![]() |
|
|
1-Antichymotrypsin Are Independent Predictors of Body Composition in Pregnant Zimbabwean Women
1


*
Research Department of Human Nutrition, Royal Veterinary and Agricultural University, Frederiksberg, Denmark;
Danish Bilharziasis Laboratory, Charlottenlund, Denmark;
**
Blair Research Laboratory, Ministry of Health, Harare, Zimbabwe;
Department of Clinical Pharmacology, University of Zimbabwe, Harare, Zimbabwe; and

Department of Clinical Chemistry, Aalborg University Hospital, Aalborg, Denmark
1To whom correspondence should be addressed. E-mail: h.friis{at}pubhealth.ku.dk.
| ABSTRACT |
|---|
|
|
|---|
1-antichymotrypsin (ACT, an acute phase protein) in weight, body mass index (BMI), arm circumference (AC), triceps skinfold thickness (TSF), and arm muscle (AMA) and fat (AFA) area were assessed using multiple linear regression analysis. The mean (range) age was 24.4 (1445) y and gestational age 29 (2235) wk. HIV infection was present in 31.5% of the women, malaria parasitemia in 0.4% and 11.4% had serum ACT >0.4 g/L. There was no difference in any anthropometric variable between HIV-infected and uninfected women. However, women with viral loads (genome equivalents/mL) between 4 and 5 and >5 log10 had 1.1 [95% confidence interval (CI): -0.3, 2.3] and 2.5 (95% CI: 0.1, 5.1) kg lower weights compared with uninfected women; this was explained by losses of both AFA and AMA. Malaria parasitemia was associated with 6 cm2 (95% CI: 0.4; 11.8) or 25% lower AMA. Elevated serum ACT was a negative predictor of all anthropometric variables, i.e., levels between 0.3 and 0.4, 0.4 and 0.5 and >0.5 g/L were associated with 1, 2 and 6 kg lower mean body weights, respectively. Despite the limitations of a cross-sectional design, we conclude that arm fat and muscle areas, reflecting body fat and lean body mass, seem to be unaffected in the majority of HIV-infected pregnant women, but decline with increasing viral loads. The effects of viral load are not explained by elevated serum ACT, which is a strong independent predictor of all anthropometric variables.
KEY WORDS: HIV-1 malaria acute phase body composition pregnancy
| INTRODUCTION |
|---|
|
|
|---|
There are no data on the effect of HIV infection on body composition in pregnancy, despite the fact that the prevalence of HIV infection exceeds 25% in the worst afflicted countries in sub-Saharan Africa. Pregnant women with HIV infection have low viral loads and are usually asymptomatic (Friis, H., unpublished data), likely because fertility becomes impaired with advancing HIV infection (5
). Nonetheless, their status with respect to vitamin A, ß-carotene and folate and several other micronutrients is often reduced (6
,7
).
Because body composition is of importance to maternal health and reproduction, the role of HIV and other infections in body composition during pregnancy should be clarified. Anthropometric data were available from a study among 1669 pregnant Zimbabwean women (7
). We described previously the complex relationship between age and gravidity, and body composition, based on the 1113 HIV uninfected women in this study (8
). Here we present data on the role of HIV status and viral load, malaria parasitemia and elevated serum
1-antichymotrypsin (ACT) in body composition based on simple anthropometric measurements.
| SUBJECTS AND METHODS |
|---|
|
|
|---|
The study was conducted in the Mbare residential area of Harare, Zimbabwe, in 19961997. Unemployment was very high in the study area, especially among women; most of those employed were general laborers. The common diet was maize meal porridge taken with vegetables and occasionally meat. Malaria was not endemic in the study area due to high altitude.
Women registering for antenatal care at Edith Oppermann Maternity Hospital were informed about the study; those between 22 and 36 wk gestation were offered inclusion. Women were informed about HIV testing and counseled before giving their written consent to participate. Counseling was provided by a nongovernmental organization, AIDS Counseling Trust. HIV results were made available within 2 wk, when those willing to know their results were counseled post-test. A questionnaire was administered, and clinical examination and blood sampling were done. A research nurse obtained demographic data, and medical and obstetric history. Gestational age was calculated from d 1 of the last menstruation, or estimated by fundus height. Antiretroviral drugs were not available for either treatment or prevention of mother-to-child transmission. Permission was obtained from the ethical and scientific committees of Medical Research Council of Zimbabwe, Harare City Health Department and Ministry of Health. The Danish Central Medical Ethics Committee also approved the study. Clinical examination was part of routine antenatal care, and women found sick were referred for treatment at Edith Oppermann Maternity Hospital or Harare Central Hospital.
