Journal of Nutrition OpenSOurce Diets- www.ResearchDiets.com

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prpic, V.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prpic, V.
Right arrow Articles by Gettys, T. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Dietary Fats
*Obesity

© 2002 The American Society for Nutritional Sciences J. Nutr. 132:3325-3332, November 2002


Nutrient-Gene Interactions

Adaptive Changes in Adipocyte Gene Expression Differ in AKR/J and SWR/J Mice during Diet-Induced Obesity1

Veronica Prpic, Patricia M. Watson*, Isabell C. Frampton*, Mark A. Sabol, G. Eric Jezek and Thomas W. Gettys2

Pennington Biomedical Research Center, Baton Rouge, LA and * Departments of Medicine, Medical University of South Carolina, Charleston, SC

2To whom correspondence should be addressed. E-mail: gettystw{at}pbrc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Obesity-prone (AKR/J) and obesity-resistant (SWR/J) mice were weaned onto low (LF) or high fat (HF) diets to identify adaptive changes in adipocyte gene expression that are associated with differences between the strains in fat deposition. Food consumption was monitored at weekly intervals and all mice were evaluated after consuming their respective diets for 4 wk for analysis of mRNA levels of selected metabolic genes. Despite similar food consumption, body weight and fat deposition were significantly greater in AKR/J than in SWR/J mice, and this difference was greatly accentuated by the HF diet. The HF diet produced distinct differences between strains in gene expression patterns among fat depots. In AKR/J mice, UCP1 mRNA was decreased 10-fold in interscapular brown adipose tissue (BAT) and four- to fivefold in retroperitoneal and inguinal white adipose tissue (WAT). The HF diet also decreased PGC-1 and ß3-adrenergic receptor mRNA by two- and ninefold in BAT from AKR/J mice. In contrast, the HF diet either increased uncoupling protein (UCP)1 in BAT or had no effect on expression of these genes in adipose tissues from SWR/J mice. UCP2 mRNA was fourfold higher in WAT from AKR/J compared with SWR/J mice and increased by an additional twofold in WAT from AKR/J mice fed the HF diet. UCP2 was unaffected by diet in SWR/J mice. These studies show that the diet-induced obesity of AKR/J mice is characterized by increased metabolic efficiency and is associated with changes in adipocyte gene expression that limit the adaptive thermogenic response to increased energy density.


KEY WORDS: • uncoupling proteins • adipose tissue • adaptive thermogenesis • mice


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Mouse models of obesity have been used extensively to study the various signaling pathways that regulate the deposition of fat. Models based on single gene mutations (ob/ob, db/db) have advanced our understanding of the role of specific proteins, whereas polygenic models have provided insights into the mechanistic details that predispose or limit the development of diet-induced obesity. Comparing mouse strains that are resistant or prone to dietary obesity serves the dual purpose of illustrating the molecular adaptations that prevent obesity and identifying genes that become dysregulated by high fat diets. The A/J and C57BL/6J mouse strains are widely used examples of obesity-resistant and obesity-prone strains, and the consensus from several studies is that C57BL/6J mice deposit significantly more fat than A/J mice although they consume similar amounts of food (1Citation ,2Citation ). Recent findings support the conclusion that A/J mice resist dietary obesity by mounting a more robust adaptive thermogenic response than C57BL/6J mice when given high fat diets (2Citation –4Citation ).

In the present study, we employed an additional but less well-studied pair of mouse strains (AKR/J and SWR/J) that differ widely in their susceptibility to dietary obesity. These two strains have been used primarily in macronutrient selection studies in which the propensity to obesity of the AKR/J strain is accentuated by its preference for fat when given a choice (5Citation ,6Citation ). In this experimental system, the SWR/J mice select primarily carbohydrate, and the cumulative difference in energy intake favors AKR/J mice by ~30% and accentuates the strain difference in fat deposition. Our goal was to evaluate AKR/J and SWR/J mice in an experimental paradigm using low and high fat diets to test whether their differing susceptibilities to obesity are associated with patterns of metabolic and genetic adaptive responses comparable to the C57BL/6J and A/J models of diet-induced obesity. Using AKR/J and SWR/J mice weaned onto low and high fat diets, we show strain-specific adaptations to the high fat diet that influence fat deposition through changes in metabolic efficiency and gene expression profiles that are consistent with decreased adaptive thermogenic potential.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Materials.

EDTA, sodium cholate, Triton X-100, bovine serum albumin (BSA),3 guanidinium thiocyanate, TES, sucrose, and other common chemicals were from Sigma Chemical (St. Louis, MO). T1-RNase and Trizol LS Reagent were from Life Technologies (Gaithersburg, MD). T7 RNA polymerase, SP6 RNA polymerase, Taq DNA polymerase, MMLV reverse transcriptase (RT), and the pGEM-3Z cloning vector were from Promega (Madison, WI). Taq DNA polymerase for quantitative real-time polymerase chain reaction (PCR) was obtained from Takara Suzo (Shiga, Japan). The T7-Megashortscript kit was purchased from Ambion, (Austin, TX). 2-Mercaptoethanol was acquired from J. T. Baker, (Phillipsburg, NJ). The selective ß3-adrenergic receptor agonist, CL316,243 was a gift from Wyeth Ayerst Research (Princeton, NJ). Oligonucleotide primers were prepared by Ransom Hill Bioscience (Ramona, CA). {alpha}-[32P]-CTP was purchased from Dupont NEN Radiochemicals (Boston, MA). The semipurified diets were manufactured by Research Diets (New Brunswick, NJ) as described in detail previously (1Citation ,7Citation ,8Citation ). The low fat diet (D12329) contained 4.8, 16.8 and 74.3 g/100 g from fat, protein and carbohydrate, respectively whereas the high fat diet (D12331) contained 35.8, 23.0 and 35.5 g/100 g from fat, protein and carbohydrate, respectively. The fat sources for the diets were coconut and soybean oils. The diets contained the same amount of soybean oil (1.83 g/100 g diet); however, the low fat diet contained 2.93 g of coconut oil/100 g diet, whereas the high fat diet contained 33.34 g of coconut oil/100 g diet. The protein source was primarily casein supplemented with DL-methionine (0.15 g/100 g). Carbohydrate was provided as a mixture of maltodextrin 10 and sucrose and the fiber source was cellulose. Minerals and vitamins were added to each diet according to the AIN76A standard (9Citation ). Male AKR/J and SWR/J mice were obtained at weaning from Jackson Laboratories (Bar Harbor, ME).

