![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Nutrition Department, The Pennsylvania State University, University Park, PA 16802
2To whom correspondence should be addressed. E-mail: yyy1{at}psu.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
KEY WORDS: • garlic • hepatocytes • HMG-CoA reductase • S-alk(en)yl cysteines
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
–6
), which may explain in part the hypocholesterolemic effect of garlic in humans and animals (7
–10
). Three water-soluble S-alk(en)yl cysteines, i.e., S-allyl-cysteine (SAC),3
S-ethyl cysteine (SEC) and S-propyl cysteine (SPC) were the most potent inhibitors of cholesterol synthesis, achieving 42–55% maximal inhibition in cultured hepatocytes (6
). However, the underlying mechanisms have not been fully elucidated. An in vitro study demonstrated that water-soluble garlic extracts reduced hepatocyte cholesterol synthesis when [14C] acetate but not [14C]mevalonate was used as a precursor, indicating a potential regulation of 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase (1
). In fact, animal studies have shown that garlic-supplemented diets decreased hepatic activity of HMG-CoA reductase (7
,11
). However, the regulatory mechanisms of HMG-CoA reductase activity by garlic compounds remain unclear.
The regulation of HMG-CoA reductase may occur at the transcriptional or post-transcriptional level (12
–14
). Post-transcriptional regulation could be at the levels of translation, protein degradation and catalytic efficiency, including phosphorylation and thiol redox status of the enzyme (15
,16
). In cultured Chinese hamster ovary (CHO) cells, sterols were shown to regulate the enzyme mainly at the level of transcription, whereas nonsterols exerted regulation at the post-transcriptional level including translation and protein degradation (13
). Studies with CHO and baby hamster kidney cells indicate that the N-terminal 8-transmembrane domain of the reductase is required for the degradation of the enzyme (17
, 18
). HMG-CoA reductase is inactivated by phosphorylation (13
). This reaction is catalyzed by a protein kinase family, AMP-activated protein kinases (19
), and the inactivated enzyme can be reactivated by phosphatase (20
). In addition, HMG-CoA reductase can be inactivated by sulfhydryl oxidation and reactivated by high concentrations of thiols such as dithioerythritol and dithiothreitol (DTT) (21
,22
).
This study was undertaken to determine the effects of S-alk(en)yl cysteines on cholesterol synthesis from [14C]mevalonate and the activity of HMG-CoA reductase, and to investigate the possible regulatory mechanisms of HMG-CoA reductase activity by these compounds in cultured rat hepatocytes. The mRNA and protein levels of HMG-CoA reductase were determined after treatment with various compounds. The possible involvement of phosphorylation and thiol redox status of the enzyme by the garlic compounds was explored as well. The results suggest that sulfur compounds of garlic inhibit cholesterol synthesis by depressing HMG-CoA reductase activity, likely resulting from enhanced phosphorylation of the enzyme.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Male Sprague-Dawley rats (200–300 g) were obtained from Harlan Sprague Dawley (Indianapolis, IN) and fed a nonpurified diet (Purina Rat Chow, Ralston Purina, St. Louis, MO). The animals were housed individually in stainless steel cages at 
24°C and 50% relative humidity on a 12-h light:dark cycle (1000–2200 h). The animal protocol was approved by The Pennsylvania State University Institutional Animal Care and Use Committee.
Hepatocyte isolation and culture.
Hepatocytes were isolated from rats according to the method of Berry and Friend (23
) as modified by Seglen (24
), and detailed previously (6
). From each liver, 100–250 x 106 cells were obtained with a viability of 92–94%, judging by trypan blue exclusion. The cells were resuspended in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics (1 x 105 U penicillin/L plus 100 mg streptomycin/L) to obtain 0.75 x 109 cells/L of suspension. Aliquots (2 mL) of cell suspension were plated in each well in a six-well culture plate (Becton Dickinson Labware, Franklin Lakes, NJ) for the measurement of [14C] mevalonate incorporation into cholesterol. Aliquots (4 mL) of the suspension were plated in each 60-mm diameter culture dish (Becton Dickinson Labware) to obtain a sufficient number of cells for determining the activity of HMG-CoA reductase and the levels of mRNA and protein of the enzyme. The plates or dishes were then incubated at 37°C under an atmosphere of 95% air/5% CO2. After 4 h of incubation, nonadhering cells were removed and discarded. Hepatocytes that adhered to the culture plates and dishes were refed with DMEM and incubated overnight for 16 h.
Determination of [14C]mevalonate incorporation into cholesterol.