Anthropometric examinations.
Height and weight were measured with the women barefooted and wearing light clothing. Height was measured to the nearest 0.1 cm and weight to the nearest 0.1 kg. Body mass index (BMI) was computed as weight/height2 (kg/m2). Mid-upper arm circumference (AC) was measured to the nearest 0.1 cm, and triceps skinfold thickness (TSF) to the nearest 0.1 mm on the right arm. With the women in the standing position and the elbow flexed to 90°, the midpoint between the lateral projection of the acromial process and the inferior border of the olecranon process of the ulna was identified. The TSF was then measured using a Harpenden caliper (Assist Creative Resources Ltd., Wrexham, UK), in the midline of the posterior aspect of the arm at the marked level, with the arm hanging loosely. At the same level, the AC was measured without compressing the tissue, using Babytape (Raven Equipment, Dunmow, Essex, UK). From the measurements of AC and TSF, the arm muscle area (AMA) and arm fat area (AFA) were calculated, without adjusting for bone area, using the formulas: AMA = [AC - (TSF ·
)]2/(4 ·
), and arm fat area, AFA = [AC2/(4 ·
)] - AMA, and expressed as cm2 (9
).
HIV, malaria and serum
1-antichymotrypsin.
Venous blood was collected between 900 and 1200 h, with 5 mL collected in EDTA tubes and 5 mL in plain tubes. The samples were placed in ice-cooled insulated boxes immediately after collection and were delivered to the laboratory within 4 h. Thick and thin blood slides were made for malaria parasitemia. Serum was separated and stored in liquid nitrogen at -196°C until tested for antibodies against HIV type 1/2. Samples found negative with the Genelavia Mixt (Sanofi, Marnes la Coquette, France) HIV-1/2 enzyme immunoassay kit were reported negative. Positive and indeterminate samples were further tested using the Recombigen HIV-1/2 (Cambridge Biotech, Galway, Ireland) enzyme immunoassay with different antigens from the Genelavia kit. Samples positive with the Recombigen were reported positive, whereas women with indeterminate results were tested on a later sample. Samples found positive were confirmed at the Department of Clinical Chemistry, Aalborg University Hospital, Denmark, using a modification of a reverse transcriptase-polymerase chain reaction developed in-house (10
). HIV-RNA was isolated from 125 µL plasma. The following primers from the gag region of the virus were used: 5'-primer, AGTTGGAGGACATCAAGCAGCCATGCA AAT and 3'-primer, TGCTATGTCAGTTCCCCTTGGTTCTCT. All samples were analyzed in two independent extractions and runs. The limit of detection was 40 genome equivalents (geq)/mL. Samples with discordant results were retested in duplicate. Data on CD4 counts were available only on a subsample and were not included in this analysis. Serum
1-antichymotrypsin (ACT) was measured by automated turbidimetry (Cobas Mira Plus; Roche, Basel, Switzerland), as previously described (7
), and arbitrarily categorized as <0.3, 0.30.4, 0.40.5 and >0.5 g/L.
Statistical analysis.
The distribution of the anthropometric variables conformed to normality as assessed by normal probability plots. The two-sample t test and one-way ANOVA were used to test for differences in means, and the
2 test to test for differences in proportions. Multiple linear regression analysis was used to estimate the statistical effects of HIV infection, malaria parasitemia and elevated ACT on weight, BMI, AC, TSF, AMA and AFA. Age, gravidity, gestational age and season of enrollment were controlled for in all models. Gestational age was controlled for using a categorical variable (2225, 2628, 2932 and 3335 wk) or dummy variables where the effect was not linear (i.e., body weight). For all dependent variables except AMA, interactions between age and gravidity were found, and interaction terms expressing the effect of age for different categories of gravidity included as described previously (8
). If no interactions were found (i.e., AMA), age and gravidity were included as independent variables. HIV-uninfected women were assigned an HIV load of 0 before viral loads were log10(x + 1) transformed. Dummy variables were used to assess the statistical effect of categories of viral load and elevated serum ACT, and categorical variables to test for linear trend. Residual analysis was performed by assessing normal plots, and by plotting standardized residuals against predicted values and continuous independent variables. The level of significance used was 0.05.
