Journal of Nutrition Animal Diets/Enrichment Products...

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bachmann, H.
Right arrow Articles by Grolier, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bachmann, H.
Right arrow Articles by Grolier, P.

© 2002 The American Society for Nutritional Sciences J. Nutr. 132:3616-3622, December 2002


Nutrient-Gene Interactions

Feedback Regulation of ß,ß-Carotene 15,15'-Monooxygenase by Retinoic Acid in Rats and Chickens

Heinrich Bachmann, Andrew Desbarats, Peter Pattison, Megan Sedgewick, Georges Riss, Adrian Wyss1, Nicolas Cardinault*, Christelle Duszka*, Regina Goralczyk and Pascal Grolier*

Roche Vitamins, Human Nutrition and Health, Carotenoid Group, CH-4070 Basel, Switzerland * INRA, Unité des Maladies Métaboliques, Equipe Vitamines, 63009 Clermont-Ferrand, France

1To whom correspondence should be addressed. E-mail: adrian.wyss{at}roche.com.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
ß,ß-Carotene 15,15'-monooxygenase (formerly termed ß,ß-carotene 15,15'-dioxygenase, EC 1.13.11.21) catalyzes the conversion of provitamin A carotenoids to retinal in vertebrate tissues. In the present study, we investigated whether preformed vitamin A or ß-carotene and its direct metabolites can regulate the enzyme activity in vivo. We found dose-dependent decreases in intestinal ß,ß-carotene monooxygenase activity after oral administration to rats of retinyl acetate (up to -79%), ß-carotene (up to -79%), apo-8'-carotenal (up to -56%), all-trans retinoic acid (up to -88%), and 9-cis retinoic acid (up to -67%). Liver ß,ß-carotene 15,15'-monooxygenase (ßCMOOX) activity was not affected. Apo-12'carotenal and the retinoic acid receptor (RAR) {alpha} antagonist Ro 41-5253 significantly increased the intestinal enzyme activity by 55 and 94%, respectively. When ß-carotene was administered to rats pretreated with the two cytochrome P450 (CYP) inducers, pentobarbital and naphthoflavone, the intestinal ßCMOOX activity increased by 39%. In a transcriptional study in chickens, treatment with retinoic acid resulted in low expression of the intestinal ßCMOOX. Our data suggest that retinoids and carotenoids might regulate ßCMOOX expression by a transcriptional feedback mechanism via interaction with members of the RAR family.


KEY WORDS: • ß-carotene cleavage • retinoic acid regulation • RAR{alpha} • rats • chickens


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Retinoic acid (RA)2 is a biologically active form of vitamin A that acts via nuclear hormone receptors (1Citation ), retinoic acid receptors (RAR) {alpha},ß,{gamma} and retinoid X receptors (RXR) {alpha},ß,{gamma}, to regulate cell proliferation, differentiation and morphogenesis. Although 9-cis retinoic acid (9RA) is a ligand for both RAR and RXR, the all-trans isomer (RA) has a selective affinity for RAR; 13-cis retinoic acid (13RA) has generally a low affinity for both RAR and RXR. Excessive doses of RA, as well as retinol, may be teratogenic in humans and animals, suggesting that normal development requires a careful balance of retinoids.

In vertebrate tissues, RA can be formed from retinol and retinal oxidation catalyzed by alcohol and aldehyde dehydrogenases, and specific cytochrome P450 enzymes (2Citation ). RA can also be synthesized in vivo and in vitro as a terminal product of ß-carotene metabolism (3Citation ,4Citation ). In humans, it has been estimated that provitamin A carotenoids might contribute 40–80% of the vitamin A supplies of the body (5Citation ).

The conversion of ß-carotene to vitamin A in human and animal tissues (6Citation ) is catalyzed by the enzyme ß,ß-carotene 15,15'-monooxygenase (ßCMOOX) (formerly ß,ß-carotene 15,15'-dioxygenase). Biochemical characterization suggested a dioxygenase reaction mechanism (7Citation ,8Citation ). For this reason, the enzyme was termed ß,ß-carotene 15,15'-dioxygenase (E C. 1.13.11.21) for many years. However, recent work by Leuenberger et al. (9Citation ) demonstrated that the cleavage of ß-carotene follows a monooxygenase mechanism. We therefore use the term ß,ß-carotene 15,15'-monooxygenase.

ßCMOOX has recently been cloned and characterized from chicken intestine (10Citation ), Drosophila (11Citation ), mice (12Citation –14Citation ) and human retinal pigment epithelium (15Citation ). Because ß-carotene is a symmetrical molecule, both central and excentric cleavage is possible (Fig. 1Citation ). Central cleavage yields two molecules of retinal that are either further reduced to retinol or oxidized to RA (16Citation ). Excentric cleavage yields one molecule of ß-apo-carotenal that can be oxidized to ß-apo-carotenoic acids and then shortened to RA (Fig. 1Citation ) (4Citation ,17Citation ). The recent cloning and molecular identification of the enzyme that is responsible for the excentric cleavage (18Citation ) proved the existence of both pathways in biological systems.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1 Proposed pathways from ß-carotene to retinoic acid in humans and animals. On the left side, the central cleavage pathway is depicted, leading mainly to retinol and retinyl esters. The right side shows the alternative excentric cleavage pathway. The enzyme responsible for asymmetric cleavage, ß,ß-carotene 9',10'-dioxygenase, yields apo-10'-carotenal and ß-ionone as products. The apo-carotenals are subsequently oxidized to the apo-carotenoic acids and further shortened to retinoic acid.

