![]() |
|
|
Department of Physiology, The University of Western Australia, Nedlands 6907, Western Australia
2To whom correspondence should be addressed. E-mail: poates{at}cyllene.uwa.edu.au.
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: iron uptake efflux DMT1 IREG1 hephaestin
| INTRODUCTION |
|---|
|
|
|---|
DMT1 is expressed on the apical membrane of the enterocyte; in the presence of a proton gradient provided by gastric secretions, it cotransports ferrous iron [Fe(II)] from the membrane into the cell (3
,9
,10
). Supporting evidence for the role of DMT1 in the uptake of iron is found in homozygous microcytic anemic mice and Belgrade rats in which uptake of iron from the lumen of the intestine is greatly impaired due to a G185R mutation in DMT1 (4
,11
13
).
The recent cloning and characterization of IREG1/ferroportin/MTP1 suggests that it is the efflux carrier of the enterocyte as shown in expression systems in which IREG1 exported iron in the presence of ceruloplasmin (Cp) (5
7
). However, the efflux of iron from the enterocyte probably requires the Cp homologue hephaestin (8
) because its mutation as seen in sex-linked anemic mice impairs iron release (14
).
Understanding how these proteins coordinate iron absorption is assisted by studies using cell lines of human origin (15
,16
). However, it would be advantageous to have a cell line derived from the same species used in studies of whole animals, such as the rat, so that additional mechanistic questions can be studied in conjunction with those obtained in vivo and in turn compared with those found in humans. These cells must be of intestinal origin, express the above genes, have functional uptake and efflux transporters, and be able to be transfected for the further study of genes of interest. In view of this we evaluated the nontransformed rat small intestinal epithelial cell line IEC-6 as a model for the study of nonheme iron absorption. This involved comparing the expression and cellular localization of DMT1 and IREG1 in IEC-6 cells and rat duodenum. Also, the existence of uptake and efflux iron transport processes along with changes in the expression of the above genes with variations in iron loading was investigated in IEC-6 cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
IEC-6 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD) and routinely maintained in the presence of Dulbeccos modified Eagles medium (DMEM) containing 5% fetal calf serum (FCS), 100 U insulin, 50 mg/L penicillin, 50 mg/L streptomycin and 2.5 mg/L fungizone (Invitrogen, Groningen, The Netherlands). Cells were grown at 37°C in a humidified atmosphere of 5%CO2/95% air and viability was monitored using phase contrast microscopy and trypan blue staining. All experiments were done on cells between passages 17 and 30.
Variations in iron loading were performed as described below (see ferrous uptake). Total cellular iron concentration was measured by atomic absorbance spectrometry. This involved washing the cells with PBS and removing them from a 25 cm2 culture flask. The cells were centrifuged (700 x g for 5 min) and resuspended in 2.8 mol/L nitric acid and left at 90°C for 60 min. The solution was centrifuged (1200 x g for 5 min) to remove denatured protein and appropriately diluted supernatant measured for Fe concentration using an atomic absorption spectrometer (Varian, Victoria, Australia).
The results presented in this study have been normalized to the protein content of the cells. The protein content of IEC-6 cells was determined using the BCA protein assay kit (Pierce, Rockford, IL).
Animals.
The use of animals in this study has been approved by the Animal Welfare Committee of the University of Western Australia. Outbred male Wistar rats (6 wk old) were obtained from the Animal Resources Center (Animal Resource Centre, Murdoch, Western Australia). Rats were fed a semipurified diet either normal or low in iron; the composition of the diet was reported previously (17
). Iron was added in the form of ferrous ammonium sulfate to the control diet to a concentration of 70 mg/kg. The iron-deficient diet, with no added iron, contained 510 mg/kg. These diets were consumed ad libitum for 14 wk. At the time of killing, the rats were injected intraperitioneally with 0.5 mL of 60 g/L Nembutal. After deep anesthesia was achieved, a midline incision was made to expose the thorax and the heart was cut. The duodenum was removed and either used for protein expression (see Western blot analysis below) or frozen in liquid nitrogencooled isopentane and stored at -80°C (see confocal microscopy below).
Isolation of duodenal villous mucosa.
Duodenal mucosa representing the mid-villous region was obtained by applying a light scrape with a glass slide to remove superficial cells followed by a deeper scrape to remove the villous region from the proximal 3 cm of the duodenum from rats fed the iron-deficient and control diets. A deeper scrape was also performed on the duodenum of a control rat to obtain crypt cells. The tissue was immediately lysed in lysis buffer consisting of 25 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl plus 0.5% Triton X-100 and the protease inhibitors phenylmethylsulfonyl fluoride, leuptin and trasyol.