At the end of the overnight incubation, cells cultured in the six-well plate were washed three times with 2 mL of FBS-free DMEM. The cells were then incubated with 2 mL FBS-free medium containing [2-14C] mevalonate (3.6 mmol/L, specific activity 2.44 MBq/mmol) in the absence or presence of SAC, SEC or SPC at a 50% inhibitory concentration (IC50) and 4 mmol/L. A linear rate of [14C]acetate incorporation into cholesterol was established during 4, 6 and 8 h of incubation in our previous study (6
). Thus, the rate of [14C] mevalonate incorporation into cholesterol in hepatocytes was measured at the end of 4 h of incubation. The cells were then harvested for extraction of cholesterol (6
). The radioactivity of [14C]-labeled cholesterol was determined by liquid scintillation counting (Beckman Model LS 3801, Beckman Instruments, Fullerton, CA). The specific activity of cholesterol synthesis was expressed as pmol mevalonate incorporated into cholesterol/(mg cellular protein · 4 h). The relative rate of cholesterol synthesis by cells treated with organosulfur compounds was expressed as a percentage of control (control was arbitrarily set as 100%) (6
).
Preparation of hepatocyte microsomes.
Cells cultured in the 60-mm culture dish were washed three times with 2 mL of FBS-free DMEM after the overnight incubation and treated with 4 mL FBS-free DMEM in the absence or presence of test compounds at IC50 and/or 4 mmol/L. After 4 h incubation, cells were washed twice with 2 mL ice-cold buffer A (50 mmol/L Tris-HCl and 150 mmol/L NaCl, pH 7.4). The dishes were placed on ice and 1 mL of buffer A was added immediately. The cells were then harvested by scraping. The content of each dish was rinsed with 1 mL buffer A and added to the suspension of scraped cells. The cell suspension was centrifuged at low speed (900 x g, 5 min at 4°C) and the resulting supernatant was discarded (25
). The cell pellet was dissolved in 1 mL buffer B (50 mmol/L Tris-HCl, 0.3 mol/L sucrose, 50 mmol/L NaCl, 10 mmol/L EDTA and 10 mmol/L DTT, pH 7.4) and sonicated using a sonifier (Branson Model 250, Branson Ultrasonics Corporation, Danbury, CT). The sample was then centrifuged at 12,000 x g for 15 min at 4°C. The pellet was discarded and the supernatant was recentrifuged at 110,000 x g for 1.5 h at 4°C. The resulting microsomal pellet was suspended in 100 µL buffer C (20 mmol/L imidazol-HCl and 10 mmol/L DTT) and aliquots were immediately used for determination of HMG-CoA reductase activity (26
–28
).
HMG-CoA reductase activity.
HMG-CoA reductase activity was measured by radiochemical assay using TLC as described by Goldstein et al. (25
). Aliquots of microsomes (20–100 µg of protein in 50 µL buffer C) were mixed with 100 µL of buffer D (200 mmol/L potassium phosphate, 12 mmol/L DTT and 4 mmol/L NADPH, pH 7.4) and 40 µL of water. [14C]HMG-CoA (10 µL; 0.62 mmol/L, specific activity 336 MBq/mmol) used as the substrate was added to initiate the reaction. The reaction mixture was incubated for 60 min at 37°C and terminated by the addition of 20 µL of 5 mol/L HCl. After the addition of [5-3H]mevalonolactone as an internal standard, the mixture was incubated for another 30 min at 37°C to lactonize [14C]mevalonate product to [14C] mevalonolactone. Mevalonolactone was isolated by TLC (25
), and the radioactivity of [14C] mevalonolactone and [3H]mevalonolactone was counted by a liquid scintillation counter. The percentage of added [3H] mevalonolactone recovered during the assay was used for correction of [14C]mevalonolactone formed. The activity of HMG-CoA reductase was expressed as picomoles [14C]mevalonate formed per milligram of microsomal protein per minute [pmol/(mg protein · min)]. For determination of the expressed activity of HMG-CoA reductase, the microsomes were prepared in a buffer similar to buffer B except NaCl was replaced by NaF, and assayed as above. For determination of the total activity of HMG-CoA reductase, microsomes were prepared in buffer B and the activity was measured as above except that microsomes were preincubated for 60 min in the presence of 10 U of phosphatase (26
,29
).
Real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR).