Experimental animal protocol.

    Experiment 1. Male SWR/J and AKR/J mice (n = 40) were obtained at 3 wk of age and eight mice of each strain were killed 1 d after arrival. The remaining mice of each strain were randomly assigned to groups of six to receive either the low (LF) or high-fat (HF) diet for 4 wk. Mice were housed in standard cages with bedding (2 mice/cage) in a controlled animal facility at 23°C on a 12-h light:dark cycle. They consumed food and water ad libitum. The diet stocks were refrigerated at 4°C; to ensure palatability, fresh preweighed diet was provided twice per week. After the second provision of fresh diet each week, food consumption, corrected for spillage, was determined for each group over a 24-h period spanning a full light:dark cycle. Body weights were recorded in the morning at 3 to 4 d intervals throughout the study. All mice were killed by cervical dislocation at the end of wk 4 after 2–3 h of food deprivation, and epididymal white adipose tissue (WAT), inguinal WAT, retroperitoneal WAT and interscapular brown adipose tissue (BAT), were removed and carefully dissected to remove connective tissue for isolation of total RNA.

    Experiment 2. Twelve mice of each strain were obtained at 3 wk of age and weaned onto the HF diet described above. After 4 wk of consuming the HF diet, half the mice from each strain received intraperitoneal injections of vehicle or CL316,243 [1 µg/d · g body)] for 3 d. The mice were killed 2 h after injection on the morning of d 3 and tissues were harvested as described above for isolation of total RNA.

Preparation of RNA.

After dissection, the interscapular, epididymal, retroperitoneal and inguinal fat pads were homogenized with Trizol LS Reagent using an Ultraturax (Tekmar, Cincinnati, OH) according to the manufacturer’s specifications. Total RNA was isolated, purified and treated with DNAase as described (10Citation ).

Ribonuclease protection assay.

mRNA levels for UCP1, UCP2 and the ß3-adrenergic receptor 3-AR) were measured by ribonuclease protection assays as previously described (2Citation ,10Citation ,11Citation ). A riboprobe for mouse PGC-1 was generated by RT-PCR with RNA from mouse intrascapular BAT using specific primers (5'-3': F, GAACTAAGGGATGGCGACTT; R, CCTTATACCACTAGCCCTTG). The PGC1 RT-PCR fragment was purified and cloned into the pGEM-3Z riboprobe vector containing transcriptional start sites 5' and 3' to the multiple cloning site (Promega). The PGC-1 probe corresponded to nucleotides 1535–1840 upon sequencing of the cloned fragment. Templates were purchased from Ambion for the 18S and ß-actin probes. RNA probes complementary to our target genes were labeled and hybridized with unknown samples and known amounts of sense strand standard. Detected bands were quantitated by scanning laser densitometry and standardized to the amount of 18S rRNA in each sample. Estimated concentrations of each mRNA were then determined by reverse calibration from standard curves generated from the known amounts of sense strand standard included in each assay (2Citation ,11Citation ).

Quantitative real-time PCR.

In some experiments, real-time PCR (Cepheid Smart Cycler, Sunnyvale, CA) was used to measure UCP1, PGC-1, ß3-AR, leptin and cyclophilin mRNA expression in samples in which recovered RNA was limiting. To produce standards for each assay, primers for each gene were used to produce substantial amounts of each cDNA fragment by PCR. The gene fragments were then purified, sequenced, quantitated by measuring Abs260/280 and serially diluted to construct standard curves for each gene. The slope of the standard curves for cyclophilin, UCP1, PGC-1, ß3-AR and leptin, relating log mass of each cDNA to cycle threshold, did not differ from the expected -3.3 in each case. In addition, dilutions of unknown cDNA samples produced changes in cycle thresholds that paralleled the standard curves. Pilot experiments established the amount of reverse-transcribed RNA required for each gene and tissue type to place cycle thresholds for unknown samples in the middle portion of standard curves. In the assay proper, duplicate dilutions of each standard and unknown sample were amplified with the appropriate primer and probe sets and the mass of mRNA in unknown samples was estimated from standard curves relating cycle threshold to mass of each standard. Cyclophilin standard curves were used to determine the mass of this housekeeping gene in each sample; after correction for cyclophilin mRNA differences, target gene mRNA levels were expressed as fmol/µg total RNA for analysis.

Methods of analysis.

Group means for estimated mRNA concentrations for each gene and fat pad weights were analyzed using a one-way ANOVA, whereas food consumption and growth data were analyzed using a three-way ANOVA with strain, diet, and time as the main effects. The strain x diet x time interaction was tested using the residual variance (animal within strain x diet x week) as the error term, and in the absence of such interactions, subsequent analyses were conducted to evaluate the basis for differences in the response of each strain to the diets, averaged over time. Post-hoc testing of group means was made with the Bonferroni correction using the pooled error term to calculate standard errors. Protection against Type I errors was set at 5%.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Effect of high fat diet on growth and food consumption.

Body weights of mice within each strain did not differ at weaning but diverged within the first few days of the study (Fig. 1Citation ). For example, AKR/J mice fed the HF diet rapidly increased body weight after weaning and were significantly heavier than all other mice after 1 wk (Fig. 1)Citation . This difference became greater as the study progressed, and after 4 wk of consuming the HF diet, AKR/J mice were ~14 g heavier than SWR/J mice (Fig. 1)Citation . The strain difference in body weight accretion reflects a combination of rapid growth by AKR/J mice and a total resistance of SWR/J mice to the obesity-promoting effects of the HF diet. Examination of SWR/J mice over time revealed that at no point during the study did body weights of HF-fed mice exceed those of the LF-fed controls (Fig. 1)Citation . SWR/J mice consuming both diets gained a total of ~6–7 g over the 4-wk period, whereas AKR/J mice consuming the HF diet gained ~21 g. The AKR/J mice consuming the LF diet had an intermediate weight gain of 13 g during the 4-wk study (Fig. 1)Citation .