Glycosylation of DMT1 in vivo.
To determine whether DMT1 was glycosylated in vivo, 150 µg of the total duodenal mucosal protein was precipitated with trichloroacetic acid, washed, solubized in buffer containing 5 U N-glycosidase F (Hoffman-La Roche, Basel, Switzerland.) and incubated overnight. Digested and undigested proteins were then subjected to Western blot analysis.
Uptake of ferrous iron by IEC-6 cells.
IEC-6 cells were seeded in 12-well plates at 7.5 x 104 cells/well 3 or 10 d before the experiment, resulting in the cells being in the exponential or stationary growth phase, respectively, at the time of study. To study the uptake of Fe(II), a solution containing 1 µmol/L iron (concentration determined from preliminary studies that saturated the uptake transport process) as 59FeCl3 and 56FeSO4 in a 1:10 molar ratio, with a 100-fold molar excess of sodium ascorbate, was added to an isotonic solution of minimum essential medium (MEM) containing 20 mmol/L HEPES-Tris (pH 5.0, 5.5 and 7.4) and 10 g/L bovine serum albumin. Cells were washed 3 times in buffered salt solution (BSS) to remove culture media and were incubated for 01 h in the 1 µmol/L Fe solution at 37°C in an atmosphere of 5%CO2/95% air. Cells were washed 5 times in BSS and lysed in 0.1mol/L NaOH, 1% Triton-X100 and the radioactivity counted in a gamma counter (Packard, Meriden, CT).
Uptake of ferrous iron under different iron loading and pH conditions.
IEC-6 cells were seeded in 12-well plates at 7.5 x 104 cells/well 3 d before the experiment; thus, the cells were in the exponential growth phase at the time of study. One day before the experiment cells were made iron deficient or loaded by the addition of 0.5 mmol/L deferoximine (Sigma, NSW, Australia) or 5 g/L Fe in the form of ferric ammonium chloride to the cells, respectively. Cells used as the control were incubated in identical media that contained no supplemented iron except that provided by the manufacturer (0.2 µmol/L iron). The uptake of Fe(II) was performed as described above.
Ferrous iron release studies.
To study the release of iron, the cells in the stationary and exponential growth phases were incubated with 1 µmol/L Fe(II) as above, except after the 1-h incubation, the cells were washed with BSS and then incubated with a MEM solution deficient in the tracer iron solution with or without 500 nmol/L Cp or 200 µmol/L apotransferrin. The cells were incubated for 0, 5, 10, 15, 30 and 60 min at 37°C in an atmosphere of 5%CO2/95% air. The efflux medium was removed and counted for radioactivity. The cells were washed and then incubated with 1 g/L pronase to remove membrane-bound proteins. After centrifugation (700 x g for 5 min), the cells were washed and lysed in 0.1 mol/L NaOH, 1% Triton-X100. Cells were counted for radioactivity in a gamma counter.
Copper oxidase activity.
The intracellular and extracellular copper oxidase activity of IEC-6 cells was measured by the rate of oxidation of p-phenylenediamine (18
). A sodium acetate solution (200 mmol/L) containing 1.5 g/L p-phenylenediamine was incubated with viable cells in a 6-well plate, fresh and freshly boiled homogenates for 1560 min at 37°C. The reaction was stopped by the addition of 1.5 mol/L sodium azide. Parallel reactions with sodium azide present throughout the incubation were carried out to account for spontaneous oxidation of p-phenylenediamine. The color change was quantified by measuring its absorbance at 530 nm. Activity is expressed in units as follows: 1 U = 1 absorbance unit change/30 min.
Western blot analysis.