| RESULTS |
|---|
|
|
|---|
|
Neither HIV [95% confidence interval (CI): -1.44; 0.35, P = 0.23] nor malaria (95% CI: -3.93; 8.34, P = 0.48) infection was a predictor of weight, when gestational age, age, gravidity and season were controlled for in multiple regression analysis. However, using dummy variables to assess the effect of viral load (Table 2
), women with viral loads >5 log10 had 2.5 kg (95% CI: -0.1; 5.1) lower mean body weight than uninfected women if elevated serum ACT was not controlled for, but the difference was only marginally significant (P = 0.058). If elevated serum ACT was included in the model, the difference was 2.2 kg (95% CI: -0.4; 4.8, P = 0.09). Elevated serum ACT was strongly, inversely associated with weight, in that women with levels between 0.3 and 0.4, 0.4 and 0.5 and >0.5 g/L had almost 1, 2 and 6 kg, respectively, lower mean body weight than women with levels <0.3 g/L (Table 2
, model 2). With body mass index as the dependent variable, a similar model was obtained (data not shown).
|
Malaria parasitemia was not a predictor (-1.60, 95% CI: -3.67; 0.48, P = 0.13), but women with HIV infection had a 0.39 cm (95% CI: 0.09; 0.69, P = 0.01) lower AC than uninfected women (not shown). If the effect of HIV infection was assessed using dummy variables based on viral loads, then women with levels between 4 and 5 and >5 log10 had 0.77 (95% CI: 0.33; 1.20) and 1.10 cm (95% CI: 0.23; 1.97) lower AC than uninfected women (Table 3
, model 1). The effects of HIV infection were only slightly lower if elevated ACT was controlled for (model 2). Serum ACT levels between 0.4 and 0.5 and >0.5 g/L were associated with 0.71 and 1.89 cm lower AC, respectively, whereas AC did not differ between women with serum ACT <0.3 and between 0.3 and 0.4 g/L.
|
Women that were HIV infected had 0.62 mm (95% CI: 0.03; 1.20, P = 0.04) lower mean TSF than uninfected women, whereas malaria parasitemia was not associated with TSF (0.63, 95% CI: -3.35; 4.62, P = 0.76). The lower TSF in HIV-infected women was due to effects of viral loads <3 and >4 log10. Women with serum ACT >0.5 g/L had a 2.31 mm (95% CI: 0.81; 3.82) lower mean TSF than women with serum ACT <0.3 g/L, whereas TSF of women with serum ACT between 0.3 and 0.5 g/L was not different (Table 4
).
|
HIV infection was associated with a 1.0 cm2 (95% CI: 0.2; 1.9, P = 0.02) lower AFA. The effect of HIV infection was due to lower AFA among those with viral loads >4 log10 (Table 5
). In contrast, malaria parasitemia was not a predictor of AFA (-0.8, 95% CI: -6.6; 5.0, P = 0.78), but the estimate was imprecise due to the low number of cases. The regression coefficients of serum ACT between 0.3 and 0.4, 0.4 and 0.5 and >0.5 g/L, were 0.02, -1.0 and -4.0, but only the latter differed from the reference category (Table 5
, model 2).
|
HIV status was not significantly associated with AMA (-0.4, 95% CI: -1.2; 0.4, P = 0.32). However, if viral load was introduced into the model, then AMA was 1.6 (95% CI: 0.4; 2.8) and 2.4 (95% CI: -0.03; 4.8) cm2 lower in women with viral loads between 4 and 5 and >5 log10, respectively, compared with HIV-uninfected women (Table 6
). Malaria parasitemia was a significant predictor of AMA, with the regression coefficient reflecting a 6 cm2 lower AMA among the seven parasitemic women compared with those without parasitemia. AMA declined with increasing serum ACT, and was 0.7, 1.9 and 4.3 cm2 lower in women with serum ACT between 0.3 and 0.4, 0.4 and 0.5 and >0.5 g/L, respectively, compared with women with serum ACT <0.3 g/L (Table 6
, model 2). The estimated effects of malaria parasitemia and HIV viral load were weakened when elevated serum ACT was explained in the model.
|
| DISCUSSION |
|---|
|
|
|---|
HIV and malaria.
Wasting has long been recognized as a cardinal symptom of AIDS (17
). With advancing HIV infection, there is a progressive depletion of body cell mass with death occurring when approximately half of the body cell mass is lost (1
). Although the weight loss is usually episodic when accompanying opportunistic infections, but progressive in patients with chronic diarrhea (18
), there is evidence that loss of lean body mass occurs even in early asymptomatic HIV infection before significant immune deficiency (2
,19
,20
). Because loss of lean body mass has been shown to be a predictor of survival, independent of CD4 count (2
,21
), it is important to describe the changes in body composition with time in HIV infection, and to identify its determinants.