 
High dose ß-carotene supplementation in humans does not cause any signs of hypervitaminosis A or teratogenicity (19Citation ). Therefore, the conversion of ß-carotene to vitamin A must be tightly regulated through vitamin A homeostasis [for review see (20Citation )]. The conversion efficiency of ß-carotene to vitamin A decreases with increasing doses (21Citation ). In rats, the conversion rate, as measured by a vitamin A growth bioassay, is >50% at low doses of ß-carotene, whereas at high doses, the cleavage efficiency is <5% as measured by retinal accumulation in the liver storage test. Subsequent findings showed that the ßCMOOX activity is upregulated in rat intestine by vitamin A deficiency (22Citation ). Van Vliet et al. (23Citation ) confirmed in the same tissue that high doses of vitamin A or its precursor ß-carotene decreased enzyme activity. However, the mechanism involved in such regulation is still unclear.

The aim of the present study was to determine whether and how potential end products of ß-carotene metabolism, i.e., ß-apo-carotenals and RA, can regulate the conversion of ß-carotene to retinal in vivo. In addition, we wanted to differentiate under which conditions central or excentric cleavage pathways might occur in vivo. We also addressed the question whether activated xenobiotic metabolizing enzymes might alter ßCMOOX activity.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Materials.

Test compounds for feed, including ß-carotene formulated as water dispersible powder (ß-carotene 10% CWS, Roche Vitamins, Basel, Switzerland), vitamin A acetate, apo-8'-carotenal, apo-12'-carotenal, RA, 9RA, 13RA and the RAR{alpha} antagonist Ro 41-5253 (24Citation ,25Citation ), were from F. Hoffmann-La Roche (Basel, Switzerland). Other chemicals were purchased from Fluka or Sigma (Buchs, Switzerland). Formulated ß-carotene powder was suspended in water at 45°C for 10 min with continuous stirring to form a homogenous suspension. Other test compounds were dissolved in the smallest amount of dimethyl sulfoxide and brought to final volume with triacetin or Migliol (Merck, Darmstadt, Germany). Solutions to be applied were kept in amber ampoules at 4°C under argon for no longer than 4 d. For the ßCMOOX activity assay, crystalline all-trans ß-carotene (Roche Vitamins) was used.

Animals and diets.

Female rats of the strain Ibm:RORO, weighing 280–300 g (study 1) or 140–160 g (all other studies), were obtained from RCC (Füllinsdorf, Switzerland) and fed a vitamin A-free diet. In the studies at INRA (Clermont-Ferrand, France), female Wistar rats weighing 180–200 g were used and fed the AIN76 diet (26Citation ) containing 4.2 µmol vitamin A/kg (ICN, Orsay, France). Laying hens (20 wk old) of the strain LSL Lohmann (transcriptional study) were obtained from the Wütherich hatchery (Belp, Switzerland). All animals had free access to feed and water and were housed at controlled temperature with a 12-h light:dark cycle. The animals were maintained in accordance with the Swiss animal protection law.

The diets used (Table 1Citation ) consisted of either a commercial rodent feed low in vitamin A (Sodi2027, Kliba Mills; Kaiseraugst, Switzerland) containing ~1.6 µmol vitamin A/kg or a vitamin A–deficient rat diet (A104, Roche Vitamins). The chicken diet was (Sodi3179; Kliba Mills). To achieve a higher basal level of ßCMOOX activity, diets were either deficient or low in vitamin A.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Composition of diets fed to rats and chickens

 
Curative feeding experiments in rats.

Curative feeding and kinetic studies were conducted independently both at Roche and INRA. Rats were fed a vitamin A-free diet for ~3 wk until liver retinol was near depletion, as assessed by liver HPLC analysis of two killed rats. The rats were randomly assigned to groups. Vehicle (in the control group) and test compounds were given by oral gavage on three or four consecutive days. Rats received total doses, divided into 4 daily portions. Total amounts were 2.1 or 4.2 µmol retinyl acetate, 4.2, 8.4 or 16.8 µmol ß-carotene, 4.2, 8.4 or 16.8 µmol ß-apo-8'-carotenal; ß-apo-12'-carotenal was also given in 4.2, 8.4 or 16.8 µmol doses per rat, and RA in 16.8 or 33.6 µmol doses per rat. For the RAR{alpha} antagonist Ro 41-5253 (C28H36O5S, F. Hoffmann-La Roche), 26.1 µmol was administered per rat. The rats were killed 16–24 h after the last treatment.

ßCMOOX activity assay.

All work with carotenoids and retinoids was carried out in the absence of direct light and under nitrogen. Activity measurements were made according to the protocols of Goodman and Olson (27Citation ) with 14C-ß-carotene, or according to During et al. (28Citation ) with unlabeled ß-carotene and subsequent HPLC analysis. In the course of the work, we used both methods. In general, we found a higher specific enzyme activity with the During protocol than with the Goodman protocol. The modified During protocol was described elsewhere (12Citation ). Here the Goodman method is described in brief.

    Sample preparation. The samples of one trial were processed the same day under identical conditions. The intestines were opened lengthwise and the mucosa was scraped onto an ice-cooled glass plate with a microscope slide without thawing of the material. Mucosa (~2 g) was homogenized in a ratio of 4:1 (wt/v) phosphate buffer (0.1 mol/L potassium phosphate, pH 7.8 containing 30 mmol/L nicotinamide and 4 mmol/L MgCl2) at 0°C with 5 strokes in a glass-teflon Potter-Elvehjem homogenizer (Kontes Glass Co., Vineland, NJ). After centrifugation at 65,000 x g (Sorval centrifuge with SS-34 or SM-24 rotor; Kendro Ltd., Switzerland) for 20 min and 4°C, 6.0 mL of saturated ammonium sulfate solution was added slowly to 4 mL of the clear supernatant in an ice bath under stirring (magnet stirrer). This results in 60% saturation. After incubation on ice for 20 min, the tubes were centrifuged at 10,000 x g at 4°C for 15 min. The pellets were kept at -20°C until assaying for a longer time without loss of activity.