Protein concentrations of IEC-6 cells, glycosidase Ftreated and untreated intestinal mucosal scrapings were determined; 50 µg of each preparation was heated at 100°C for 5 min in standard Laemmli buffer and separated on a 12% SDS-polyacrylamide gel. Gels were electroblotted onto Immobilon-P transfer membrane (Millipore, Bedford, MA). Similar loading and transfer of proteins to the membranes was verified by staining the blots with Ponceau red. The blots were washed, dried and then subjected to antigen detection. Primary antibodies were used as follows: 1) mouse monoclonal proliferating cell nuclear antigen (PCNA) (1:1000), affinity purified rabbit polyclonal anti-rat DMT1 (1:2000) (9
). This antibody recognizes both the iron response element (IRE) and non-IRE forms of DMT1 (3
,4
,12
); 2) a rabbit polyclonal anti-rat ferritin (Fn) antibody that recognizes both heavy and light Fn chains (19
); and 3) rabbit polyclonal anti-rat IREG1 antibody (1:1500) (see below for verification). All polyclonal antibodies were produced in the laboratory. An anti-rabbit secondary antibody conjugated to horseradish peroxidase was used at 1:2000 for the polyclonal antibodies (Serotech, Oxford, UK) and an anti-mouse secondary antibody conjugated to horseradish peroxidase was used at 1:2000 for the monoclonal antibody (Serotech). The immune complexes were detected using the ECL chemiluminescent assay (Amersham, Bucks, UK).
Production and validation of IREG11 antibody.
A synthetic peptide corresponding to amino acids 247264 of rat IREG1 was conjugated to keyhole limpet hemocynanin and then used to immunize a rabbit for production of anti-IREG1 antiserum as described previously (9
). Several weeks after sensitization, antiserum was obtained and subjected to an ELISA using immobilized immunizing peptide as antigen to determine antibody titer.
IREG1 cDNA construction.
A polymerase chain reaction (PCR) fragment representing nucleotides 269-2012 of the published rat IREG1 sequence (Accession #U76714) and encompassing the open reading frame of the gene was generated by a one-step reverse transcriptase (RT) PCR (Invitrogen) using purified total RNA from rat duodenum. Primer used for the RT step was also the 3' primer, i.e., CAGATCTATTAGGCTGACTT; the 5' primer was CTAGCATCCGAACAAACAAG. The IREG1 cDNA was unidirectionally cloned in the sense direction into the Not1 and BamH1 sites of pcDNA3.1/V5/His-TOPO eucaryotic expression vector (Invitrogen). The orientation and sequence of the cDNA clone were confirmed by sequencing.
Overexpression and detection of IREG1 in Cos-7 cells and duodenal tissue.
Cos-7 cells were transfected by Lipofectamine treatment (Invitrogen). One day before transfection, 3 x 105 cells were seeded per 25cm2 culture flask, so that on the day of transfection, the culture was 70% confluent. No antibiotics were used throughout the transfection period. Cos-7 cells were transfected with either pcDNA3.1-IREG1 or pcDNA3.1 plasmids. Lipofectamine at 5 L/g DNA was used for the transfections. The DNA/lipofectamine mixture was removed after 5 h of incubation at 37°C and the cells were incubated for 24 h in DMEM with 5% FCS before they were lysed in lysis buffer as described above. The lysate was incubated with 5 µL of anti-IREG1 antibody for 1 h at 4°C. Immunoprecipitates were collected by incubation with 100 µL of protein A-sepharose for 2 h at 4°C, washed 3 times with PBS, heated at 100°C for 5 min in standard Laemmli buffer and separated on a 12% SDS-polyacrylamide gel. Western blot analysis was carried out as above. As an additional control, the tissue sections were incubated with the IREG1 antibody in the presence or absence of immunizing peptide (see below).
Validation of the isolation of villous mucosa from crypt mucosa.
Protein (50 µg) isolated from mid-villus, crypt cells and IEC-6 cells in log-phase were subjected to Western blot analysis using PCNA to detect cells in proliferation.
Immunofluorescence microscopy.
IEC-6 cells were grown on glass coverslips in 35-mm dishes. Cells were seeded at 1.5 x 105 cells/dish 2 d before the experiment and were in the exponential phase of cell growth for the experiment. Cells were prepared for immunofluorescence microsocopy either while viable or after fixation in 12% formalin. Primary antibodies were used as follows: monoclonal anti-sucrase-isomaltase (SI) (1:100) (20
), affinity purified rabbit polyclonal anti-rat DMT1 (1:300) and rabbit polyclonal anti-rat IREG1 (1:100). Rabbit preimmune serum was used as a control. Secondary antibodies were anti-rabbit Texas-red conjugated (Molecular Probes, Eugene, OR) or anti-mouse FITC-conjugated (Serotech) diluted 1:100 with BSS. Viable and fixed cells were incubated with primary and secondary antibodies together for 1 h at 37°C or 4°C and then washed 5 times with PBS. The viable cells were then fixed. Co-incubation of both primary and secondary antibodies with viable cells enabled the detection of these proteins after movement from the cell surface if this was a temperature-dependent process.