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1 Changes in body weight over time in male AKR/J and SWR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Values are mean ± SEM, n = 12. Most standard errors are smaller than the height of the symbol. Differences between AKR/J mice consuming LF and HF diets are indicated by an asterik (P < 0.05), and differences between AKR/J mice consuming LF diet and SWR/J mice consuming either diet are indicated by a pound symbol (P < 0.05).

 
The basis for the differential weight gains was evaluated by comparing energy intake among the strain by diet combinations on the basis of the energy contents of the two diets at each time point. Initial analysis of energy intake using a three-way ANOVA provided no evidence of a strain x diet x time interaction; thus, our interest shifted to a potential difference in the way each strain responded to different energy densities (i.e., strain x diet interaction). Using energy intake averaged across all time points, ANOVA revealed a strain x diet interaction (P < 0.05). The basis of the interaction stemmed from the greater energy consumption by AKR/J than the SWR/J mice fed the HF diet (P < 0.05) and the lack of difference in energy consumption between AKR/J and SWR/J mice fed the LF diet (Fig. 2Citation ). Interestingly, there was no effect of diet within mouse strain because energy intake did not differ between SWR/J mice fed the two diets or between AKR/J mice fed the two diets (Fig. 2)Citation . This result permitted pooling the degrees of freedom from the two diets to test whether food consumption averaged across diet differed between the strains. We found that energy consumption over the duration of the study was higher in AKR/J than in SWR/J mice (P < 0.05). To test the hypothesis that the strain differences in food consumption were related to differences in body weight, energy intake was compared after correction for differences in body weight. This data transformation removed all strain x diet interactions and revealed that energy intake per unit body weight did not differ among the groups at any time during the study (data not shown). It is worth noting that energy intake per unit body weight decreased at a uniform rate over time in the four groups. This was due to the relatively constant energy intake within each group during the 4 wk of the study and the gradual increases in body weight over this period.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 2 Energy intakes of male AKR/J and SWR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Values are mean ± SEM, n = 12 and represent mean food consumption over the 4-wk period of study. Strain differences in energy intake of each diet are indicated by an asterik (P < 0.05).

 
Strain differences in fat deposition were evaluated by comparing the weight of epididymal, retroperitoneal and inguinal fat pads after 4 wk of consuming the respective diets. The epididymal and retroperitoneal fat pads of mice consuming the LF diet were three- to fourfold heavier in AKR/J than SWR/J mice (P < 0.05), whereas the inguinal pad size did not differ between the strains (Table 1Citation ). The HF diet did not increase the weight of the three fat pads in SWR/J mice (Table 1)Citation . In contrast, it resulted in a two- to threefold increase (P < 0.05) in fat pad weights of AKR/J mice compared with LF diet-fed controls (Table 1)Citation . This difference in fat accretion between strains was most evident in comparisons between mice consuming the HF diet where epididymal, retroperitoneal and inguinal pad weights were 5.7-, 4- and 2-fold greater, respectively, in AKR/J than SWR/J mice (P < 0.05, Table 1Citation ). Considered together, differences in energy intake did not completely account for the strain and diet-specific changes in growth and fat deposition among the groups.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Weights of epididymal, retroperitoneal, and inguinal white adipose tissue (WAT) depots of Male SWR/J and AKR/J mice fed low or high fat diets for 4 wk1

 
Brown adipose tissue gene expression.

The hypothesis that changes in dietary energy density generated different adaptive thermogenic responses in AKR/J and SWR/J mice was evaluated by first comparing UCP1 mRNA in BAT from weanling mice. The objective in evaluating this time point was to rule out initial strain differences that would confound assessment of subsequent dietary effects. No differences in UCP1 mRNA were detected between the strains at this initial time point (data not shown). However, changes in UCP1 mRNA did become evident in the 4 wk after weaning, primarily due to the difference in the response of the two strains to the HF diet (Fig. 3ACitation ). UCP1 mRNA levels did not differ between AKR/J (3.4 ± 0.3 fmol/µg RNA) and SWR/J (2.6 ± 0.3 fmol/µg RNA) mice after 4 wk of consuming the LF diet (Fig. 3Citation A). However, the HF diet increased (P < 0.05) UCP1 mRNA to 5.3 ± 0.2 fmol/µg RNA in SWR/J mice, whereas in the AKR/J mice, UCP1 mRNA decreased to 0.6 ± 0.1 fmol/µg RNA (P < 0.05, Fig. 3Citation A). In addition to using 18S rRNA to correct for differences in RNA among the samples (see Fig. 3Citation A), we also probed BAT RNA samples for ß-actin mRNA, and found that this housekeeping gene was expressed at comparable levels in the four groups (Fig. 3Citation B). We also examined UCP1 mRNA expression in these samples by quantitative real-time PCR, and the estimated concentrations of UCP1 message among the samples were reasonably close to estimates obtained by ribonuclease protection assays. The only difference was in the magnitude of the decrease in UCP1 mRNA levels attributed to the HF diet in AKR/J mice (LF, 1.455 ± 0.367 fmol/µg RNA; HF, 0.199 ± 0.079 fmol/µg RNA), where we found a larger effect by quantitative real-time PCR (7.3- vs. 5.7-fold). Considered together, the data showed that SWR/J mice responded to the HF diet with a modest increase in BAT UCP1 mRNA whereas in AKR/J mice, the HF diet produced a large decrease in UCP1 expression (Fig. 3Citation A).