For measurement of mRNA abundance, cells in the dish were treated with test compounds at 4.0 mmol/L in 4 mL FBS-free DMEM after the overnight incubation. Because the rate of cholesterol synthesis from [14C]labeled substrates and the activity of HMG-CoA reductase were determined in 4 h, cells were harvested 4 h after the treatment with S-alk(en)yl cysteines for extraction of total RNA using RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. HMG-CoA reductase mRNA was quantified by real-time RT-PCR with a Perkin-Elmer/Applied Biosystems Division (PE/ABD) Prism 7700 sequence detection system [Foster City, CA (30
)]. RT-PCR reaction was performed with the AmpliTaq Gold polymerase (PE/ABD, Foster City, CA) with 20 ng total RNA for each reaction. For quantifying a particular mRNA with real-time RT-PCR, a fluorogenic probe and two primers were designed and synthesized. The internal oligonucleotide probe was labeled with a fluorescent dye, carboxyfluorescein-aminohexyl amidite (FAM), at the 5' end and black hole quencher (BHQ) dye at the 3' end (Biosearch Technologies, Novato, CA). When both dyes were present in the intact probe, BHQ acted as a quencher for FAM by absorbing at the FAM emission spectra. When the internally hybridized probe was degraded by the 5' exonuclease activity of Taq polymerase during the course of PCR, these two dyes were separated in solution, resulting in a subsequent increase in the level of fluorescence in the reaction mixture. Thus, the amount of fluorescence released during each amplification cycle was proportional to the amount of specific PCR products generated in that cycle. The 18S RNA was amplified at the same time and used as an internal control. The threshold cycle (Ct) values for 18S RNA and samples were calculated by PE/ABD computer software. Ct was determined at the most exponential phase of the reaction. Relative transcript levels were calculated as x = 2-
Ct, in which Ct = E - C, and E = Ctexperiment - Ct18S, C = Ctcontrol - Ct18s.
The primers and probe of HMG-CoA reductase were designed according to GenBank Accession Number X55286 using PE/ABD Primer Express software, which is specifically designed for the selection of primers and probes. The forward and reverse primers for rat HMG-CoA reductase mRNA were 5'-ACCGTGGGTGGTGGGAC-3' (17 nucleotides) and 5'-GCCCCTTGAACACCTAGCATC-3' (21 nucleotides), respectively. The fluorogenic internal probe was 5'-(FAM)ACCTTCTACCTCAGCAAGCCTGCCTGC(BHQ)-3' (27 nucleotides).
Cell lysate preparation for immunoblot analysis.
Hepatocytes cultured in the dish were treated as described for RT-PCR. Four hours after the treatment with the test compounds, the medium was removed and cells were washed twice with 2 mL ice-cold PBS buffer. The dishes were placed on ice and 1 mL of buffer A was added immediately. Cells were harvested by scraping. The content of each dish was rinsed with 0.5 mL buffer A and added to the suspension of scraped cells. The cell pellet was prepared as described earlier in the microsome preparation (25
). After centrifugation, the cell pellet was then dissolved in 80 µL lysis buffer and incubated on ice for 60 min. The lysis buffer consisted of 1% Nonidet P-40, 0.1% SDS, 1 mmol/L Na3VO4 and protease inhibitor cocktail prepared according to the manufacturer’s instructions (Roche Molecular Biochemical, Indianapolis, IN) in PBS. The cell lysate was centrifuged at 10,000 x g for 20 min at 4°C, and the supernatant was taken as the total cell lysate. The protein concentration of cell lysate was determined by the procedure of Lowry et al. (31
).
Immunoblot analysis.
Polyclonal antisera to a proteolytic fragment containing the catalytic domain of rat HMG-CoA reductase were generated in rabbits (32
) and were a generous gift from Dr. G. C. Ness (University of South Florida). The reductase antisera recognize a 100-kDa band as the dominant species (33
). However, if the reductase was degraded by proteolysis, other bands might appear at 70 kDa or less (32
). For immunoblot analysis, 20 µL sample buffer (30 mmol/L Tris-HCl, 1% SDS, 0.1 mol/L sucrose, 8 mol/L urea, 5% ß-mercaptoethanol and 0.005% bromophenol blue, pH 6.8) was added to 50 µg of cell lysate protein. The sample was then boiled for 5 min and subjected to gel electrophoresis on a 7.5% SDS-polyacrylamide gel (33
). The separated protein was transferred electrophoretically to PVDF-plus membrane purchased from Micron Separations, (Westboro, MA). The membranes were blocked with 5% Carnation nonfat dry milk. They were then incubated at room temperature for 2 h with a 1:5000 dilution of HMG-CoA reductase antisera. Immunoreactive protein was detected using the enhanced chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Piscataway, NJ). The relative level of HMG-CoA reductase immunoreactive protein was determined using a phosphoimager (15
,33
).
Materials.
Culture media, FBS, penicillin and streptomycin were purchased from Life Technologies (Rockville, MD). Collagenase D was obtained from Boehringer Mannheim (Indianapolis, IN). Alkaline phosphatase was purchased from Worthington Biochemical Corporation (Lakewood, NJ). Three water-soluble S-alk(en)yl cysteines of garlic, i.e., SAC, SEC and SPC, were provided by Wakunaga of America (Mission Viejo, CA). [2-14C]mevalonate, dibenzylethylendiamine salt and [3-14C]HMG-CoA were obtained from Amersham Pharmacia Biotech (Piscataway, NJ). [5-3H] mevalonolactone was purchased from American Radiolabeled Chemicals (St. Louis, MO). All other chemicals of reagent grade were purchased from Sigma Chemical (St. Louis, MO).