The proximal 0.5-cm segment of the duodenum from an iron-deficient and a normal rat were frozen in liquid nitrogencooled isopentane. This tissue was then stored at -80°C until sectioned. At the time of sectioning, the tissue was glued to a chuck with Tissue Tek O.C.T. compound (Miles Scientific, Naperville, IL). Sections (7 µm) were then cut at -13°C and adhered to a 0.5 g/L gelatin-coated microscope slides. The sections were dried for 10 min at room temperature and fixed in 12% formalin. The tissue was then used immediately for immunofluorescent microscopy for the localization of SI, DMT1 and IREG1 as described above. In addition, tissue was reacted with the IREG1 antibody that had been incubated overnight with 1 mg of the IREG1 immunizing peptide. To examine antibody staining, the tissue was covered with a coverslip using a fluorescence antifade mounting medium. Images were captured on an Olympus microscope equipped with a BioRad MRC-1000 confocal system, using a 10X or 60X objective (BioRad, Hercules, CA). All images were obtained using the same laser intensity, so that staining patterns could be compared. Images were processed using Adobe Photoshop 5 (Adobe Systems, San Jose, CA).
Statistical methods.
The results are expressed as means ± SEM. Data were analyzed by ANOVA and Tukeys test using the Instat program (Graphpad Software, San Diego, CA). Differences were considered significant at P < 0.05.
| RESULTS |
|---|
|
|
|---|
Cellular iron levels measured by atomic absorption spectrophotometry showed that iron-deficient cells contained 789 ± 24 fmol iron/µg protein, whereas iron-loaded cells contained 5587 ± 96 fmol iron/µg protein and control cells contained 1636 ± 52 fmol iron/µg protein. All conditions were different from one another other.
Fe(II) uptake by IEC-6 cells.
Because the uptake of 1 µmol/L Fe(II) by IEC-6 cells with normal iron levels was 80 fmol iron/µg protein at a pH of 5.5 and 51 fmol iron/µg protein at pH 7.5, we chose to measure uptake under different cellular iron concentrations at pH 5.5. No significant difference was seen in uptake of Fe(II) by IEC-6 cells in the stationary or exponential growth phase.
Exponential growth phase cells were studied with variations in iron loading, and a similar uptake pattern was seen for all conditions. When iron uptake was measured over the first 15 min, it was 20.1 ± 3, 11.2 ± 2 and 7.7 ± 2 µmol/(g protein · min) in iron-deficient, control and iron-loaded cells, respectively, all of which differed (Fig. 1
).
|
Iron was released from IEC-6 cells over time (Fig. 2
). The rate of release was constant for all iron conditions, resulting in the release of 50% of the radiolabeled iron within 60 min. Cells in the stationary or exponential growth phase did not differ in rate of release of iron. Addition of Cp or apotransferrin to the medium had no effect on the release of Fe (data not shown).
|
To determine the presence of IREG1 antisera we used ELISA to show that there was immunoreactivity when the antisera were reacted with immunizing antigen. To rigorously test the specificity of the antisera, we overexpressed recombinant rat IREG1 in Cos 7 cells. When the protein was immunoprecipitated and subjected to Western blot analysis using the antisera, a single band migrating at
60 kDa was observed. The signal was markedly greater than in untransfected or vector alone transfected Cos-7 cells in which the signal was equally low (Fig. 3
). In addition, the immunofluorescent signal seen with the IREG1 antibody on sections of tissue was identical to that previously reported (see below). This signal can be eliminated if the IREG1 antibody is incubated overnight with the immunizing peptide used to generate it, which indicates that the antibody is specific for rat IREG1 protein (Fig. 4C
).
|
|
Protein obtained from crypt mucosa and IEC-6 cells reacted positively for PCNA. Mid-villous cells were negative for PCNA (Fig. 5
).
|
DMT1 migrated predominantly as a band of
66 kDa in IEC-6 cells although there were an additional two bands (iron-deficient cells) and one smaller sized band (control cells) (Fig. 6A
). In villous mucosa, DMT1 migrated as a band at
90 kDa (Fig. 6A
). In addition, DMT1 expression in IEC-6 cells was inversely related to cellular iron loading (Fig. 6A
). Ferritin was demonstrated as a
20-kDa protein in both IEC-6 cells and rat intestinal scrapings (Fig. 6B
). Ferritin levels were directly related to cellular iron loading (Fig. 6B
). IREG11 migrated as a
60-kDa protein in IEC-6 cells and duodenal mucosa scrapings (Fig. 6C
). In IEC-6 cells, IREG1 expression was unaffected by cellular iron loading (Fig. 6C
).