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 3 Ribonuclease protection assay of UCP1 mRNA and 18S rRNA (A) and actin mRNA (B) in 1 µg of total RNA from interscapular BAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 
Given its role in coordinating expression of mitochondrial genes linked to energy expenditure, we also examined expression of the transcriptional coactivator, PGC-1, to determine whether it responded to the HF diet in a manner similar to UCP1. Interestingly, PGC-1 mRNA was nearly twofold higher in BAT from AKR/J mice consuming the LF diet (0.021 ± 0.002 fmol/µg RNA) compared with SWR/J mice (0.012 ± 0.001 fmol/µg RNA) consuming the same diet (P < 0.05, Fig. 4ACitation ). In a manner similar to UCP1 mRNA, the HF diet increased PGC-1 mRNA in BAT of SWR/J mice to 0.019 ± 0.001 fmol/µg RNA while decreasing it in AKR/J mice to 0.012 ± 0.001 fmol/µg RNA (P < 0.05, Fig. 4Citation A). The relative changes in PGC-1 mRNA were consistent with the differences in UCP1 among the groups, although the magnitude of decrease in PGC-1 mRNA in AKR/J mice consuming the HF diet was substantially less (Figs. 3Citation A and 4Citation A).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4 Ribonuclease protection assay of PGC-1 mRNA (A) or ß3-adrenergic receptor mRNA (B) in 5 µg of total RNA purified from interscapular BAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 
Because the ß3-AR mediates many of the effects of sympathetic stimulation of BAT, it plays a central role in mediating the effects of sympathetic regulation of PGC-1 and UCP1. Therefore, we compared ß3-AR mRNA among the groups to determine whether decreased receptor expression could account for strain differences in UCP1 and PGC-1 induction. ß3-AR mRNA appeared to be higher in BAT from AKR/J mice consuming the LF diet (0.103 ± 0.019 fmol/µg RNA) compared with SWR/J mice (0.061 ± 0.010), but the relatively large standard errors precluded detection of this difference (P < 0.05 fmol/µg RNA). As observed with PGC-1 and UCP1, the HF diet down-regulated ß3-AR in BAT from AKR/J mice to 0.015 ± 0.003 fmol/µg RNA (P < 0.05, Fig. 4Citation B). In contrast, ß3-AR mRNA levels were not reduced by the HF diet in SWR/J mice (Fig. 4Citation B). Collectively, these results suggest that strain-specific responses to the HF diet may have altered the ability of BAT to respond to sympathetic stimulation and increase thermogenic capacity.

WAT gene expression.

Obesity-resistant mouse strains can respond to sympathomimectics with an increase in UCP1 expression in specific white fat pads such as the retroperitoneal or inguinal depots (12Citation ,13Citation ), and resistance to obesity may be associated with diet-induced upregulation of UCP2 in WAT (4Citation ). To test the hypothesis that strain-specific differences in responses to HF diets extended to WAT and involved either UCP1 or UCP2, we examined expression of these two genes among several WAT depots. UCP2 mRNA was fourfold higher (P < 0.05) in epididymal WAT from AKR/J mice (0.152 ± 0.04 fmol/µg RNA) consuming the LF diet compared with SWR/J mice consuming the same diet (0.042 ± 0.007 fmol/µg RNA) (Fig. 5Citation ). UCP2 mRNA expression was unaffected by the HF diet in SWR/J mice (0.052 ± 0.005 fmol/µg RNA) but was increased almost twofold (P < 0.05) by the HF diet in AKR/J mice (0.258 ± 0.005 fmol/µg RNA). An almost identical pattern of strain and dietary effects on UCP2 expression occurred in inguinal WAT of AKR/J and SWR/J mice (data not shown). Comparison of UCP2 mRNA in skeletal muscle showed no differences between strain and no effects of diet in this tissue (data not shown). These results show that UCP2 was consistently higher in WAT from obesity-prone AKR/J than in obesity-resistant SWR/J mice and induced by the HF diet in AKR/J but not SWR/J mice.



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 5 Ribonuclease protection assay of UCP2 mRNA and 18S rRNA in 2 µg of total RNA from epididymal WAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 
On the basis of its role in regulating energy expenditure and adipocyte gene expression, we examined leptin mRNA expression in inguinal WAT and found no difference in mRNA levels between the strains consuming the LF diet (AKR/J LF, 0.018 ± 0.014 fmol/µg RNA; SWR/J LF, 0.011 ± 0.005 fmol/µg RNA). The HF diet did not increase leptin mRNA in either strain (AKR/J HF, 0.028 ± 0.013 fmol/µg RNA; SWR/J HF, 0.014 ± 0.003 fmol/µg RNA), and the large standard errors attached to mean estimates precluded detection of strain differences for either diet. When considered relative to the differences in fat pad sizes between the strains (Table 1)Citation , these findings show that leptin expression per unit of adipose tissue was disproportionately lower in AKR/J than SWR/J mice.

To evaluate the possibility that induction of UCP1 in WAT was a component of the differential response of AKR/J and SWR/J to HF diets, we compared UCP1 mRNA levels in inguinal and retroperitoneal WAT from each group. AKR/J and SWR/J mice consuming the LF diet expressed substantial but similar levels of UCP1 mRNA in their retroperitoneal fat pads (Fig. 6Citation ). The HF diet did not alter UCP1 mRNA expression in SWR/J mice, but decreased UCP1 mRNA levels from 0.229 ± 0.04 fmol/µg RNA to 0.061 ± 0.001 fmol/µg RNA (P < 0.05). Although UCP1 mRNA was expressed at lower levels in inguinal WAT, the strain and diet effects followed the same pattern as in the retroperitoneal depot. For example, UCP1 mRNA levels did not differ between AKR/J (0.035 ± 0.007 fmol/µg RNA) and SWR/J mice (0.020 ± 0.006 fmol/µg RNA) fed the LF diet (Fig. 7Citation ). The HF diet had no effect on UCP1 expression in SWR/J mice (0.013 ± 0.004 fmol/µg RNA) but decreased UCP1 mRNA (P < 0.05) by fivefold (0.007 ± 0.001 fmol/µg RNA) in inguinal WAT of AKR/J mice. Together, these data show that the HF produced completely different responses in WAT with respect to UCP1, producing little or no change in expression in SWR/J mice but compromising mRNA levels in WAT from obesity-prone AKR/J mice.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 6 Ribonuclease protection assay of UCP1 mRNA and 18S rRNA in 5 µg of total RNA from retroperitoneal WAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 7 Ribonuclease protection assay of UCP1 mRNA and 18S rRNA in 5 µg of total RNA purified from inguinal WAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 
To rule out the possibility that consumption of the HF diet compromised the ability of adipose tissue to respond to sympathetic stimulation in a strain-specific manner, an additional experiment was conducted using the ß3-AR agonist, CL316,243, to assess this question directly. Mice of each strain were treated with CL316,243 after consumption of the HF diet for 4 wk. Both strains responded with 10- to 20-fold increases in UCP1 mRNA in retroperitoneal WAT (Fig. 8Citation ). The ß3-AR agonist also increased UCP1 mRNA in BAT, although the magnitude of the effect in both strains was smaller (data not shown). This is important because of the previous observation that the HF diet selectively reduced ß3-AR mRNA in BAT of AKR/J mice (Fig. 4Citation B). The HF diet also reduced ß3-AR mRNA in WAT of AKR/J mice from 4.43 ± 0.44 fmol/µg RNA to 2.48 ± 0.18 fmol/µg RNA (P < 0.05), but in neither tissue did the decrease in ß3-AR diminish the ability of the tissue to respond to CL316,243. Collectively, these findings show that the HF diet did not compromise the ability of BAT or WAT to respond to a maximal dose of CL316,2343 and initiate signaling responses in either mouse strain.