In contrast to other studies, we found no crude differences in any anthropometric variable between HIV-infected and -uninfected women. This is most likely explained by the earlier stage of HIV infection in pregnant women compared with those in previous studies based on patients recruited from HIV clinics. Pregnant HIV-infected women represent earlier HIV infection due to the substantial impairment of fertility by HIV infection, as well as increased fetal loss. From a cross-sectional study among almost 5000 Ugandan women, the odds ratio of pregnancy was 0.49 in those without symptoms, and 0.23 in those with symptoms of HIV-associated disease (5
). This was due to both reduced risk of pregnancy and increased risk of pregnancy loss because among the nonpregnant women subsequently followed-up, the relative risk of pregnancy was 0.73, and the relative risk of pregnancy loss was 1.50 among HIV-infected compared with -uninfected women. Thus, HIV-infected women in the last half of pregnancy represent early HIV infection.
Although HIV status was only a predictor of arm fat area, we found that all anthropometric measurements and indicators declined with increasing viral load. A similar relationship between viral load and magnitude of weight loss was reported from a study among 33 severely wasted patients referred to a wasting clinic (22
). In half of the patients, the weight loss could not be explained by opportunistic infections or gastrointestinal symptoms, suggesting that a high viral load per se leads to loss of weight. Our finding of an inverse relationship between viral load and weight among women with early asymptomatic HIV infection further supports this.
We found that viral loads between 4 and 5 and >5 log10 were associated with 1 and 2.5 kg lower body weight, respectively, which were explained by 1.6 and > 2 cm2, respectively, lower arm fat as well as arm muscle areas. However, although the effects on arm fat and muscle area were of similar magnitude when expressed in absolute terms, the effect on arm fat area was twice as great when expressed relative to the mean area (Table 1)
. A larger effect on fat compared with lean body mass is in contrast to findings from studies of men in whom loss of weight is due to loss of lean body mass. However, the finding is in accordance with results from the few studies among nonpregnant women (4
,23
,24
). In a study among HIV-infected women with wasting, Grinspoon et al. (23
) found that women had a progressive and disproportionate loss of body fat compared with lean body mass. Compared with nonwasted HIV-infected controls, those with wasting had lost 58% fat and 13% lean body mass. Kotler and colleagues (4
) did a study among men and women based on bioimpedance analysis, and found an interaction between HIV and sex on body composition. Of the difference in weight between HIV-infected and -uninfected individuals, fat-free mass accounted for one half in men, but only one fifth in women. In other words, HIV infection was found to reduce the sexual dimorphism of body composition (4
). Swanson et al. (24
) also reported that underweight HIV-infected women have a preferential loss of fat mass and a relative preservation of body cell mass.
Controlling for elevated serum ACT had a modest effect on the relationship between viral load and body composition. This is not surprising because we reported previously that there was no difference in mean serum ACT between HIV-infected and -uninfected pregnant women. However, HIV-infected women tended to have low and high levels (7
). Furthermore, although mild to moderately elevated (0.30.5 g/L) serum ACT was associated with higher viral load, highly elevated (> 0.5 g/L) ACT was not (Friis, H., unpublished data). Thus, only a small proportion of the effects are mediated through the acute phase response. Direct effects of HIV infection in the gastrointestinal tract on absorption of nutrients (25
), rather than increased energy and nutrient requirements or reduced appetite, could be responsible for the loss of lean and fat body mass early in the course of HIV infection.
Malaria was not endemic because transmission cannot take place in the study area due to the high altitude. With only seven women parasitemic, the regression coefficients of malaria parasitemia could not be estimated with precision. Nonetheless, malaria parasitemia was associated with considerably lower arm muscle area, whereas it was not a predictor of arm fat area.
The acute phase response.
We used elevated serum ACT as a measure of ongoing acute phase response, although
1-acidglycoprotein, C-reactive protein and other acute phase proteins have also been recommended. Women with elevated serum ACT had substantially lower lean body mass, and to a lesser extent body fat mass, resulting in as much as 1, 2 and 6 kg lower body weight among women with serum ACT between 0.3 and 0.4, 0.4 and 0.5 and >0.5 g/L, respectively,. The effects of serum ACT levels around the mean of 0.32 g/L are surprising in view of the fact that 0.6 g/L was suggested previously as a cut-off value defining elevated levels (26
). However, on the basis of associations with serum markers of micronutrient status and hemoglobin (6
,7
), we previously suggested 0.4 g/L as a cut-off value, and the anthropometric data presented here seem to be consistent.