|
Digesting duodenal mucosal protein with glycosidase F resulted in a reduction of the 90-kDa band to
66 kDa (Fig. 7
), suggesting that the heavier 90-kDa band observed in vivo is due to gylcosylation of the DMT1.
|
Copper oxidase activity of 0.16 U was detected in the homogenate of IEC-6 cells, but no activity could be detected extracellularly. In addition, this activity was lost when the IEC-6 homogenate was boiled (data not shown).
Localization of sucrase isomaltase, DMT1and IREG1.
SI was not detected in IEC-6 cells. In whole mounts of duodenum, SI was not detected in the crypt region but its expression commenced at the crypt-villous junction where it localized strongly along the brush border throughout the length of the villus, but attained the highest concentrations in the mid-villous region (Fig. 8
).
|
|
In IEC-6 cells, IREG1 was detected only on the cell membrane when immunofluorescence preparation was carried out on viable cells at 4°C (Fig. 10A
). However, when the reaction was carried out at 37°C, the protein was also seen at intracellular locations, where it localized to vesicles resembling endosomes (Fig. 10B
). When cells were fixed before processing for immunofluorescence, the pattern of staining was similar to that at 37°C (Fig. 10C
).
|
Unfortunately, because the DMT1 and IREG1 antibodies were both produced in rabbits, it was not possible to do colocalization studies to determine whether these proteins colocalized to the same organelles in IEC-6 cells and from tissue.
| DISCUSSION |
|---|
|
|
|---|
Because of the recognized role of DMT1 in the uptake of divalent metals and IREG1 in Fe release, we next examined whether these transport processes are present in IEC-6 cells. From preliminary studies, the addition of Fe(II) at a concentration known to saturate the transporter resulted in the uptake of Fe(II). Furthermore, our results are consistent with the requirement of a proton gradient for DMT1 to transport Fe(II) in the uptake step by showing this was highest at pH 5.5 and least effective at 7.5 (10
). Analysis of the data for the uptake of iron over time showed that this was curvilinear, suggesting the coexistence of an efflux transporter. Indeed we found that cells preloaded with radiolabeled iron released 50% of this within 60 min, revealing an efflux transporter. Interestingly, the release of iron from these cells does not require the presence of Cp or apotransferrin, nor was iron efflux increased when these were added to the medium. This differs from hepatocytes and macrophages that require the ferroxidase activity of Cp for most efficient release of iron as evidenced by its retention in the absence of Cp (26
). These results therefore appear consistent with the functioning of the Cp homologue hephaestin in the release of iron from the enterocyte (8
). Hephaestin is predicted to contain a carboxy terminal transmembrane domain, suggesting that it operates extracellularly (8
). We tested this possibility by determining protein-dependent copper oxidase activity both within and outside the cell and found it present only within IEC-6 cells. This suggests that hephaestin functions intracellularly and supports the observation that it occupies a perinuclear location in villous enterocytes (27
).
The expression of DMT1, IREG1 and the likely presence of hephaestin in IEC-6 cells are consistent with these proteins functioning in the uptake and efflux transport pathways. These findings differ from the only other study assessing Fe(II) uptake in IEC-6 cells performed 10 years ago (28
). They showed an uptake carrier in confluent cells, but there was no evidence of an efflux transporter. Here we show that these cells have both uptake and efflux transporters and have similar efficiencies in proliferating and stationary cells. Apart from the use of these cells in different states of proliferation, there appear to be no other major differences in the methodology of the two studies.