    Sample preparation (on assay day). To the assay buffer (0.15 mmol/L tricine, pH 8.0) 3.0 g/L of glutathione (GSH) and 0.21 g/L sodium cholate were added before use. The protein pellets were resuspended in cold assay buffer by gentle vortexing at a protein concentration of ~10 g/L. The suspension was centrifuged at 20,000x g for 10 min at 4°C, and aliquots of the supernatant were used for the incubation with the substrate.

    Substrate preparation. Before each assay, crystalline ß-carotene was purified using an Alox column; ~1.0 g of Alox (CAMAG, Muttenz, Switzerland, inactivated with 10% (w/v) water) was poured into a Pasteur pipette and washed with hexane (Fluka). According to the Goodman protocol, ~5 x 106 dpm ß-carotene [30 mCi/mg, (1.12 x 109 Bq/mg) F. Hoffmann-La Roche] was applied to the Alox column and eluted with hexane into 500 µL {alpha}-tocopherol solution (10 g/L in hexane) in a glass vial. This resulted in a 98–99% pure substrate solution. The hexane was evaporated under a gentle stream of nitrogen in a water bath of 40°C. Without crystallization of the ß-carotene, 1 mL of a 45°C prewarmed mixed-micelle solution [116 g/L sodium glycocholate (prepared from glycocholic acid and 1 mol/L sodium hydroxide to pH 7.2 and filtered trough a 0.2 µm filter), 8 g/L lecithin in water] was added under vigorous vortexing followed by sonication for 30 s. The preparation was examined for the absence of crystals.

Incubation was started by the addition of 50 µL (6.5–8 nmol) of the substrate solution into 1950 µL preincubated solution containing the protein sample (1.25 mg protein), 30 µmol nicotinamide and 6 mg GSH in 0.1 mol/L potassium phosphate buffer, pH 7.7. After 60 min of incubation at 37°C, the reaction was stopped by the addition of 1.3 mL methanol followed by 2 mL chloroform (containing 17 µg {alpha}-tocopherol, 40 µg ß-carotene and 66 µg retinal). After a thorough mixing, 200 µL of the chloroform phase was applied to a preparative TLC plate (10 x 20 cm Silica 60 with concentration zone, thickness 0.25 mm; Merck, Darmstadt, Germany) and was run in chloroform/hexane 85:15. Without drying, the faint yellow retinal band was scraped off and transferred to a scintillation vial with 10 mL of scintillation fluid (Ultima Gold, Packard BioScience, Berkshire, UK). The vial was mixed for several minutes on a Coulter mixer and radioactivity was measured in a beta-counter (TRI-CARB; Packard Instruments, Meriden, CT).

Lactate dehydrogenase (LDH) activity.

The cytosolic fraction (10 µL; freshly prepared or stored at -20°C) was diluted 1:1000 in PBS and applied to a commercial LDH assay kit (Sigma, St. Louis, MO), which was adapted to multititer plate format.

CYP induction in rats.

Phenobarbital (Sigma, Buchs, Switzerland) was dissolved in water and injected into rats on d 1 at 30 mg/kg, then at 60 mg/kg for the next 3 d; ß-naphthoflavone (Sigma) was dissolved in corn oil and given on d 3 at 80 mg/kg. On d 4, ß-carotene was administered. All applications were given intraperitoneally. The rats were killed on d 5.

HPLC analysis.

Total retinol in plasma and liver after saponification, and ß-carotene in liver were assayed by standard methods of Roche Vitamins (29Citation ). Retinoic acid in plasma was determined in the laboratory of H.K. Biesalski, University of Hohenheim, Germany, according to the method of Wyss and Bucheli (30Citation ).

Northern blot analysis.

Total RNA from duodenum and liver of laying hens was separated on 1% formaldehyde/agarose gel in 1X 3-[N-morpholino]propanesulfonic acid buffer. The RNA gel was vacuum blotted with 20X salt-sodium citrate (SSC) buffer on a Zeta-Probe membrane (Bio-Rad, Glattbrug, Switzerland) for 4 h. The membrane was crosslinked with an UV-Stratalinker (Stratagene, La Jolla, CA) and prehybridized in 50% formamide, 5X SSC, 5X Denhardt’s, 10 g/L SDS and 100 mg/L denatured herring sperm DNA for 1 h. The probe was amplified by polymerase chain reaction from the coding sequence of ßCMOOX (5' primer: 5' GGTACTTCAATTGTTGATAAAGG 3'; 3' primer: 5' TTCTGTT GCATAGACATACTTG 3') and purified over an S-400 spin column (Amersham Biosciences, Dübendorf, Switzerland). Denatured DNA (25 ng) was labeled with 50 µCi (1.85 x 106 Bq) ({gamma}-32P) dCTP [6000 Ci/mmol (1.33 x 1016 Bq/mmol), Amersham Pharmacia Biotech] using the High Prime random labeling kit from Roche Molecular Biochemicals (Mannheim, Germany). The labeled DNA probe was purified over an S-200 spin column (Amersham Biosciences). Hybridization was performed overnight at 42°C with 7.8 x 108 dpm/L. Filters were washed with 2X SSC for 15 min at room temperature, with 0.1X SSC/0.1% SDS for 15 min at room temperature, with 1X SSC, 1 g/L SDS for 15 min at 65°C and exposed overnight on X-OMAT AR (Integra Biosciences Ltd., Wallisellen, Switzerland) at -80°C with double intensifying screens.