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 8 Ribonuclease protection assay of UCP1 mRNA and 18S rRNA in 5 µg of total RNA purified from retroperitoneal WAT of male SWR/J and AKR/J mice fed low (LF) or high fat (HF) diets for 4 wk after weaning. Thereafter, retroperitoneal WAT was harvested from each mouse after either intraperitoneal injection of vehicle or CL316,243 [1 µg/(g body · d)] for 3 d. Individual RNA samples from each mouse were analyzed to test for group differences and representative samples are presented.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Chronic energy intake in excess of that required for maintenance energy requirements results in accumulation of body fat and ultimately, obesity, but in most cases, these two components are balanced and energy homeostasis is maintained. Alteration of either component has the potential to affect long-term energy balance; in A/J and C57BL/6J mice, therefore, strain differences in fat deposition that occur at common rates of energy intake suggest differences in metabolic efficiency (1Citation ,2Citation ). Results from the present study are more complicated in the sense that differences in fat deposition between AKR/J and SWR/J mice can be explained in part by differences in energy intake. For instance, AKR/J mice consuming the HF diet consumed more energy than SWR/J mice consuming either the LF or HF diet. Nevertheless, this overall modest difference in energy intake is unlikely to account fully for the five- to ten-fold difference in fat deposition between AKR/J and SWR/J mice consuming the HF diet. Differences in energy intake between AKR/J and SWR/J mice consuming the LF diet were not evident, yet AKR/J mice deposited three- to fourfold more fat than SWR/J mice. Together, these two findings support the argument that metabolic efficiency differs between the strains. Direct measurements of metabolic rate with doubly labeled H2O also support this conclusion by showing that energy expenditure is higher in SWR/J than AKR/J mice (14Citation ).

Another important issue is the strain difference in response to the HF diets. For instance, energy intake did not differ between AKR/J mice consuming the LF and HF diets, but fat deposition was two- to threefold higher in mice consuming the HF diet in each of the depots examined. In contrast, fat deposition was unaffected by diet in SWR/J mice, as was energy intake. These results imply that the ability of SWR/J mice to resist diet-induced obesity stemmed from their ability to adjust food intake to account for the increase in energy density in conjunction with the failure of the HF diet to alter metabolic efficiency in these mice. Energy consumption also did not differ between AKR/J mice consuming the two diets, but despite this similarity, fat deposition was significantly higher in AKR/J mice consuming the HF diet. This suggests that the HF diet enhanced fat deposition by increasing metabolic efficiency in AKR/J mice (15Citation ). Considered together, strain and diet-induced differences in efficiency of energy use for maintenance appear to be the primary basis for the differences in fat deposition among groups. Strain and diet-induced differences in metabolic efficiency may be related to changes in gene expression, which compromise or enhance the functionality of energy-dissipating mechanisms. Initial studies with obesity-resistant A/J mice reported that HF diets induced expression of UCP2 mRNA in WAT, prompting the authors to suggest that UCP2 may be a key gene in the control of metabolic efficiency (16Citation ). Genetic mapping of UCP2 to a region of chromosome 7 linked to obesity and Type II diabetes complemented this observation and prompted further investigation of the effect of diet in inducing UCP2 among mouse strains known to vary in their resistance to obesity (17Citation ). Subsequent studies found that UCP2 was induced by the HF diet only in WAT of obesity-resistant mouse strains (2Citation ,4Citation ), suggesting that UCP2 was a component of the adaptive thermogenic response. We investigated the general applicability of this hypothesis in the current study and found that UCP2 mRNA was fourfold lower in WAT from obesity-resistant SWR/J mice and unaffected by the HF diet. In AKR/J mice, the HF diet induced an additional twofold increase in UCP2 mRNA to levels that were sixfold higher than in SWR/J mice fed either diet. Thus, in these two strains of mice, we found no evidence to support the contention that UCP2 conveys resistance to diet-induced obesity. Moreover, the factors linking consumption of HF diets to induction of UCP2 mRNA in WAT of obesity-resistant A/J mice (4Citation ) are apparently also common to obesity-prone AKR/J mice. It will be of interest in future studies to use the observed strain differences in UCP2 induction to address the mechanism of nutritional regulation of this gene.

