to regulate mouse metallothionein-I expression in response to the essential metal zinc in visceral endoderm cells during early development. EMBO J. 20:1114-1122.[Medline]

48. Hammer, R. E., Swift, G. H., Ornitz, D. M., Quaife, C. J., Palmiter, R. D., Brinster, R. L. & MacDonald, R. J. (1987) The rat elastase I regulatory element is an enhancer that directs correct cell specificity and developmental onset of expression in transgenic mice. Mol. Cell Biol. 7:2956-2967.[Abstract/Free Full Text]

49. MacDonald, R. J., Hammer, R. E., Swift, G. H., Ornitz, D. M., Davis, B. P., Palmiter, R. D. & Brinster, R. L. (1986) Tissue-specific expression of pancreatic genes in transgenic mice. Ann. N. Y. Acad. Sci. 478:131-146.[Medline]

50. Ornitz, D. M., Palmiter, R. D., Hammer, R. E., Brinster, R. L., Swift, G. H. & MacDonald, R. J. (1985) Specific expression of an elastase-human growth hormone fusion gene in pancreatic acinar cells of transgenic mice. Nature 313:600-602.[Medline]

51. Glanville, N., Durnam, D. M. & Palmiter, R. D. (1981) Structure of mouse metallothionein-I gene and its mRNA. Nature (Lond.) 292:267-269.[Medline]

52. Lee, D. K., Fu, K., Liang, L., Dalton, T. P., Palmiter, R. D. & Andrews, G. K. (1996) Transgenic mouse blastocysts that over-express metallothionein-I resist cadmium toxicity in vitro. Mol. Reprod. Devel. 43:158-166.[Medline]

53. Searle, P. F., Davison, B. L., Stuart, G. W., Wilkie, T. M., Norstedt, G. & Palmiter, R. D. (1984) Regulation, linkage, and sequence of mouse metallothionein I and II genes. Mol. Cell. Biol. 4:1221-1230.[Abstract/Free Full Text]

54. Langmade, S. J., Ravindra, R., Daniels, P. J. & Andrews, G. K. (2000) The transcription factor MTF-1 mediates metal regulation of the mouse ZnT1 gene. J. Biol. Chem. 275:34803-34809.[Abstract/Free Full Text]

55. Dalton, T. P., Palmiter, R. D. & Andrews, G. K. (1994) Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements. Nucleic Acids Res. 22:5016-5023.[Abstract/Free Full Text]

56. Eaton, D. L. & Cherian, M. G. (1991) Determination of metallothionein in tissues by cadmium-hemoglobin affinity assay. Methods Enzymol 205:83-88.[Medline]

57. Davis, S. R., McMahon, R. J. & Cousins, R. J. (1998) Metallothionein knockout and transgenic mice exhibit altered intestinal processing of zinc with uniform zinc-dependent zinc transporter-1 expression. J. Nutr. 128:825-831.[Abstract/Free Full Text]

58. Coyle, P., Philcox, J. C. & Rofe, A. M. (1995) Hepatic zinc in metallothionein-null mice following zinc challenge: In vivo and in vitro studies. Biochem. J. 309:25-31.

59. Maret, W. (2000) The function of zinc metallothionein: a link between cellular zinc and redox state. J. Nutr. 130:1455S-1458S.[Abstract/Free Full Text]

60. Palmiter, R. D. (1995) Constitutive expression of metallothionein-III (MT-III), but not MT-I, inhibits growth when cells become zinc deficient. Toxicol. Appl. Pharmacol. 135:139-146.[Medline]

61. Quaife, C. J., Kelly, E. J., Masters, B. A., Brinster, R. L. & Palmiter, R. D. (1998) Ectopic expression of metallothionein-III causes pancreatic acinar cell necrosis in transgenic mice. Toxicol. Appl. Pharmacol. 148:148-157.[Medline]

62. Sewell, A. K., Jensen, L. T., Erickson, J. C., Palmiter, R. D. & Winge, D. R. (1995) Bioactivity of metallothionein-3 correlates with its novel ß domain sequence rather than metal binding properties. Biochemistry 34:4740-4747.[Medline]