Data analysis.

The arithmetic mean of each treatment group was compared with the control group, present in every experiment, by one-way ANOVA followed by the Bonferroni/Dunn post-hoc test using standard software (Microsoft Excel; Statview, SAS Institute, Cary, NC). Values are means ± SD.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Retinal was the only product formed from ß-carotene in the enzyme assays applied during this study. Apo-carotenals were not found after detection of enzymatic products by HPLC or in reaction mixtures with radiolabeled 14C-ß-carotene. However, when ß-carotene was incubated with an intestinal postnuclear homogenate from CYP-induced rats, we found minor traces of 8'-, 10'- and 12'-apo-carotenal, as identified by comparison with pure standards (data not shown). During the course of the work, we changed the enzyme assay from the Goodman (27Citation ) protocol with radioactive ß-carotene to the protocol published by During et al. (28Citation ). Generally, both methods give the same qualitative results, but the specific activity was markedly higher with the latter method, which resulted in better solubilization of the ß-carotene by introducing Tween 40 as detergent, and by improved retinal extraction. Cytosolic LDH activity was assessed in the duodenum as a marker for acute toxicity. It is used as a diagnostic marker for cell integrity, and it is a gene that is not regulated by RA. We found relatively high interindividual variation; however, treatments did not affect LDH activity.

ßCMOOX regulation by ß-carotene, vitamin A, ß-apo-carotenals and RA in rats.

In the control group, where liver vitamin A was reduced to <0.05 µmol retinol, the specific activity of intestinal monooxygenase was 3.72 ± 1.03 pmol retinal/(h · mg protein) (Table 2Citation ). Application of a total of 2.1 or 4.2 µmol retinyl acetate reduced specific ßCMOOX activity by 76 and 79%, respectively (P < 0.0001). Of the applied dose of retinyl acetate, most was hydrolyzed to retinol, and 53% was liver retinol. ß-Carotene, at doses of 4.2, 8.4 and 16.8 µmol reduced the specific activity of intestinal ßCMOOX by 73, 72 and 79% (P < 0.0001), respectively. Of the applied dose, 15.8, 10.9 and 6.7%, respectively, accumulated as retinol, and 0.62, 0.52 and 0.29% (data not shown), respectively, as intact ß-carotene. Serum levels of retinol and RA increased significantly after ß-carotene administration (Table 2Citation ).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Intestinal ß,ß-carotene 15,15'-monooxygenase activity (ßCMOOX) and vitamin A levels in liver and serum after curative application of different retinoids and carotenoids in rats1

 
Apo-8'-carotenal, in total doses of 4.2, 8.4 or 16.8 µmol, decreased the specific activity of intestinal ßCMOOX by 56, 54 (P < 0.005) and 15% (P = 0.34), respectively. Of the dose administered, 3.7, 2.4 and 1.3%, respectively, of the applied compound was converted to retinol and deposited in the liver. Serum RA levels were greater than in controls only in rats administered the highest dose of apo-8'-carotenal. In contrast, in the groups treated with 4.2, 8.4 or 16.8 µmol apo-12'-carotenal, ßCMOOX was not affected in rats given the two lower doses. A significant upregulation occurred only in rats administered the 16.8 µmol dose (Table 2Citation ). In liver, 0.57, 0.34 and 0.23%, respectively, of the applied doses were retinol. Serum retinol and RA increased significantly with all doses administered.

In intestinal homogenates from rats administered 16.8 or 33.4 µmol RA, ßCMOOX activity was potently reduced by 88 and 85%, respectively (P < 0.0001). This effect was likely mediated by in vivo regulation because the addition of RA, retinal or apo-12'-carotenal, up to a fivefold excess to the in vitro ßCMOOX assay, did not inhibit or activate the enzyme (data not shown). In rats treated with five daily oral applications of 5.22 µmol of the RAR{alpha} antagonist Ro 41–5253, intestinal ßCMOOX activity increased by 92%, P < 0.0001 (Table 3Citation ). Administration of 2.1 µmol 9RA decreased intestinal ßCMOOX activity 67% (Table 3Citation ), whereas ß-carotene (2.1 µmol) and 13RA (2.1 µmol) did not affect the activity under the same experimental conditions. Again, all-trans RA had the most striking effect (-74%, P < 0.001) in this series of treatments.


View this table:
[in this window]
[in a new window]
 
TABLE 3 Effect of vitamin A, ß-carotene and retinoids on ß,ß-carotene 15,15'-monooxygenase (ßCMOOX) activity in rat intestine1

 
CYP induction in rats.

ß-Carotene has not been reported to induce phase I and II xenobiotic metabolizing enzymes in rats at moderate doses (31Citation ,32Citation ). However, it is not known whether ß-carotene itself might serve as a substrate for otherwise activated CYP enzymes, and that such hypothetical metabolites might influence ßCMOOX activity. Pentobarbital and naphthoflavone treatment of rats did not affect ßCMOOX activity (Table 4Citation ). ß-Carotene alone reduced the activity of the intestinal ß-carotene 15,15'-monooxygenase compared with control rats (-44%, P < 0.001), whereas it induced ßCMOOX activity by 39% (P < 0.001) compared with xenobiotic-treated rats.