Statistics.
Data are presented as means ± SEM for 4–10 samples as specified in the legends to the table and figures. The comparisons of the test compounds were analyzed by ANOVA with the general linear model. When statistical significance was indicated by ANOVA, Dunnett’s or Fisher’s tests were applied to identify significant differences between the treatments and the control or among all groups, respectively, P < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). Therefore, in the present study, the incorporation of [14C] mevalonate into cholesterol was measured in cultured hepatocytes to determine the regulation of cholesterol synthesis by S-alk(en)yl cysteines. The rate of [14C]mevalonate incorporation into cholesterol was 1878 ± 54 pmol/(mg protein · 4 h) for control and ranged from 1801 to 1944 pmol/(mg protein · 4 h) among the treated cells. When compared with a relative rate set arbitrarily at 100% for control, none of the S-alk(en)yl cysteines (SAC, SEC and SPC) affected the incorporation of [14C]mevalonate into cholesterol (Table 1
). The activity of HMG-CoA reductase was then determined in the cultured cells treated with S-alk(en)yl cysteines at the IC50 concentrations and 4 mmol/L. The IC50 concentrations for SAC, SEC and SPC were 0.61, 0.58, and 0.72 mmol/L, respectively, as determined previously (6
). The activity of HMG-CoA reductase was decreased 35, 27 and 33% by SAC, SEC and SPC at the IC50 concentrations, respectively (Table 1)
. The activity of HMG-CoA reductase was depressed 30–41% at 4.0 mmol/L by the S-alk(en)yl cysteines (Table 1)
.
|
shows the results of immunoblot analysis of HMG-CoA reductase. Molecular weight markers (118, 85, and 62 kDa) are indicated on the left. The upper band between 85 and 118 kDa represents HMG-CoA reductase, and the number above each band is the percentage of density relative to the total density of eight lanes. The lower band at 70 kDa is the degraded product of the enzyme (32
). As shown, the amount of HMG-CoA reductase protein was unchanged by treatment with SAC, SEC and SPC. (Fig. 1)
. S-Alk(en)yl cysteines had no effect on the abundance of HMG-CoA reductase mRNA or the amount of the enzyme.
|
). The ratio of E/T was 18–29% lower in cells treated with the three S-alk(en)yl cysteines than in untreated cells (Fig. 2
). The ratio of E/T for SPC was lower than that for SAC and SEC groups and there was no difference between SAC and SEC (Fig. 2)
. The decreased E/T ratios resulted primarily from decreased expressed activity because total activity was not different [91 to 94 pmol/(mg protein · min)] among the treated and control cells.
|
). However, there was no further increase of the enzyme activity from 12 to 16 mmol/L DTT (Fig. 3
A). The activity was also stimulated by increasing phosphatase from 5 to 10 U, and there were no differences in the activities at concentrations of 10, 15 and 20 U (Fig. 3
B). Consequently, as described in Materials and Methods, the activity of HMG-CoA reductase was routinely measured at 12 mmol/L DTT, whereas the total activity of the enzyme was determined in the presence of 12 mmol/L DTT using microsomes preincubated with 10 U phosphatase. When the reductase activity was measured with 12 mmol/L DTT, SAC inhibited the activity by 30% (Figure 4
). Such an inhibition by SAC was not apparent when the activity was assayed in the presence of 12 mmol/L DTT and 10 U phosphatase, perhaps because the enzyme was in a highly dephosphorylated and reduced state. We therefore measured the reductase activity under less reduced assay conditions using 8 mmol/L DTT and 10 U phosphatse. The reductase activity of the SAC-treated cells was 10% lower than that of control cells (Fig. 4)
. SEC and SPC had no effect on the activity measured in the presence of 12 mmol/L plus 10 U phosphatase or 8 mmol/L plus 10 U phosphatase (data not shown).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). The present study, however, showed that the rate of [14C]mevalonate incorporation into cholesterol remained the same whether cells were or were not treated with S-alk(en)yl cysteines. These results suggest that the sulfur compounds regulate cholesterol synthesis at the point of HMG-CoA reductase. Consistent with this, the activity of HMG-CoA reductase was depressed 41% by SAC, 37% by SPC and 30% by SEC. The reduction of the enzyme activity was consistent with findings in other in vitro and animal feeding studies (1
, 7
,11
).