Elevated serum ACT most likely reflects an acute phase response to various infections, other than malaria and HIV. However, elevated serum ACT could be the result rather than the cause of the loss of lean and fat body mass. This latter possibility could not be confirmed among nonpregnant obese Danes because there were no changes in serum ACT after considerable weight losses (Michael Martinez, Research Department of Human Nutrition, Royal Veterinary and Agricultural University, Frederiksberg, Denmark, personal communication).
Despite the limitations of cross-sectional studies, we conclude that increasing HIV viral load seems to lead to loss of both lean and fat body mass, even in early HIV infection in pregnant women. These effects are not mediated by an acute phase response, although even mild to moderately elevated serum ACT was associated with considerable weight loss.
| FOOTNOTES |
|---|
1-antichymotrypsin; AFA, arm fat area; AMA, arm muscle area; BMI, body mass index; CI, confidence interval; geq, genome equivalents; HIV, human immunodeficiency virus; TSF, triceps skinfold thickness. Manuscript received 19 June 2002. Initial review completed 8 August 2002. Revision accepted 2 September 2002.
| LITERATURE CITED |
|---|
|
|
|---|
1. Kotler, D. P., Tierney, A. R., Wang, J. & Pierson, R. N., Jr. (1989) Magnitude of body-cell-mass depletion and the timing of death from wasting in AIDS. Am. J. Clin. Nutr. 50:444-447.
2. Suttmann, U., Ockenga, J., Selberg, O., Hoogestraat, L., Deicher, H. & Muller, M. J. (1995) Incidence and prognostic value of malnutrition and wasting in human immunodeficiency virus-infected outpatients. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 8:239-246.[Medline]
3. Wheeler, D. A., Gibert, C. L., Launer, C. A., Muurahainen, N., Elion, R. A., Abrams, D. I. & Bartsch, G. E. (1998) Weight loss as a predictor of survival and disease progression in HIV infection. Terry Beirn Community Programs for Clinical Research on AIDS. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 18:80-85.[Medline]
4. Kotler, D. P., Thea, D. M., Heo, M., Allison, D. B., Engelson, E. S., Wang, J., Pierson, R. N., Jr., St Louis, M. & Keusch, G. T. (1999) Relative influences of sex, race, environment, and HIV infection on body composition in adults. Am. J. Clin. Nutr. 69:432-439.
5. Gray, R. H., Wawer, M. J., Serwadda, D., Sewankambo, N., Li, C., Wabwire-Mangen, F., Paxton, L., Kiwanuka, N., Kigozi, G., Konde-Lule, J., Quinn, T. C., Gaydos, C. A. & McNairn, D. (1998) Population-based study of fertility in women with HIV-1 infection in Uganda. Lancet 351:98-103.[Medline]
6. Friis, H., Gomo, E., Koestel, P., Ndhlovu, P., Nyazema, N., Krarup, H. & Michaelsen, K. F. (2001) HIV and other predictors of serum folate, serum ferritin, and hemoglobin in pregnancy: a cross-sectional study in Zimbabwe. Am. J. Clin. Nutr. 73:1066-1073.
7. Friis, H., Gomo, E., Koestel, P., Ndhlovu, P., Nyazema, N., Krarup, H. & Michaelsen, K. F. (2001) HIV and other predictors of serum beta-carotene and retinol in pregnancy: a cross-sectional study in Zimbabwe. Am. J. Clin. Nutr. 73:1058-1065.
8. Friis, H., Gomo, E., Kæstel, P., Nyazema, N., Ndhlovu, P. & Michaelsen, K. F. (2002) Does the first pregnancy precipitate age-related fat deposition?. Int. J. Obes. 26:1274-1276.
9. Frisancho, A. R. (1990) Anthropometric Standards for the Assessment of Growth and Nutritional Status 1990 The University of Michigan Press Ann Arbor, MI.
10. Krarup, H. B., Drewes, A. M. & Madsen, P. H. (1998) A quantitative HCV-PCR test for routine diagnostics. Scand. J. Clin. Lab. Investig. 58:415-422.[Medline]
11. Institute of Medicine (1990) Body composition changes during pregnancy. Nutrition during Pregnancy 1990:121-136 National Academy Press Washington, DC.