63. Hasler, D. W., Jensen, L. T., Zerbe, O., Winge, D. R. & Vasák, M. (2000) Effect of the two conserved prolines of human growth inhibitory factor (metallothionein-3) on its biological activity and structure fluctuation: comparison with a mutant protein. Biochemistry 39:14567-14575.[Medline]

64. Dutta, S. K., Procaccino, F. & Aamodt, R. (1998) Zinc metabolism in patients with exocrine pancreatic insufficiency. J. Am. Coll. Nutr. 17:556-563.[Abstract/Free Full Text]

65. Adamama-Moraitou, K., Rallis, T., Papasteriadis, A., Roubies, N. & Kaldrimidou, H. (2001) Iron, zinc, and copper concentration in serum, various organs, and hair of dogs with experimentally induced exocrine pancreatic insufficiency. Dig. Dis. Sci. 46:1444-1457.[Medline]

66. Oberleas, D. (1996) Mechanism of zinc homeostasis. J. Inorg. Biochem. 62:231-241.[Medline]

67. Walsh, C. T., Sandstead, H. H., Prasad, A. S., Newberne, P. M. & Fraker, P. J. (1994) Zinc: health effects and research priorities for the 1990s. Environ. Health Perspect. 102(suppl. 2):5-46.

68. Oestreicher, P. & Cousins, R. J. (1989) Zinc uptake by basolateral membrane vesicles from rat small intestine. J. Nutr. 119:639-646.

69. Hempe, J. M., Carlson, J. M. & Cousins, R. J. (1991) Intestinal metallothionein gene expression and zinc absorption. J. Nutr. 121:1389-1396.

70. Cousins, R. J. & McMahon, R. J. (2000) Integrative aspects of zinc transporters. J. Nutr. 130(suppl.):1384S-1387S.[Abstract/Free Full Text]

71. Krebs, N. F. (2000) Overview of zinc absorption and excretion in the human gastrointestinal tract. J. Nutr. 130:1374S-1377S.[Abstract/Free Full Text]

72. De, S. K., Enders, G. C. & Andrews, G. K. (1991) Metallothionein mRNA stability in chicken and mouse cells. Biochim. Biophys. Acta Gene Struct. Expression 1090:223-229.[Medline]

73. Klaassen, C. D., Choudhuri, S., McKim, J. M., Jr, Lehman-McKeeman, L. D. & Kershaw, W. C. (1994) In vitro and in vivo studies on the degradation of metallothionein. Environ. Health Perspect. 102(suppl. 3):141-146.

74. Kagi, J. H. & Schaffer, A. (1988) Biochemistry of metallothionein. Biochemistry 27:8509-8515.[Medline]




This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
J. A. Jamieson, J. N. Shuhyta, and C. G. Taylor
Lead Does Not Affect Transcription of Intestinal Zinc-Binding Proteins in Growing Rats
Experimental Biology and Medicine, June 1, 2007; 232(6): 744 - 753.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Dufner-Beattie, Z. L. Huang, J. Geiser, W. Xu, and G. K. Andrews
Generation and Characterization of Mice Lacking the Zinc Uptake Transporter ZIP3
Mol. Cell. Biol., July 1, 2005; 25(13): 5607 - 5615.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Dufner-Beattie, Y.-M. Kuo, J. Gitschier, and G. K. Andrews
The Adaptive Response to Dietary Zinc in Mice Involves the Differential Cellular Localization and Zinc Regulation of the Zinc Transporters ZIP4 and ZIP5
J. Biol. Chem., November 19, 2004; 279(47): 49082 - 49090.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Coll. Nutr.Home page
J. Kim, H. Y. Paik, H. Joung, L. R. Woodhouse, S. Li, and J. C. King
Zinc Supplementation Reduces Fractional Zinc Absorption in Young and Elderly Korean Women
J. Am. Coll. Nutr., August 1, 2004; 23(4): 309 - 315.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Dufner-Beattie, S. J. Langmade, F. Wang, D. Eide, and G. K. Andrews
Structure, Function, and Regulation of a Subfamily of Mouse Zinc Transporter Genes
J. Biol. Chem., December 12, 2003; 278(50): 50142 - 50150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D. K.
Right arrow Articles by Andrews, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D. K.
Right arrow Articles by Andrews, G. K.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2003 by American Society for Nutrition