View this table:
[in this window]
[in a new window]
 
TABLE 4 Effect of ß-carotene administration on ß,ß-carotene 15,15'-monoxygenase (ßCMOOX) activity in intestine from control and phenobarbital/naphthoflavone treated-rats [(cytochrome P450 (CYP)-induced rats)]1

 
Time course of ßCMOOX regulation.

Wistar and RORO rats were killed at 0, 2, 4, 8, 24 and 48 h after receiving a single oral dose of RA (2.1 µmol/kg body) in 0.25 mL triacetin. Despite differences in strain, origin and feeding between the two assays, significant downregulation of intestinal ßCMOOX activity by RA occurred between 24 and 48 h (P < 0.05) in both studies. In liver, the enzyme activity did not differ between RA-treated rats and controls (Fig. 2Citation C). LDH activities of RA-treated and control rats did not differ (Fig. 2Citation D).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 2 Time course experiment in Wistar (panel a) and RORO (panels B-D) rats administered a single oral dose of all-trans retinoic acid. Rats were fed for 3 wk a diet with a low vitamin A content (Wistar rats) or a vitamin A-deficient diet (RORO rats, see Table 1Citation ). Values are means ± SD, n = 6. *Different from control, P < 0.05. Intestinal ß,ß-carotene 15,15'-monooxygenase activity was measured in Wistar (A) rats and (B) RORO rats over a period of 48 h. Panels c and d show liver monooxygenase and intestinal lactate dehydrogenase activities, respectively, in RORO rats.

 
ßCMOOX regulation by RA in chickens.

Possible transcriptional regulation of intestinal ßCMOOX mediated by RA was investigated in a further experiment with chickens fed a vitamin A-restricted diet for 4 wk. Northern blot analysis showed markedly lower ßCMOOX mRNA levels in RA-treated chickens compared with controls (Fig. 3Citation ). Intestinal ßCMOOX activity was also decreased by RA (-86%, P < 0.0001, Fig. 3Citation ). The RAR{alpha} antagonist Ro 41-5253 tended (P = 0.42) to increase intestinal ßCMOOX mRNA and did increase ßCMOOX activity (P < 0.05, data not shown). Liver ßCMOOX mRNA expression, and liver and lung ßCMOOX activity were not affected by RA (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 3 Transcriptional regulation of intestinal ß,ß-carotene-15,15'-monooxygenase in chickens: (A) enzymatic activity; (B) Northern blot analysis using total RNA from one chicken/group; and (C) corresponding amount of RNA loaded in each lane. All chickens were fed a low vitamin A diet. Chickens in the treatment group were given 17 µmol all-trans RA for 4 d. (A) Enzymatic activity is expressed in pmol retinal/(h · mg protein). Chickens from group 1 (n = 10) are the control group (1); chickens in group 2 (n = 5) were treated with retinoic acid (2). Values are means ± SD. *Different from control, P < 0.0001.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
In the present study we demonstrated that RA and 9RA regulate retinal biosynthesis from ß-carotene at the initial formation step (ßCMOOX) in the intestine, but not in liver, of both rats and chickens. This finding is in agreement with the observation that the biosynthesis of potent agents, which regulate cell differentiation and proliferation, is stringently controlled.

The regulation of intestinal ßCMOOX might take place at the transcriptional level, whereby RAR seem to be involved. RA downregulated the intestinal ßCMOOX mRNA expression in chickens. Additionally, RA and 9RA, which were reported to bind RAR (33Citation ), markedly reduced ßCMOOX activity in rats. Treatment with the RAR{alpha} antagonist increased ßCMOOX activity in rats and chickens. This is further evidence that RAR might be involved in a negative feedback regulation.

In the promoter of the mouse ßCMOOX gene, we found a direct repeat with a spacing of 2 nucleotides RA responsive element (TACAGGTTCAGAAGTTCAGTCC, unpublished data). Therefore, we assume that RAR and/or RXR are responsible at least in part for the regulation that occurs in the intestines of rats and chickens. The tissue specificity of ßCMOOX regulation was indicated by the fact that the liver and lung enzyme was not affected by RA. It remains to be investigated which other transcription factors are involved in this transrepression. RA has been shown to inhibit the expression of several genes by antagonizing the enhancer interaction of the transcription factor activator protein 1 (34Citation ) and CCAAT/enhancer-binding protein ß (35Citation ). Such interactions have to be further investigated for ßCMOOX.

The kinetic studies showed a decrease of enzyme activity 12–48 h after application of RA. The effect was significant after 24 h. An initial increase of ßCMOOX after 3–4 h was observed in both strains of rats tested but was not significant (P = 0.26). Liver ßCMOOX, as well as LDH activity, was not regulated, suggesting a tissue- and gene-specific regulation by RA.

Administration of both ß-carotene and vitamin A acetate to vitamin A-depleted rats increased vitamin A in liver, restored normal retinol levels in serum and, as a consequence, markedly reduced ßCMOOX activity in intestine. Moreover, these effects were apparently dose dependent. Our data strengthen those of Brubacher et al. (21Citation ) who reported conversion rates of ß-carotene to vitamin A of 50% at low doses and <5% at high doses. The importance of the vitamin A status on ßCMOOX activity in rats, which was observed the by Villard and van Vliet (22Citation ,23Citation ), was confirmed by our studies.