However, the mechanisms by which S-alk(en)yl cysteines decrease the activity of HMG-CoA reductase are not clear. HMG-CoA reductase may be regulated at the level of gene expression including transcription of the gene and translation of mRNA (13
,16
) or by an activation/deactivation mechanism involving dephosphorylation and phosphorylation, and interchange of thiol-disulfide (15
,35
). The induction and repression of the mRNA for HMG-CoA reductase was observed in CHO cells that were cultured in the presence or absence of sterols (13
). The levels of mRNA and/or protein of hepatic HMG-CoA reductase were also changed by nutritional status and hormones such as insulin and glucagon (15
,36
–38
). On the contrary, the S-alk(en)yl cysteines tested in the present study did not alter the abundance of mRNA encoding for HMG-CoA reductase, nor did these compounds change the protein concentration of HMG-CoA reductase.
HMG-CoA reductase activity is modulated by phosphorylation and dephosphorylation (39
,40
). It has been shown that hepatic HMG-CoA reductase was deactivated in vitro when microsomal enzyme was incubated with cytosol in the presence of ATP and Mg2+ (41
). On the other hand, reactivation of the deactivated reductase obtained from rat liver has been demonstrated, but such reactivation was prevented by sodium fluoride (NaF), an inhibitor of phosphatases, suggesting dephosphorylation as a mechanism for reactivating the phosphorylated enzyme (40
). In fact, Gibson and Ingebritsen and their associates (20
,39
) found that the inactivated reductase could be reactivated by a partially purified hepatic phosphoprotein phosphatase. The phosphorylation/dephosphorylation state of HMG-CoA reductase may be estimated by determining the ratio of expressed (E) to total (T) activity of the enzyme. A strong linear relationship between the E/T ratio and the fraction of dephosphorylated enzyme established by Parker et al. (34
) suggests that the E/T ratio is a valid index of the HMG-CoA reductase phosphorylation state. In other words, the E/T ratio is an accurate representation of the percentage of microsomal reductase in the dephosphorylated state (34
,42
); the higher the ratio, the more the enzyme is dephosphorylated. Therefore, the E/T ratio was used as an index of the HMG-CoA reductase phosphorylation state in this study. The E/T ratios were reduced 29, 21 and 18% by SPC, SAC and SEC, respectively. This finding, together with unaltered mRNA abundance and immuoreactive protein concentration, suggests that S-alk(en)yl cysteines regulate the activity of HMG-CoA reductase at the post-translational level by increasing phosphorylation of the enzyme. This speculation coincides with an earlier report of Sato et al. (43
) that confirmed phosphorylation as a mechanism for deactivating HMG-CoA reductase activity. However, in contrast to this mode of regulation by S-alk(en)yl cysteines, cholesterol feeding depressed HMG-CoA reductase activity by reducing enzyme protein synthesis, indicating regulation at the translational level (15
). Similarly, a decrease in HMG-CoA reductase activity of insulin-insufficient diabetic rats was associated with decreased synthesis of the enzyme and mRNA abundance (37
). Therefore, available data suggest that HMG-CoA reductase may be regulated at the transcriptional, translational or post-translational level depending on nutritional and physiologic conditions. Finally, it should be stressed that although E/T ratios closely and accurately reflect the phosphorylation state of HMG-CoA reductase (34
,42
), further studies are necessary to determine the amount of the enzyme that is phosphorylated and dephosphorylated by S-alk(en)yl cysteines.
Thiol-disulfide interchange plays an essential role in modulating the activity of HMG-CoA reductase (16
,44
). The susceptibility of HMG-CoA reductase to inactivation by sulfhydryl oxidation has been well documented (21
,22
,45
,46
). The oxidative inactivation is reversible in the presence of high concentrations of thiols such as dithioerythritol, DTT and glutathione (21
, 22
). Because the total activity of the reductase was not altered by S-alk(en)yl cysteines in the presence of a saturating level of DTT (i.e., 12 mmol/L), we used a lower DTT concentration (8 mmol/L) and a maximal concentration of phosphatase (i.e., 10 U/L) to test the possible effects on thiol redox status of HMG-CoA reductase by S-alk(en)yl cysteines. Under the assay conditions, phosphorylation of the enzyme was diminished by phosphatase; hence, any effect on the enzyme was taken as a measure of change in the thiol redox state. SAC indeed reduced the activity of the reductase slightly (10%) but significantly. This finding was consistent with an early study demonstrating that diallyl disulfide derived from garlic deactivated HMG-CoA reductase (47
). The deactivation was attributed to the formation of intramolecular disulfides within the enzyme, indicating an increased sulfhydryl oxidation of HMG-CoA reductase by diallyl disulfide (47
). Therefore, SAC may have depressed that activity of the reductase by increasing sulfhydryl oxidation.