The involvement of UCP1 in the adaptive response to dietary obesity has been investigated, and the evidence is strong that it is differentially affected by HF diets in obesity-resistant A/J compared with obesity-prone C57 mice (2Citation ,3Citation ). In this model, it was proposed that A/J mice mount a more robust adaptive thermogenic response to HF diets than do C57BL/6J mice by virtue of a disproportionate increase in leptin expression and a resulting larger increase in UCP1 expression in both BAT and WAT (2Citation ,3Citation ). We examined the effect of mouse strain and diet in the present study and found in three different depots that UCP1 mRNA was not higher in SWR/J than AKR/J mice fed the LF diet. UCP1 expression was increased in one of three fat pads (BAT) by the HF diet in SWR/J mice, but interestingly, UCP1 mRNA was significantly reduced in three separate fat pads of AKR/J mice after 4 wk of consuming the HF diet. The decrease in UCP1 mRNA was five- to sevenfold and fairly uniform in BAT, retroperitoneal WAT and inguinal WAT in AKR/J mice. This finding suggests a common mechanism across tissues, perhaps a circulating hormone or metabolite which is differentially affected by the HF diet in the two strains. On the basis of its demonstrated role in increasing fat oxidation (18Citation ), reducing WAT (19Citation ,20Citation ) and increasing UCP1 expression (11Citation ,21Citation ,22Citation ), leptin is a potential candidate. Previous studies have shown that leptin expression increases in relation to the amount of carcass fat (23Citation ,24Citation ); thus, we predicted that the significant increase in fat deposition in AKR/J mice consuming the HF diet would be accompanied by a concomitant increase in leptin expression. Although serum leptin was not measured in the current study, measurements of leptin mRNA in WAT did not support this prediction because we found similar leptin mRNA levels in AKR/J mice fed the HF and LF diets. Surprisingly, leptin mRNA did not differ between SWR/J and AKR/J mice despite the vast difference in fat pad size between the strains. These findings support the conclusion that leptin expression per unit of adipose tissue was greater in SWR/J than in AKR/J mice. The failure of AKR/J mice consuming the HF diet to increase leptin expression should not in itself have led to the decrease in UCP1 expression in the various fat pads. However, if it occurred in conjunction with the development of leptin resistance as would be expected, it could explain the diminished expression of PGC-1 and UCP1. Although not evaluated in the present work, responsiveness to exogenous leptin would provide a direct test of this possibility and is an area for future study. Taken together, these data suggest the interesting possibility that obesity-promoting effects of HF diets in AKR/J mice stem in part from their antithermogenic effects on adipose tissue.

The interpretation that the observed decreases in UCP1 expression are important are based on the position that UCP1 plays an important role in adaptive thermogenesis. Gain of function experiments suggest that UCP1 plays an important role in limiting fat deposition (25Citation ,26Citation ). This position is also supported by our recent studies, in which we showed that leptin’s ability to target and reduce WAT, independent of effects through reduced food intake, was dependent on the presence of UCP1 (21Citation ). Available evidence also supports the existence of UCP1-independent mechanisms of adaptive thermogenesis (27Citation ,28Citation ), and experiments with UCP1 null mice confirm that this system can substitute for UCP1 during cold exposure and high fat feeding (27Citation ,29Citation ). However, it is not clear to what extent this alternate system operates when UCP1 is present or how it is regulated. Although it is not possible to assess the relative importance of UCP1-dependent and -independent mechanisms in the current study, the results are consistent with the conclusion that strain differences in mice fed the LF diet likely depend on UCP1 independent mechanisms, whereas strain differences in mice consuming the HF diets involve both mechanisms. One interesting candidate for an UCP1-independent mechanism of metabolic regulation is the recently identified gene BFIT, an acyl-CoA thioesterase that is differentially expressed in adipose tissue from AKR/J and SWR/J mice (30Citation ). This gene was mapped to a genetic loci (30Citation ) that was linked to dietary obesity in previous studies by West et al. (31Citation ). BFIT expression was not altered by diet (30Citation ); thus, it is not among the adipocyte genes differentially affected by the HF diet between the strains.

Our studies indicated that the HF diet decreased ß3-AR mRNA expression in two different fat depots of AKR/J but not SWR/J mice. Decreased ß3-AR expression could be important if it compromised the ability of adipose tissue to respond to adrenergic signals from the sympathetic nervous system. This possibility was addressed with an exogenous ß3-AR agonist and no evidence emerged to support the conclusion that the HF diet compromised the ability of adipose tissue from AKR/J mice to respond when fully stimulated. However, the decrease in ß3-AR mRNA, along with PGC-1 and UCP-1 mRNA may indicate a response to the HF diet that is specific to AKR/J mice. One likely candidate is peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) whose transcriptional activity regulates a number of fat cell-specific genes. Although our understanding of the process is not yet clear, recent evidence suggests that production of endogenous ligands for PPAR{gamma} may be sensitive to HF diets (32Citation ). Thus, strain differences in sensitivity to dietary fat may be reflective of genetic differences in the manner in which a HF diet affects PPAR{gamma} expression or production of its endogenous ligand. Recent studies showed that PPAR{gamma} expression level had a profound effect on the response of mice fed a HF diet and on gene expression in adipose tissue from mice treated with PPAR{gamma} agonists (32Citation ,33Citation ) For example, the authors showed that reduced PPAR{gamma} expression prevented the decrease in ß3-AR mRNA normally observed after consumption of HF diets (33Citation ). An analogous scenario was not evident in our studies in which we found similar PPAR{gamma}2 mRNA levels in BAT samples from each strain (unpublished data). Given that the identity of the endogenous ligand for PPAR{gamma} is unknown, it is not yet possible to assess how diet may have affected its production. Nevertheless, it will be important in future studies to investigate the mechanisms by which diet affects PPAR{gamma} transcriptional activity as a basis for understanding strain differences in responses to HF diets.

Collectively, our studies show that SWR/J resist obesity when weaned onto HF diets by reducing food intake to account for the increased energy density of the HF diet, and effectively maintain the same level of energy intake. Second, the increased fat content of the diet does not alter efficiency of energy use for maintenance. The result is comparable energy intake and comparable fat deposition in SWR/J mice consuming LF or HF diets. In contrast, the HF diet promotes a 5- to 10-fold higher level of fat deposition in AKR/J mice that is not supported by a concomitantly greater energy intake. These data indicate that the HF diet increased metabolic efficiency in AKR/J mice, leaving a larger proportion of consumed energy for deposition as fat. Strain-specific differences in adipocyte gene expression profiles are consistent with this hypothesis and support the conclusion that HF diets selectively diminished energy dissipating mechanisms in AKR/J but not SWR/J mice. A limitation of the current work is that inferences regarding changes in gene expression were based on measurements of mRNA rather than expression or functional activity of the various proteins. It will be important in future studies to make these measurements and confirm the physiologic importance of changes in expression of these adipocyte genes.