To further investigate the mechanism of ßCMOOX regulation, we tested the effect of feeding potential ß-carotene metabolites on ß-carotene conversion to retinal, and on the resulting vitamin A liver and serum levels. It was shown earlier that apo-12'-carotenal exhibited a lower vitamin A activity (33% of a standard vitamin A acetate) than apo-8'-carotenal (46%) (36Citation ). In our study, apo-8'-carotenal and apo-12'-carotenal showed opposite effects in terms of liver vitamin A, serum retinol and ßCMOOX activity. Apo-8'-carotenal restored the retinol serum levels in vitamin A-depleted rats, whereas those administered apo-12'-carotenal reached only 50% of normal serum retinol, and had marginally increased retinol liver stores. Apo-12'-carotenal increased ßCMOOX activity in rats fed the highest dose, whereas apo-8'-carotenal downregulated the enzyme activity, at least at the lower doses. These data indicate that apo-8'-carotenal is the better substrate for ßCMOOX than apo-12'-carotenal. At the 16.8 µmol dose, however, there was no effect of apo-8'-carotenal on ßCMOOX activity, although serum and liver retinol increased, indicating that the substrate was cleaved. Transcriptional repression by RA did not occur in this case. This might be due to a competition between the apo-carotenal and RA for the ligand binding site of RAR. This dominant negative effect prevents the transcriptional downregulation by RAR/RXR heterodimers. Apo-12'-carotenal increased the ßCMOOX activity at the highest dose, suggesting a certain antagonism of the apo-12'-carotenal or a metabolite thereof, perhaps in a way similar to that observed for the RAR{alpha} antagonist. However, because apo-12'-carotenal increased serum RA levels up to 80% of those of the retinyl acetate-treated rats, regardless of its less efficient conversion by central cleavage, RA formation by ß-oxidation may also be involved.

RA strongly inhibited intestinal ßCMOOX expression and reduced enzyme activity, but did not restore liver vitamin A because RA cannot be reduced to retinol. Thus, our data suggest that the regulation of intestinal ßCMOOX activity is not directly associated with the vitamin A levels in liver. All of the tested compounds increased the levels of RA in serum. Therefore, serum concentrations of RA might not be predictive of the observed effects.

Recently, sound evidence for the existence of a specific enzyme responsible for the excentric cleavage of ß-carotene was presented (18Citation ). Earlier, it was suggested that CYP enzymes might be involved. Thus, conditions of induced CYP systems, e.g., cigarette smoking, could alter ß-carotene metabolism. To address this question, ß-carotene was fed to rats induced by phenobarbital/naphtoflavone (37Citation ). ß-Carotene inhibited ßCMOOX in uninduced control rats, but activated the intestinal enzyme activity in CYP-induced rats nearly 50%. Two different scenarios are possible. First, CYP induction might have increased RA metabolism and tissue depletion (38Citation ). CYP26 oxidized RA at the carbon-4 position and led to more hydrophilic compounds. Therefore, clearance from the body was facilitated. Subsequently, ßCMOOX activity was increased to enhance ß-carotene cleavage. Second, CYP activation might have led to increased excentric cleavage, perhaps in combination with an antagonistic action of formed apo-carotenals on ßCMOOX transcription, via interaction with RAR. However, the latter hypothesis is less likely because we observed only traces of apo-carotenals in ßCMOOX activity assays with intestinal homogenates of CYP-induced rats. Yet, as shown in Table 2Citation , ßCMOOX activation required high amounts of apo-12'-carotenal. In conclusion, CYP activation did not change intestinal ß-carotene metabolism qualitatively, as the central cleavage pathway was upregulated.

The effective feedback regulation of RA on intestinal ßCMOOX might also be involved in vitamin A homeostasis in humans, and it might explain why excessive doses of ß-carotene do not cause hypervitaminosis A or teratogenicity. Further study of the regulation of the important vitamin A-forming enzyme, especially promoter studies, will be helpful in understanding the effects of the nutritional status on ß,ß-carotene-15,15'-monooxygenase. This might be important for populations relying on ß-carotene as their main source of vitamin A.


    ACKNOWLEDGMENTS
 
We thank M. Klaus, Preclinical Research Division, F. Hoffmann-La Roche Ltd. for the supply of the RAR{alpha}-antagonist Ro 41-5253 and K. H. Biesalski, University of Hohenheim, Stuttgart, Germany, for the RA determination in rat serum. We also thank Christopher Allington and Jennifer Bryant for their careful correction of the manuscript.


    FOOTNOTES
 
2 Abbreviation used: ßCMOOX, ß,ß-carotene 15,15'-monooxygenase; CYP, cytochrome P450; GSH, glutathione; LDH, lactate dehydrogenase; RA, all-trans retinoic acid; 9RA, 9-cis retinoic acid; 13RA, 13-cis retinoic acid, RAR, retinoic acid receptor; RXR, retinoid X receptor; SSC, salt-sodium-citrate (buffer). Back

Manuscript received 31 May 2002. Initial review completed 2 July 2002. Revision accepted 10 September 2002.