In summary, SAC, SEC and SPC inhibit hepatic cholesterol biosynthesis primarily by decreasing HMG-CoA reductase activity. The decreased activity of HMG-CoA reductase by S-alk(en)yl cysteines, on the other hand, may be attributed to increased phosphorylation but not alteration in mRNA or the amount of the enzyme. Among S-alk(en)yl cysteines, SAC appears to be the most potent inhibitor of HMG-CoA reductase because it not only increases phosphorylation but also enhances sulfhydryl oxidation of the enzyme.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
3 Abbreviations used: BHQ, black hole quencher; CHO, Chinese hamster ovary; DMEM, Dulbecco’s modified Eagle’s medium; DTT, dithiothreitol; E/T ratio, the ratio of expressed to total activity of HMG-CoA reductase; FAM, carboxyfluorescein-aminohexyl amidite; FBS, fetal bovine serum; HMG-CoA, 3-hydroxy-3-methylglutaryl CoA; IC50, concentration required for 50% of maximal inhibition; RT-PCR, reverse transcriptase-polymerase chain reaction; SAC, S-allyl cysteine; SEC, S-ethyl cysteine; SPC, S-propyl cysteine.
Manuscript received 29 October 2001. Initial review completed 2 January 2002. Revision accepted 6 March 2002.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
1. Gebhardt, R. (1991) Inhibition of cholesterol biosynthesis by a water-soluble garlic extract in primary cultures of rat hepatocytes. Arzneimittelforschung 41:800-804.[Medline]
2. Gebhardt, R. (1993) Multiple inhibitory effects of garlic extracts on cholesterol biosynthesis in hepatocytes. Lipids 28:613-619.[Medline]
3. Gebhardt, R., Beck, H. & Wagner, K. G. (1994) Inhibition of cholesterol biosynthesis by allicin and ajoene in rat hepatocytes and HepG2 cells. Biochim. Biophys. Acta 1213:57-62.[Medline]
4. Gebhardt, R. & Beck, H. (1996) Differential inhibitory effects of garlic-derived organosulfur compounds on cholesterol biosynthesis in primary rat hepatocyte cultures. Lipids 31:1269-1276.[Medline]
5. Yeh, Y.-Y. & Yeh, S.-M. (1994) Garlic reduces plasma lipids by inhibiting hepatic cholesterol and triacylglycerol synthesis. Lipids 29:189-193.[Medline]
6. Liu, L. & Yeh, Y.-Y. (2000) Inhibition of cholesterol biosynthesis by organosulfur compounds derived from garlic. Lipids 35:197-203.[Medline]
7. Qureshi, A. A., Din, Z. Z., Abuirmeileh, N., Burger, W. C., Ahmad, Y. & Elson, C. E. (1983) Suppression of avian hepatic lipid metabolism by solvent extracts of garlic: impact on serum lipids. J. Nutr. 113:1746-1755.
8. Mader, F. H. (1990) Treatment of hyperlipidaemia with garlic-powder tablets. Evidence from the German Association of General Practitioners’ multicentric placebo-controlled double-blind study. Arzneimittelforschung 40:1111-1116.
9.
Steiner, M., Khan, A. H., Holbert, D. & Lin, R. I. (1996) A double-blind crossover study in moderately hypercholesterolemic men that compared the effect of aged garlic extract and placebo administration on blood lipids. Am. J. Clin. Nutr. 64:866-870.
10. Yeh, Y.-Y., Lin, R. I., Yeh, S.-M. & Evens, S. (1997) Garlic reduces plasma cholesterol in hypercholesterolemic men maintaining habitual diets. Ohigashi, H. Osawa, T. Terao, J. Watanabe, S. Toshikawa, T. eds. Food Factors for Cancer Prevention 1997:226-230 Springer Tokyo, Japan. .
11. Qureshi, A. A., Crenshaw, T. D., Abuirmeileh, N., Peterson, D. M. & Elson, C. E. (1987) Influence of minor plant constituents on porcine hepatic lipid metabolism. Impact on serum lipids. Atherosclerosis 64:109-115.[Medline]
12. Anderson, J. A., Leonard, D. A., Cusack, K. P. & Frye, L. L. (1995) 15-Substituted lanosterols: post-transcriptional suppressors of 3-hydroxy-3-methylglutaryl coenzyme A reductase. Arch. Biochem. Biophys. 316:190-196.[Medline]
13. Goldstein, J. L. & Brown, M. S. (1990) Regulation of the mevalonate pathway. Nature (Lond.) 343:425-430.[Medline]
14.
Parker, R. A., Pearce, B. C., Clark, R. W., Gordon, D. A. & Wright, J. J. (1993) Tocotrienols regulate cholesterol production in mammalian cells by post-transcriptional suppression of 3-hydroxy-3-methylglutaryl-coenzyme A reductase. J. Biol. Chem. 268:11230-11238.