    ACKNOWLEDGMENTS
 
The authors acknowledge the excellent technical assistance of Heather Hatcher, Rudy Beiler and Eric Hall.


    FOOTNOTES
 
1 Supported by a Research Grant from the American Diabetes Association (T.W.G.), a U.S. Public Health Service Grant DK 53981 (T.W.G.), and Research Grants from the United States Department of Agriculture NRICGP/USDA #9800699 and NRICGP/USDA #20010828 (T.W.G.). Back

3 Abbreviations used: ß3-AR, ß3-adrenergic receptor; BAT, brown adipose tissue; BSA, bovine serum albumin; HF, high fat; LF, low fat; PCR, polymerase chain reaction; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; RT, reverse transcriptase; UCP, uncoupling protein; WAT, white adipose tissue. Back

Manuscript received 10 July 2002. Initial review completed 24 July 2002. Revision accepted 13 August 2002.


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 

1. Surwit, R. S., Feinglos, M. N., Rodin, J., Sutherland, A., Petro, A. E., Opara, E. C., Kuhn, C. M. & Rebuffe-Scrive, M. (1995) Differential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice. Metabolism 44:645-651.[Medline]

2. Watson, P. M., Commins, S. P., Beiler, R. J., Hatcher, H. C. & Gettys, T. W. (2000) Differential regulation of leptin release and function in A/J versus C57BL/6J mice during diet-induced obesity. Am. J. Physiol. 279:E356-E365.[Abstract/Free Full Text]

3. Collins, S., Daniel, K. W., Petro, A. E. & Surwit, R. S. (1997) Strain-specific response to ß3-adrenergic receptor agonist treatment of diet-induced obesity in mice. Endocrinology 138:405-413.[Abstract/Free Full Text]

4. Surwit, R. S., Wang, S. Y., Petro, A. E., Sanchis, D., Raimbault, S., Ricquier, D. & Collins, S. (1998) Diet-induced changes in uncoupling proteins in obesity-prone and obesity-resistant strains of mice. Proc. Natl. Acad. Sci. U.S.A. 95:4061-4065.[Abstract/Free Full Text]

5. Smith, B. K., West, D. B. & York, D. A. (1997) Carbohydrate versus fat intake: differing patterns of macronutrient selection in two inbred mouse strains. Am. J. Physiol. 272:R357-R362.[Abstract/Free Full Text]

6. West, D. B., Goudey-Lefevre, J., York, B. & Truett, G. E. (1994) Dietary obesity linked to genetic loci on chromosomes 9 and 15 in a polygenic mouse model. J. Clin. Investig. 94:1410-1416.

7. Surwit, R. S., Seldin, M. F., Kuhn, C. M., Cochrane, C. & Feinglos, M. N. (1991) Control of expression of insulin resistance and hyperglycemia by different genetic factors in diabetic C57BL/6J mice. Diabetes 40:82-87.[Abstract]

8. Surwit, R. S., Kuhn, C. M., Cochrane, C., McCubbin, J. A. & Feinglos, M. N. (1988) Diet-induced type II diabetes in C57BL/6J mice. Diabetes 37:1163-1167.[Abstract]

9. American Institute of Nutrition (1977) Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J. Nutr. 107:1340-1348.

10. Gettys, T. W., Watson, P. M., Seger, L., Padgett, M. & Taylor, I. L. (1997) Adrenalectomy after weaning restores ß3-adrenergic receptor expression in white adipocytes from C57BL/6J mice. Endocrinology 138:2697-2704.[Abstract/Free Full Text]

11. Commins, S. P., Watson, P. M., Padgett, M. A., Dudley, A., Argyropoulos, G. & Gettys, T. W. (1999) Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140:292-300.[Abstract/Free Full Text]

12. Guerra, C., Koza, R. A., Yamashita, H., Walsh, K. & Kozak, L. P. (1998) Emergence of brown adipocytes in white fat in mice is under genetic control—effects on body weight and adiposity. J. Clin. Investig. 102:412-420.[Medline]

13. Koza, R. A., Hohmann, S. M., Guerra, C., Rossmeisl, M. & Kozak, L. P. (2000) Synergistic gene interactions control the induction of the mitochondrial uncoupling protein (UCP1) gene in white fat tissue. J. Biol. Chem. 275:34486-34492.[Abstract/Free Full Text]

14. West, D. B., Waguespack, J., O’Neal, J. & DeLany, J. P. (1994) Metabolic rate by doubly labelled H2O is inversely related to sensitivity to dietary obesity in two inbred mouse strains. FASEB J 8:A171(abs.).

15. West, D. B., DeLany, J. P., Camet, P. M., Blohm, F. Y., Truettt, A. A. & Scimeca, J. A. (1998) Effects of conjugated linoleic acid on body fat and energy metabolism in the mouse. Am. J. Physiol. 275:R667-R672.

16. Fleury, C., Neverova, M., Collins, S., Raimbault, S., Champigny, O., Levi-Meyrueis, C., Bouillaud, F., Seldin, M. F., Surwit, R. S., Ricquier, D. & Warden, C. H. (1997) Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat. Genet. 15:269-272.[Medline]

17. Gong, D. W., He, Y. F. & Reitman, M. L. (1999) Genomic organization and regulation by dietary fat of the uncoupling protein 3 and 2 genes. Biochem. Biophys. Res. Commun. 256:27-32.[Medline]

18. Hwa, J. J., Ghibaudi, L., Compton, D., Fawzi, A. B. & Strader, C. D. (1996) Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice. Horm. Metab. Res. 28:659-663.[Medline]

19. Friedman, J. M. & Halaas, J. L. (1998) Leptin and the regulation of body weight in mammals. Nature (Lond.) 395:763-770.[Medline]

20. Halaas, J. L., Gajiwala, K. S., Maffei, M., Cohen, S. L., Chait, B. T., Rabinowitz, D., Lallone, R. L., Burley, S. K. & Friedman, J. M. (1995) Weight-reducing effects of the plasma protein encoded by the obese gene. Science (Washington, DC) 269:543-546.[Abstract/Free Full Text]