An important property of iron absorption is that it is regulated. In vivo iron absorption is increased by anemia, hypoxia, erythropoiesis and feeding diets low in iron; conversely it is inhibited by high iron stores (29
32
). Variations in uptake of Fe(II) are mediated by alterations in the expression of DMT1, whereas IREG1 appears to respond only to severe iron deficiency (5
,7
,33
). In view of this, we tested whether expression and function of these transport proteins in IEC-6 cells changed with variation in iron loading as is seen in vivo. DMT1 increased in proportion to uptake and this in turn was inversely related to cellular iron stores, a finding that supports studies using a human cell line (15
,16
). In addition to the
66-kDa product that can be predicted from the cDNA of DMT1, we also found two smaller products in iron-deficient cells and only one in control cells. Previously, it was suggested that DMT1 is produced de novo and is subject to rapid degradation if iron stores rise (34
). It is therefore possible that these smaller bands represent degradation of DMT1 as a result of activity associated with the uptake of iron that would be greatest with iron deficiency. Interestingly, the larger mass of DMT1 obtained from in vivo preparations compared with IEC-6 cells can be explained by glycosylation of DMT1 in mucosal enterocytes. This is based on the reduction in size of DMT1 to that of IEC-6 cells after glycosidase F treatment.
Ferritin expression increased with cellular iron levels and is consistent with its role in iron sequestration to prevent oxidative damage. The expressions of DMT1 and Fn conform to the known molecular mechanisms regulating their expression. In the case of DMT1 and Fn, there is an IRE within the 3' and 5' untranslated regions (UTR) of the mRNAs encoding these genes, respectively. With a decrease in cytoplasmic iron levels, there is increased activity of iron responsive proteins (IRP) I and II which leads to increased binding to IRE. This stabilizes the DMT1 transcript, enhancing the translation of DMT1 but reducing that of Fn. Thus, with cellular iron deficiency, increased expression of DMT1 leads to greater uptake of Fe(II) and because there is less Fn to sequester the iron, it is exported from the cell. Conversely, increased iron stores result in the degradation of DMT1 mRNA and inhibition of translation. The lack of detection of DMT1 in iron-loaded IEC-6 cells by Western blotting in this study supports this interpretation. Furthermore, because the DMT1 antibody used here recognizes both IRE and non-IRE forms of the protein, the non-IRE form would be expressed under iron-loaded conditions. Because no DMT1 was detected under these conditions, it suggests that DMT1 non-IRE is expressed at levels below detection or is absent from IEC-6 cells. In contrast to DMT1, IREG1 has a putative IRE in its 5' UTR, and its expression did not respond to alterations in iron loading, suggesting that under these circumstances, it is not regulated by an IRE/IRP mechanism. This is further supported by the similar rates of iron release seen with IEC-6 cells with different iron loads.
It is clear from confocal microscopy of intact tissue of villous enterocytes that DMT1 is localized to the cell membrane but can also be seen in the apical cytoplasm, suggesting that it can cycle between these sites as was suggested previously (9
,35
). We investigated this hypothesis using viable IEC-6 cells and showed that at 4°C, DMT1 was localized only to the cell membrane; however, when warmed to 37°C, DMT1 was also found inside the cell in structures resembling endosomes, suggesting that it can also function within the cell. The finding that the localization of DMT1 at 37°C and in cells fixed before immunofluorescence preparation was similar suggests that surface-bound DMT1 is in contact with all DMT1 located intracellularly.
With respect to IREG1, we along with others have found that in intact tissue, it is localized to the basal and lateral membranes and lower one third of the cytoplasm (5
7
). This suggests that it may also cycle. This was tested in viable IEC-6 cells; at 4°C, IREG1 was localized to the cell membrane; when warmed to 37°C, however, the protein was internalized, revealing IREG1 in the cytoplasm similar to that in intact tissue. Collectively, the findings taken from intact tissue and IEC-6 cells show for the first time that IREG1 functions by moving from the basolateral membrane and basal cytoplasm of the enterocyte as part of the uptake of iron, whereas DMT1 operates between the microvillous cell membrane and apical cytoplasm. Clearly, it will be of interest to define the signaling and structures involved in this cycling process and to determine whether DMT1 and IREG1 interact directly.