15. Chambers, C. M. & Ness, G. C. (1998) Dietary cholesterol regulates hepatic 3-hydroxy-3-methylglutaryl coenzyme A reductase gene expression in rats primarily at the level of translation. Arch. Biochem. Biophys. 354:317-322.[Medline]
16.
Ness, G. C. & Chambers, C. M. (2000) Feedback and hormonal regulation of hepatic 3-hydroxy-3-methylglutaryl coenzyme A reductase: the concept of cholesterol buffering capacity. Proc. Soc. Exp. Biol. Med. 224:8-19.
17.
Kumagai, H., Chun, K. T. & Simoni, R. D. (1995) Molecular dissection of the role of the membrane domain in the regulated degradation of 3-hydroxy-3-methylglutaryl coenzyme A reductase. J. Biol. Chem. 270:19107-19113.
18.
Moriyama, T., Sather, S. K., McGee, T. P. & Simoni, R. D. (1998) Degradation of HMG-CoA reductase in vitro. Cleavage in the membrane domain by a membrane-bound cysteine protease. J. Biol. Chem. 273:22037-22043.
19.
Mitchelhill, K. I., Stapleton, D., Gao, G., House, C., Michell, B., Katsis, F., Witters, L. A. & Kemp, B. E. (1994) Mammalian AMP-activated protein kinase shares structural and functional homology with the catalytic domain of yeast SNF1 protein kinase. J. Biol. Chem. 269:2361-2364.
20. Gibson, D. M. & Ingebritsen, T. S. (1978) Reversible modulation of liver hydroxymethylglutaryl CoA reductase. Life Sci 23:2649-2664.[Medline]
21. Dotan, I. & Shechter, I. (1982) Thiol-disulfide-dependent interconversion of active and latent forms of rat hepatic 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Biochim. Biophys. Acta 713:427-434.[Medline]
22. Dotan, I. & Shechter, I. (1983) Properties of latent and thiol-activated rat hepatic 3-hydroxy-3-methylglutaryl-coenzyme A reductase and regulation of enzyme activity. Arch. Biochem. Biophys. 226:401-410.[Medline]
23.
Berry, M. N. & Friend, D. S. (1969) High-yield preparation of isolated rat liver parenchymal cells: a biochemical and fine structural study. J. Cell Biol. 43:506-520.
24. Seglen, P. O. (1973) Preparation of rat liver cells. 3. Enzymatic requirements for tissue dispersion. Exp. Cell Res. 82:391-398.[Medline]
25. Goldstein, J. L., Basu, S. K. & Brown, M. S. (1983) Receptor-mediated endocytosis of low-density lipoprotein in cultured cells. Methods Enzymol 98:241-260.[Medline]
26.
Brown, M. S., Goldstein, J. L. & Dietschy, J. M. (1979) Active and inactive forms of 3-hydroxy-3-methylglutaryl coenzyme A reductase in the liver of the rat. Comparison with the rate of cholesterol synthesis in different physiological states. J. Biol. Chem. 254:5144-5149.
27.
Doerner, K. C., Gurley, E. C., Vlahcevic, Z. R. & Hylemon, P. B. (1995) Regulation of cholesterol 7 
-hydroxylase expression by sterols in primary rat hepatocyte cultures. J. Lipid Res. 36:1168-1177.[Abstract]
28. Skorve, J., al-Shurbaji, A., Asiedu, D., Bjorkhem, I., Berglund, L. & Berge, R. K. (1993) On the mechanism of the hypolipidemic effect of sulfur-substituted hexadecanedioic acid (3-thiadicarboxylic acid) in normolipidemic rats. J. Lipid Res. 34:1177-1185.[Abstract]
29. Alonso, M. A., Fernandez de Quincoces, A., Lacort, M., Gandarias, J. M. & Ochoa, B. (1993) Feeding status-related effects of 17 ß-estradiol on liver 3-hydroxy-3-methylglutaryl CoA reductase. Exp. Clin. Endocrinol. 101:123-130.[Medline]
30. Grove, D. S. (1999) Quantitative real-time polymerase chain reaction for the core facility using TaqMan and the Perkin-Elmer/Applied Biosystems Division 7700 sequence detector. J. Biomol. Technol. 10:11-16.
31.
Lowry, O. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275.
32. Ness, G. C., Sample, C. E., Smith, M., Pendleton, L. C. & Eichler, D. C. (1986) Characteristics of rat liver microsomal 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Biochem. J. 233:167-172.[Medline]
33. Ness, G. C., Lopez, D., Chambers, C. M., Zhao, Z., Beach, D. L., Ko, S. S. & Trzaskos, J. M. (1998) Effects of 15-oxa-32-vinyl-lanost-8-ene-3ß,32 diol on the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase and low density lipoprotein receptor in rat liver. Arch. Biochem. Biophys. 357:259-264.[Medline]
34.