12. World Health Organization (1995) Physical Status: The Use and Interpretation of Anthropometry. WHO Technical Report Series no. 854 1995 WHO Geneva, Switzerland .
13. Hediger, M. L., Scholl, T. O., Schall, J. I., Healey, M. F. & Fischer, R. L. (1994) Changes in maternal upper arm fat stores are predictors of variation in infant birth weight. J. Nutr. 124:24-30.
14. Sidebottom, A. C., Brown, J. E. & Jacobs, D. R., Jr. (2001) Pregnancy-related changes in body fat. Eur. J. Obstet. Gynecol. Reprod. Biol. 94:216-223.[Medline]
15. Neggers, Y., Goldenberg, R. L., Cliver, S. P., Hoffman, H. J. & Cutter, G. R. (1992) Usefulness of various maternal skinfold measurements for predicting newborn birth weight. J. Am. Diet. Assoc. 92:1393-1394.[Medline]
16. Briend, A. (1985) Do maternal energy reserves limit fetal growth?. Lancet 1:38-40.[Medline]
17. Serwadda, D., Mugerwa, R. D., Sewankambo, N. K., Lwegaba, A., Carswell, J. W., Kirya, G. B., Bayley, A. C., Downing, R. G., Tedder, R. S., Clayden, S. A. & Dagleish, A. G. (1985) Slim disease: a new disease in Uganda and its association with HTLV-III infection. Lancet 2:849-852.[Medline]
18. Macallan, D. C., Noble, C., Baldwin, C., Foskett, M., McManus, T. & Griffin, G. E. (1993) Prospective analysis of patterns of weight change in stage IV human immunodeficiency virus infection. Am. J. Clin. Nutr. 58:417-424.
19. Kotler, D. P. (1997) Management of nutritional alterations and issues concerning quality of life. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 16(suppl. 1):S30-S35.
20. Ott, M., Lembcke, B., Fischer, H., Jager, R., Polat, H., Geier, H., Rech, M., Staszeswki, S., Helm, E. B. & Caspary, W. F. (1993) Early changes of body composition in human immunodeficiency virus- infected patients: tetrapolar body impedance analysis indicates significant malnutrition. Am. J. Clin. Nutr. 57:15-19.
21. Ott, M., Fischer, H., Polat, H., Helm, E. B., Frenz, M., Caspary, W. F. & Lembcke, B. (1995) Bioelectrical impedance analysis as a predictor of survival in patients with human immunodeficiency virus infection. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 9:20-25.[Medline]
22. Rivera, S., Briggs, W., Qian, D. & Sattler, F. R. (1998) Levels of HIV RNA are quantitatively related to prior weight loss in HIV-associated wasting. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 17:411-418.[Medline]
23. Grinspoon, S., Corcoran, C., Miller, K., Biller, B. M., Askari, H., Wang, E., Hubbard, J., Anderson, E. J., Basgoz, N., Heller, H. M. & Klibanski, A. (1997) Body composition and endocrine function in women with acquired immunodeficiency syndrome wasting. J. Clin. Endocrinol. Metab. 82:1332-1337.
24. Swanson, B., Hershow, R. C., Sha, B. E., Benson, C. A., Cohen, M. & Gunfeld, C. (2000) Body composition in HIV-infected women. Nutrition 16:1064-1068.[Medline]
25. Ullrich, R., Zeitz, M., Heise, W., Lage, M., Hoffken, G. & Riecken, E. O. (1989) Small intestinal structure and function in patients infected with human immunodeficiency virus (HIV): evidence for HIV-induced enteropathy. Ann. Intern. Med. 111:15-21.
26. Paracha, P. I., Jamil, A., Northrop-Clewes, C. A. & Thurnham, D. I. (2000) Interpretation of vitamin A status in apparently healthy Pakistani children by using markers of subclinical infection. Am. J. Clin. Nutr. 72:1164-1169.
This article has been cited by other articles:
![]() |
E. G. Piwoz and M. E. Bentley Women's Voices, Women's Choices: The Challenge of Nutrition and HIV/AIDS J. Nutr., April 1, 2005; 135(4): 933 - 937. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Friis, E. Gomo, N. Nyazema, P. Ndhlovu, H. Krarup, P. Kaestel, and K. F Michaelsen Effect of multimicronutrient supplementation on gestational length and birth size: a randomized, placebo-controlled, double-blind effectiveness trial in Zimbabwe Am. J. Clinical Nutrition, July 1, 2004; 80(1): 178 - 184. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||