21. Commins, S. P., Watson, P. M., Frampton, I. C. & Gettys, T. W. (2001) Leptin selectively reduces white adipose tissue in mice via an uncoupling protein-1-dependent mechanism. Am. J. Physiol. 280:E372-E377.[Abstract/Free Full Text]

22. Scarpace, P. J., Matheny, M., Pollock, B. H. & Tümer, N. (1997) Leptin increases uncoupling protein expression and energy expenditure. Am. J. Physiol. 273:E226-E230.[Abstract/Free Full Text]

23. Maffei, M., Halaas, J., Ravussin, E., Pratley, R. E., Lee, G. E., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., Kern, P. A. & Friedman, J. M. (1995) Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat. Med. 1:1155-1161.[Medline]

24. Halaas, J. L., Boozer, C., Blair-West, J., Fidahusein, N., Denton, D. A. & Friedman, J. M. (1997) Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc. Natl. Acad. Sci. U.S.A. 94:8878-8883.[Abstract/Free Full Text]

25. Kopecky, J., Clarke, G., Enerback, S., Spiegelman, B. & Kozak, L. P. (1995) Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J. Clin. Investig. 96:2914-2923.

26. Kopecky, J., Hodny, Z., Rossmeisl, M., Syrovy, I. & Kozak, L. P. (1996) Reduction of dietary obesity in aP2-UCP transgenic mice: physiology and adipose tissue distribution. Am. J. Physiol. 270:E768-E775.[Abstract/Free Full Text]

27. Enerback, S., Jacobsson, A., Simpson, E. M., Guerra, C., Yamashita, H., Harper, M. E. & Kozak, L. P. (1997) Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature (Lond.) 387:90-94.[Medline]

28. Thomas, S. A. & Palmiter, R. D. (1997) Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature (Lond.) 387:94-97.[Medline]

29. Hofmann, W. E., Liu, X., Bearden, C. M., Harper, M. E. & Kozak, L. P. (2001) Effects of genetic background on thermoregulation and fatty acid-induced uncoupling of mitochondria in UCP1-deficient mice. J. Biol. Chem. 276:12460-12465.[Abstract/Free Full Text]

30. Adams, S. H., Chui, C., Schilbach, S. L., Yu, X. X., Goddard, A. D., Grimaldi, J. C., Lee, J., Dowd, P., Colman, S. & Lewin, D. A. (2001) BFIT, a unique acyl-CoA thioesterase induced in thermogenic brown adipose tissue: cloning, organization of the human gene and assessment of a potential link to obesity. Biochem. J. 360:135-142.[Medline]

31. West, D. B., Waguespack, J., York, B., Goudey-Lefevre, J. & Price, R. A. (1994) Genetics of dietary obesity in AKR/J x SWR/J mice: segregation of the trait and identification of a linked locus on chromosome 4. Mamm. Genome 5:546-552.[Medline]

32. Kubota, N., Terauchi, Y., Miki, H., Tamemoto, H., Yamauchi, T., Komeda, K., Satoh, S., Nakano, R., Ishii, C., Sugiyama, T., Eto, K., Tsubamoto, Y., Okuno, A., Murakami, K., Sekihara, H., Hasegawa, G., Naito, M., Toyoshima, Y., Tanaka, S., Shiota, K., Kitamura, T., Fujita, T., Ezaki, O., Aizawa, S., Nagai, R., Tobe, K., Kimura, S. & Kadowaki, T. (1999) PPAR{gamma} mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell 4:597-609.[Medline]

33. Yamauchi, T., Kamon, J., Waki, H., Murakami, K., Motojima, K., Komeda, K., Ide, T., Kubota, N., Terauchi, Y., Tobe, K., Miki, H., Tsuchiya, A., Akanuma, Y., Nagai, R., Kimura, S. & Kadowaki, T. (2001) The mechanisms by which both heterozygous peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) deficiency and PPAR{gamma} agonist improve insulin resistance. J. Biol. Chem. 276:41245-41254.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. L. White, M. N. Purpera, and C. D. Morrison
Maternal obesity is necessary for programming effect of high-fat diet on offspring
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1464 - R1472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. N. Sutherland, L. C. Capozzi, N. J. Turchinsky, R. C. Bell, and D. C. Wright
Time course of high-fat diet-induced reductions in adipose tissue mitochondrial proteins: potential mechanisms and the relationship to glucose intolerance
Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1076 - E1083.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. D. Fink, J. A. Herlein, K. Almind, S. Cinti, C. R. Kahn, and W. I. Sivitz
Mitochondrial proton leak in obesity-resistant and obesity-prone mice
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R1773 - R1780.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. G. Smith, P. A. Sheridan, J. B. Harp, and M. A. Beck
Diet-Induced Obese Mice Have Increased Mortality and Altered Immune Responses When Infected with Influenza Virus
J. Nutr., May 1, 2007; 137(5): 1236 - 1243.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Y. Zhang, G. E Kilroy, T. M. Henagan, V. Prpic-Uhing, W. G. Richards, A. W. Bannon, R. L. Mynatt, and T. W. Gettys
Targeted deletion of melanocortin receptor subtypes 3 and 4, but not CART, alters nutrient partitioning and compromises behavioral and metabolic responses to leptin
FASEB J, September 1, 2005; 19(11): 1482 - 1491.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. L. White, H. D. Braymer, D. A. York, and G. A. Bray
Effect of a high or low ambient perinatal temperature on adult obesity in Osborne-Mendel and S5B/Pl rats
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2005; 288(5): R1376 - R1384.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. W. Bullen Jr, M. Ziotopoulou, L. Ungsunan, J. Misra, I. Alevizos, E. Kokkotou, E. Maratos-Flier, G. Stephanopoulos, and C. S. Mantzoros
Short-term resistance to diet-induced obesity in A/J mice is not associated with regulation of hypothalamic neuropeptides
Am J Physiol Endocrinol Metab, October 1, 2004; 287(4): E662 - E670.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prpic, V.
Right arrow Articles by Gettys, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prpic, V.
Right arrow Articles by Gettys, T. W.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Dietary Fats
*Obesity


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2002 by American Society for Nutrition