This study has validated the use of the IEC-6 cells as a model of intestinal iron transport by demonstrating the expression of iron transport proteins that function in the uptake and efflux of iron and that these processes are regulated by variation in cellular iron. Thus, this cell model is appropriate to use in conjunction with in vivo studies on rats, mice and other intestinal cell lines such as Caco-2 cells (15
,16
) to study the mechanism of iron transport. Studies such as the cycling of DMT1 and IREG1 from cell membrane to intracellular sites as shown in this study and further studies will provide new insights into this mechanism. Clearly understanding the molecular mechanisms of IREG1 will be important because this is reported to be up-regulated in genetic hemochromatosis and therefore is likely to contribute to the inappropriately high level of iron absorption seen in these individuals.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
3 Abbreviations used: BSS, buffered salt solution; Cp, ceruloplasmin; DMEM, Dulbeccos modified Eagles medium; DMT1, divalent metal transporter 1; FCS, fetal calf serum; Fe(II), ferrous iron; Fn, ferritin; IEC-6, intestinal cell line 6; IRE, iron response element; IREG1, basolateral transporter; IRP, iron response protein; MEM, minimal essential medium; MTP1, metal transporter protein 1; PCNA, proliferating cell nuclear antigen; PCR, polymerase chain reaction; RT, reverse transcriptase; SI, sucrase isomaltase. ![]()
Manuscript received 21 August 2001. Initial review completed 25 September 2001. Revision accepted 21 December 2001.
| LITERATURE CITED |
|---|
|
|
|---|
1. Andrews, N. C. (2000) Intestinal iron absorption: current concepts circa 2000. Dig. Liver Dis. 32:56-61.[Medline]
2. McCord, J. M. (1998) Iron, free radicals, and oxidative injury. Semin. Hematol. 35:5-12.[Medline]
3. Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F., Nussberger, S., Gollan, J. L. & Hediger, M. A. (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature (Lond.) 388:482-488.[Medline]
4. Fleming, M. D., Trenor, C. C., III, Su, M. A., Foernzler, D., Beier, D. R., Dietrich, W. F. & Andrews, N. C. (1997) Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat. Genet. 16:383-386.[Medline]
5.
Abboud, S. & Haile, D. J. (2000) A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J. Biol. Chem. 275:19906-19912.
6. Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S. J., Moynihan, J., Paw, B. H., Drejer, A., Barut, B., Zapata, A., Law, T. C., Brugnara, C., Lux, S. E., Pinkus, G. S., Pinkus, J. L., Kingsley, P. D., Palis, J., Fleming, M. D., Andrews, N. C. & Zon, L. I. (2000) Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature (Lond.) 403:776-781.[Medline]
7. McKie, A. T., Marciani, P., Rolfs, A., Brennan, K., Wehr, K., Barrow, D., Miret, S., Bomford, A., Peters, T. J., Farzaneh, F., Hediger, M. A., Hentze, M. W. & Simpson, R. J. (2000) A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol. Cell 5:299-309.[Medline]
8. Vulpe, C. D., Kuo, Y. M., Murphy, T. L., Cowley, L., Askwith, C., Libina, N., Gitschier, J. & Anderson, G. J. (1999) Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat. Genet. 21:195-199.[Medline]
9.
Trinder, D., Oates, P. S., Thomas, C., Sadleir, J. & Morgan, E. H. (2000) Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 46:270-276.
10.
Tandy, S., Williams, M., Leggett, A., Lopez-Jimenez, M., Dedes, M., Ramesh, B., Srai, S. K. & Sharp, P. (2000) Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells. J. Biol. Chem. 275:1023-1029.
11.
Oates, P. S. & Morgan, E. H. (1996) Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am. J. Physiol. 270:G826-G832.
12.
Fleming, M. D., Romano, M. A., Su, M. A., Garrick, L. M., Garrick, M. D. & Andrews, N. C. (1998) Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc. Natl. Acad. Sci. U.S.A. 95:1148-1153.
13.
Oates, P. S., Thomas, C., Freitas, E., Callow, M. J. & Morgan, E. H. (2000) Gene expression of divalent metal transporter 1 and transferrin receptor in duodenum of Belgrade rats. Am. J. Physiol. 278:G930-G936.
14.
Manis, J. (1971) Intestinal iron-transport defect in the mouse with sex-linked anemia. Am. J. Physiol. 220:135-139.
15.
Han, O., Fleet, J. C. & Wood, R. J. (1999) Reciprocal regulation of HFE and Namp2 gene expression by iron in human intestinal cells. J. Nutr. 129:98-104.
16.
Tallkvist, J., Bowlus, C. L. & Lonnerdal, B. (2000) Functional and molecular responses of human intestinal Caco-2 cells to iron treatment. Am. J. Clin. Nutr. 72:770-775.
17. Bieri, J. G., Stoewsand, G. S., Briggs, G. M., Phillips, R. W., Woodard, J. C. & Knapka, J. J. (1977) Report of the American Institute of Nutrition Ad Hoc committee on standards for nutritional studies. J. Nutr. 107:1340-1348.