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Chambon, P. (1996) A decade of molecular biology of retinoic acid receptors. FASEB J. 10:940-954.[Abstract]

2. Duester, G. (1996) Involvement of alcohol dehydrogenase, short-chain dehydrogenase/reductase, aldehyde dehydrogenase, and cytochrome P450 in the control of retinoid signaling by activation of retinoic acid synthesis. Biochemistry 35:12221-12227.[Medline]

3. Napoli, J. L. & Race, K. R. (1988) Biogenesis of retinoic acid from beta-carotene. Differences between the metabolism of beta-carotene and retinal. J. Biol. Chem. 263:17372-17377.[Abstract/Free Full Text]

4. Wang, X. D., Tang, G. W., Fox, J. G., Krinsky, N. I. & Russell, R. M. (1991) Enzymatic conversion of beta-carotene into beta-apo-carotenals and retinoids by human, monkey, ferret, and rat tissues. Arch. Biochem. Biophys. 285:8-16.[Medline]

5. Underwood, B. A. (1994) Was the "anti-infective" vitamin misnamed? Nutr. Rev. 52:140-143.

6. Olson, J. A. (1989) Biological actions of carotenoids. J. Nutr. 119:94-95.

7. Goodman, D. S., Huang, H. S. & Shiratori, T. (1966) Mechanism of the biosynthesis of vitamin A from beta-carotene. J. Biol. Chem. 241:1929-1932.[Abstract/Free Full Text]

8. Olson, J. A. & Hayaishi, O. (1965) The enzymatic cleavage of beta-carotene into vitamin A by soluble enzymes of rat liver and intestine. Proc. Natl. Acad. Sci. U.S.A. 54:1364-1370.[Free Full Text]

9. Leuenberger, M. G., Engeloch-Jarret, C. & Woggon, W. D. (2001) The reaction mechanism of the enzyme-catalyzed central cleavage of beta-carotene to retinal. Angew. Chem. Int. Ed. Engl. 40:2613-2617.[Medline]

10. Wyss, A., Wirtz, G., Woggon, W., Brugger, R., Wyss, M., Friedlein, A., Bachmann, H. & Hunziker, W. (2000) Cloning and expression of beta, beta-carotene 15,15'-dioxygenase. Biochem. Biophys. Res. Commun. 271:334-336.[Medline]

11. von Lintig, J. & Vogt, K. (2000) Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving beta-carotene to retinal. J. Biol. Chem. 275:11915-11920.[Abstract/Free Full Text]

12. Wyss, A., Wirtz, G. M., Woggon, W. D., Brugger, R., Wyss, M., Friedlein, A., Riss, G., Bachmann, H. & Hunziker, W. (2001) Expression pattern and localization of beta, beta-carotene 15,15'-dioxygenase in different tissues. Biochem. J. 354:521-529.[Medline]

13. Redmond, T. M., Gentleman, S., Duncan, T., Yu, S., Wiggert, B., Gantt, E. & Cunningham, F. X., Jr. (2001) Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J. Biol. Chem. 276:6560-6565.[Abstract/Free Full Text]

14. Paik, J., During, A., Harrison, E. H., Mendelsohn, C. L., Lai, K. & Blaner, W. S. (2001) Expression and characterization of a murine enzyme able to cleave beta-carotene: the formation of retinoids. J. Biol. Chem. 276:32160-32168.[Abstract/Free Full Text]

15. Yan, W., Jang, G. F., Haeseleer, F., Esumi, N., Chang, J., Kerrigan, M., Campochiaro, M., Campochiaro, P., Palczewski, K. & Zack, D. J. (2001) Cloning and characterization of a human beta, beta-carotene-15,15'-dioxygenase that is highly expressed in the retinal pigment epithelium. Genomics 72:193-202.[Medline]

16. Devery, J. & Milborrow, B. V. (1994) ß-Carotene-15,15'-dioxygenase (EC 1.13.11.21) isolation reaction mechanism and an improved assay procedure. Br. J. Nutr. 72:397-414.[Medline]

17. Sharma, R. V., Mathur, S. N., Dmitrovskii, A. A., Das, R. C. & Ganguly, J. (1976) Studies on the metabolism of beta-carotene and apo-beta-carotenoids in rats and chickens. Biochim. Biophys. Acta 486:183-194.[Medline]

18. Kiefer, C., Hessel, S., Lampert, J. M., Vogt, K., Lederer, M. O., Breithaupt, D. E. & von Lintig, J. (2001) Identification and characterization of a mammalian enzyme catalyzing the asymmetric oxidative cleavage of provitamin A. J. Biol. Chem. 276:14110-14116.

19. Mathews-Roth, M. M. (1993) Carotenoids in erythropoietic protoporphyria and other photosensitivity diseases. Ann. N.Y. Acad. Sci. 691:127-138.[Medline]

20. Olson, J. A. (1994) Hypovitaminosis A: contemporary scientific issues. J. Nutr. 124:1461S-1466S.

21. Brubacher, G. B. & Weiser, H. (1985) The vitamin A activity of beta-carotene. Int. J. Vitam. Nutr. Res. 55:5-15.[Medline]

22. Villard, L. & Bates, C. J. (1986) Carotene dioxygenase (EC 1.13.11.21) activity in rat intestine: effects of vitamin A deficiency and of pregnancy. Br. J. Nutr. 56:115-122.[Medline]

23. van Vliet, T., van Vlissingen, M. F., van Schaik, F. & van den Berg, H. (1996) ß-Carotene absorption and cleavage in rats is affected by the vitamin A concentration of the diet. J. Nutr. 126:499-508.

24. Eckhardt, K. & Schmitt, G. (1994) A retinoic acid receptor alpha antagonist counteracts retinoid teratogenicity in vitro and reduced incidence and/or severity of malformations in vivo. Toxicology 70:299-308.

25. Lamour, F. P., Lardelli, P. & Apfel, C. M. (1996) Analysis of the ligand-binding domain of human retinoic acid receptor alpha by site-directed mutagenesis. Mol. Cell. Biol. 16:5386-5392.[Abstract]

26. Bieri, G. S., Briggs, G. M., Phillips, R. W., Woodard, J. C. & Knapka, J. J. (1977) Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J. Nutr. 107:1340-1348.