Parker, R. A., Miller, S. J. & Gibson, D. M. (1989) Phosphorylation of native 97-kDa 3-hydroxy-3-methylglutaryl-coenzyme A reductase from rat liver. Impact on activity and degradation of the enzyme. J. Biol. Chem. 264:4877-4887.
35. Davis, R. A., Sinensky, M. & Junker, L. H. (1989) Regulation of cholesterol synthesis and the potential for its pharmacologic manipulation. Pharmacol. Ther. 43:221-236.[Medline]
36.
Gil, G., Goldstein, J. L., Slaughter, C. A. & Brown, M. S. (1986) Cytoplasmic 3-hydroxy-3-methylglutaryl coenzyme A synthase from the hamster. I. Isolation and sequencing of a full-length cDNA. J. Biol. Chem. 261:3710-3716.
37.
Ness, G. C., Zhao, Z. & Wiggins, L. (1994) Insulin and glucagon modulate hepatic 3-hydroxy-3-methylglutaryl-coenzyme A reductase activity by affecting immunoreactive protein levels. J. Biol. Chem. 269:29168-29172.
38. Sample, C. E., Pendleton, L. C. & Ness, G. C. (1987) Regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase mRNA levels by L-triiodothyronine. Biochemistry 26:727-731.[Medline]
39. Ingebritsen, T. S., Lee, H. S., Parker, R. A. & Gibson, D. M. (1978) Reversible modulation of the activities of both liver microsomal hydroxymethylglutaryl coenzyme A reductase and its inactivating enzyme. Evidence for regulation by phosphorylation-dephosphorylation. Biochem. Biophys. Res. Commun. 81:1268-1277.[Medline]
40.
Nordstrom, J. L., Rodwell, V. W. & Mitschelen, J. J. (1977) Interconversion of active and inactive forms of rat liver hydroxymethylglutaryl-CoA reductase. J. Biol. Chem. 252:8924-8934.
41. Beg, Z. H., Allmann, D. W. & Gibson, D. M. (1973) Modulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity with cAMP and with protein fractions of rat liver cytosol. Biochem. Biophys. Res. Commun. 54:1362-1369.[Medline]
42.
Beg, Z. H., Stonik, J. A. & Brewer, H. B., Jr (1987) Phosphorylation and modulation of the enzymic activity of native and protease-cleaved purified hepatic 3-hydroxy-3-methylglutaryl-coenzyme A reductase by a calcium/calmodulin-dependent protein kinase. J. Biol. Chem. 262:13228-13240.
43.
Sato, R., Goldstein, J. L. & Brown, M. S. (1993) Replacement of serine-871 of hamster 3-hydroxy-3-methylglutaryl-CoA reductase prevents phosphorylation by AMP-activated kinase and blocks inhibition of sterol synthesis induced by ATP depletion. Proc. Natl. Acad. Sci. U.S.A. 90:9261-9265.
44.
Ness, G. C., McCreery, M. J., Sample, C. E., Smith, M. & Pendleton, L. C. (1985) Sulfhydryl/disulfide forms of rat liver 3-hydroxy-3-methylglutaryl coenzyme A reductase. J. Biol. Chem. 260:16395-16399.
45.
Cappel, R. E. & Gilbert, H. F. (1988) Thiol/disulfide exchange between 3-hydroxy-3-methylglutaryl-CoA reductase and glutathione. A thermodynamically facile dithiol oxidation. J. Biol. Chem. 263:12204-12212.
46.
Cappel, R. E. & Gilbert, H. F. (1993) Oxidative inactivation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase and subunit cross-linking involve different dithiol/disulfide centers. J. Biol. Chem. 268:342-348.
47. Omkumar, R. V., Kadam, S. M., Banerji, A. & Ramasarma, T. (1993) On the involvement of intramolecular protein disulfide in the irreversible inactivation of 3-hydroxy-3-methylglutaryl-CoA reductase by diallyl disulfide. Biochim. Biophys. Acta 1164:108-112.[Medline]
This article has been cited by other articles:
|
|
 |
|
  D. K. Singh and T. D. Porter Inhibition of Sterol 4{alpha}-Methyl Oxidase Is the Principal Mechanism by Which Garlic Decreases Cholesterol Synthesis J. Nutr., March 1, 2006; 136(3): 759S - 764S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Borek Garlic Reduces Dementia and Heart-Disease Risk J. Nutr., March 1, 2006; 136(3): 810S - 812S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Mullen, R. M. Brown, T. F. Osborne, and N. F. Shay Soy Isoflavones Affect Sterol Regulatory Element Binding Proteins (SREBPs) and SREBP-Regulated Genes in HepG2 Cells J. Nutr., November 1, 2004; 134(11): 2942 - 2947. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