18. Sunderman, F. W., Jr & Nomoto, S. (1970) Measurement of human serum ceruloplasmin by its p-phenylenediamine oxidase activity. Clin. Chem. 16:903-910.[Abstract]
19.
Oates, P. S. & Morgan, E. H. (1997) Ferritin gene expression and transferrin receptor activity in intestine of rats with varying iron stores. Am. J. Physiol. 273:G636-G646.
20. Quaroni, A. & Isselbacher, K. J. (1985) Study of intestinal cell differentiation with monoclonal antibodies to intestinal cell surface components. Dev. Biol. 111:267-279.[Medline]
21.
Quaroni, A., Wands, J., Trelstad, R. L. & Isselbacher, K. J. (1979) Epithelioid cell cultures from rat small intestine. Characterization by morphologic and immunologic criteria. J. Cell Biol. 80:248-265.
22. Daniele, B. & DAgostino, L. (1994) Proliferation and differentiation of the small intestinal epithelium: from Petri dish to bedside. Ital. J. Gastroenterol. 26:459-470.[Medline]
23.
Hodin, R. A., Chamberlain, S. M. & Meng, S. (1995) Pattern of rat intestinal brush-border enzyme gene expression changes with epithelial growth state. Am. J. Physiol. 269:C385-C391.
24. Pothier, P. & Hugon, J. S. (1980) Characterization of isolated villus and crypt cells from the small intestine of the adult mouse. Cell Tissue Res. 211:405-418.[Medline]
25. Pountney, D. J., Konijn, A. M., McKie, A. T., Peters, T. J., Raja, K. B., Salisbury, J. R. & Simpson, R. J. (1999) Iron proteins of duodenal enterocytes isolated from mice with genetically and experimentally altered iron metabolism. Br. J. Haematol. 105:1066-1073.[Medline]
26. Harris, E. D. (1999) Ceruloplasmin and iron: vindication after 30 years. Nutrition 15:72-74.[Medline]
27.
Frazer, D. M., Vulpe, C. D., McKie, A. T., Wilkins, S. J., Trinder, D., Cleghorn, G. J. & Anderson, G. J. (2001) Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins. Am. J. Physiol. 281:G931-G939.
28. Nichols, G. M., Pearce, A. R., Alverez, X., Bibb, N. K., Nichols, K. Y., Alfred, C. B. & Glass, J. (1992) The mechanisms of nonheme iron uptake determined in IEC-6 rat intestinal cells. J. Nutr. 122:945-952.
29. Charlton, R. W. & Bothwell, T. H. (1983) Iron absorption. Annu. Rev. Med. 34:55-68.[Medline]
30. Conrad, M. E. (1968) Intraluminal factors affecting iron absorption. Isr. J. Med. Sci. 4:917-931.[Medline]
31. Weintraub, L. R., Conrad, M. E. & Crosby, W. H. (1965) Absorption of hemoglobin iron by the rat. Proc. Soc. Exp. Biol. Med. 120:840-843.[Medline]
32. Wheby, M. S. (1966) Regulation of iron absorption. Gastroenterology 50:888-892.[Medline]
33. Andrews, N. C. (1999) The iron transporter DMT1. Int. J. Biochem. Cell Biol. 31:991-994.[Medline]
34. Oates, P. S, Trinder, D. & Morgan, E. H. (2000) Gastrointestinal function, divalent metal transporter-1 expression and intestinal iron absorption. Pflugers Arch. 440:496-502.[Medline]
35.
Yeh, K. Y., Yeh, M., Watkins, J. A., Rodriguez-Paris, J. & Glass, J. (2000) Dietary iron induces rapid changes in rat intestinal divalent metal transporter expression. Am. J. Physiol. 279:G1070-G1079.
This article has been cited by other articles:
![]() |
J. F. Collins, P. Hua, Y. Lu, and P. N. Ranganathan Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G695 - G707. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Thomas and P S Oates Ferroportin/IREG-1/MTP-1/SLC40A1 modulates the uptake of iron at the apical membrane of enterocytes Gut, January 1, 2004; 53(1): 44 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Thomas and P. S. Oates Copper deficiency increases iron absorption in the rat Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G789 - G795. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Liuzzi, J. A. Bobo, L. Cui, R. J. McMahon, and R. J. Cousins Zinc Transporters 1, 2 and 4 Are Differentially Expressed and Localized in Rats during Pregnancy and Lactation J. Nutr., February 1, 2003; 133(2): 342 - 351. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||