27. Goodman, D. S. & Olson, J. A. (1969) The conversion of all-trans ß-carotene into retinal. Methods Enzymol. 15:462-475.

28. During, A., Nagao, A., Hoshino, C. & Terao, J. (1996) Assay of beta-carotene 15,15'-dioxygenase activity by reverse-phase high-pressure liquid chromatography. Anal. Biochem. 241:199-205.[Medline]

29. Aebischer, C. P., Schierle, J. & Schuep, W. (1999) Simultaneous determination of retinol, tocopherols, carotene, lycopene, and xanthophylls in plasma by means of reversed-phase high-performance liquid chromatography. Methods Enzymol. 299:348-362.[Medline]

30. Wyss, R. & Bucheli, F. (1997) Determination of endogenous levels of 13-cis-retinoic acid (isotretinoin), all-trans-retinoic acid (tretinoin) and their 4-oxo metabolites in human and animal plasma by high-performance liquid chromatography with automated column switching and ultraviolet detection. J. Chromatogr. B 700:31-47.

31. Gradelet, S., Leclerc, J., Siess, M. H. & Astorg, P. O. (1996) ß-Apo-8'-carotenal, but not ß-carotene, is a strong inducer of liver cytochromes P4501A1 and 1A2 in rat. Xenobiotica 26:909-919.[Medline]

32. Jewell, C. & O’Brien, N. M. (1999) Effect of dietary supplementation with carotenoids on xenobiotic metabolizing enzymes in the liver, lung, kidney and small intestine of the rat. Br. J. Nutr. 81:235-242.[Medline]

33. Allenby, G., Bocquel, M. T., Saunders, M., Kazmer, S., Speck, J., Rosenberger, M., Lovey, A., Kastner, P., Grippo, J. F. & Chambon, P., et al (1993) Retinoic acid receptors and retinoid X receptors: interactions with endogenous retinoic acids. Proc. Natl. Acad. Sci. U.S.A. 90:30-34.[Abstract/Free Full Text]

34. Fanjul, A., Dawson, M. I., Hobbs, P. D., Jong, L., Cameron, J. F., Harlev, E., Graupner, G., Lu, X. P. & Pfahl, M. (1994) A new class of retinoids with selective inhibition of AP-1 inhibits proliferation. Nature (Lond.) 372:107-111.[Medline]

35. Elizondo, G., Corchero, J., Sterneck, E. & Gonzalez, F. J. (2000) Feedback inhibition of the retinaldehyde dehydrogenase gene ALDH1 by retinoic acid through retinoic acid receptor alpha and CCAAT/enhancer-binding protein beta. J. Biol. Chem. 275:39747-39753.[Abstract/Free Full Text]

36. Bauernfeind, J. C. (1972) Carotenoid vitamin A precursors and analogs in foods and feeds. J. Agric. Food Chem. 20:456-473.

37. Masaki, R., Matsuura, S. & Tashiro, Y. (1984) A biochemical and electron microscopic study of changes in the content of cytochrome P-450 in rat livers after cessation of treatment with phenobarbital, beta-naphtoflavone or 3-methylcholanthrene. Cell 9:53-66.

38. Lampen, A., Meyer, S., Arnhold, T. & Nau, H. (2000) Metabolism of vitamin A and its active metabolite all-trans-retinoic acid in small intestinal enterocytes. J. Pharmacol. Exp. Ther. 295:979-985.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
FASEB J.Home page
W. C. Leung, S. Hessel, C. Meplan, J. Flint, V. Oberhauser, F. Tourniaire, J. E. Hesketh, J. von Lintig, and G. Lietz
Two common single nucleotide polymorphisms in the gene encoding {beta}-carotene 15,15'-monoxygenase alter {beta}-carotene metabolism in female volunteers
FASEB J, April 1, 2009; 23(4): 1041 - 1053.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Seino, T. Miki, H. Kiyonari, T. Abe, W. Fujimoto, K. Kimura, A. Takeuchi, Y. Takahashi, Y. Oiso, T. Iwanaga, et al.
Isx Participates in the Maintenance of Vitamin A Metabolism by Regulation of {beta}-Carotene 15,15'-Monooxygenase (Bcmo1) Expression
J. Biol. Chem., February 22, 2008; 283(8): 4905 - 4911.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. Zaripheh, T. Y. Nara, M. T. Nakamura, and J. W. Erdman Jr.
Dietary Lycopene Downregulates Carotenoid 15,15'-Monooxygenase and PPAR-{gamma} in Selected Rat Tissues
J. Nutr., April 1, 2006; 136(4): 932 - 938.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. R. Chichili, D. Nohr, M. Schaffer, J. von Lintig, and H. K. Biesalski
{beta}-Carotene Conversion into Vitamin A in Human Retinal Pigment Epithelial Cells
Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3562 - 3569.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. Wyss
Carotene Oxygenases: A New Family of Double Bond Cleavage Enzymes
J. Nutr., January 1, 2004; 134(1): 246S - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. L. Lemke, S. R. Dueker, J. R. Follett, Y. Lin, C. Carkeet, B. A. Buchholz, J. S. Vogel, and A. J. Clifford
Absorption and retinol equivalence of {beta}-carotene in humans is influenced by dietary vitamin A intake
J. Lipid Res., August 1, 2003; 44(8): 1591 - 1600.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bachmann, H.
Right arrow Articles by Grolier, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bachmann, H.
Right arrow Articles by Grolier, P.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2002 by American Society for Nutrition