![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Department of Nutrition and Food Science and the Center for Molecular Medicine and Genetics, Wayne State University, Detroit, MI;
*
Departments of Medicine and
Nutritional Sciences,
**
Wisconsin Regional Primate Research Center,
Department of Obstetrics and Gynecology,
Department of Pathobiological Sciences,
Department of Physiology of the University of Wisconsin, Madison, WI 53706; and
#
Department of Biostatistics & Center for Research for Clinical Nutrition, University of Alabama at Birmingham, Birmingham, AL
3To whom correspondence should be addressed. E-mail: ndhurand{at}sun.science.wayne.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
KEY WORDS: • cholesterol • adiposity • obesity • nonhuman primates • infection
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
–3
). We have now identified two additional viruses, SMAM-1, an avian adenovirus (Ad), and Ad-36, a human adenovirus, that produce obesity in animals (4
–7
). In 6 separate experiments, we have shown that these two adenoviruses produce a syndrome of visceral obesity, along with paradoxically decreased serum cholesterol and triglycerides in chickens and mice (4
–8
). A capillary electrophoresis assay designed to detect Ad-36 DNA (9
) showed tropism of the virus for adipose tissue of the infected animals (6
,7
). Ad-36–induced adiposity in animals was hyperplastic and hypertrophic (10
). Preliminary data showed a marked up-regulation of adipocyte differentiation induced by Ad-36 (11
,12
). In humans, serum antibodies to both SMAM-1 and to Ad-36 are associated with obesity and lower cholesterol and triglycerides levels (5
,13
). For ethical reasons, the definitive experiment of injecting humans with Ad-36 to determine a causal role for this virus in human obesity is not possible. Nonhuman primates are the best surrogates for human experiments. In this paper, we used two disparate nonhuman primate species as models in which to study the adiposity promoting potential of Ad-36. |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
Adult male rhesus monkeys (Macaca mulatta) were screened for the presence of spontaneously occurring antibodies to Ad-36, to ascertain their association with longitudinal changes in body weight and cholesterol. Frozen plasma samples from adult male rhesus monkeys (n = 15) were obtained from the Wisconsin Regional Primate Research Center (WRPRC),4
Madison, WI. Blood samples and body weight measurements were collected every 6 mo for 90 mo. Monkeys were offered once daily a purified diet (#85387, Teklad, Madison, WI) supplemented daily with a piece of fresh fruit. The composition of the diet is described in Table 1
. Energy value of the diet eaten was 
167 kJ [700 kcal/(monkey · d)]. Monkeys consumed water ad libitum. All monkeys were between 8 and 14 y of age when the first plasma sample available for this study was drawn (baseline sample). Plasma samples were used to determine total cholesterol as well as antibodies to Ad-36, using the neutralization assay described below. For each monkey, the time of first appearance of Ad-36 antibodies, as well as body weight and cholesterol were determined for 18 mo before and after the first antibody appearance.
|
In a randomized experiment, adult male common marmosets (Callithrix jacchus) were inoculated with Ad-36 to investigate prospectively the adiposity-promoting effect of the virus. Ad-36 antibody-free adult male marmosets (n = 6, age range 2–6 y) were obtained from the WRPRC and were divided into two weight- and age-matched groups (each n = 3) that were individually housed in two separate rooms. Marmosets were fed once daily at 1230–1400 h 20 g of a specialized diet (Table 2
Zu Preem Marmoset Diet, Premium Nutritional Products Topeka, KS). Two small chunks of fruit (varied daily, 10 g) were added to provide variety and 5 mL of yogurt was spread on top, providing supplements of vitamin C, cholecalciferol, and calcium. Based on our previous experience, 20 g of the diet is slightly more that the amount consumed by marmosets in a day. To verify ad libitum consumption, it was noted that some food remained in the cage each day. Monkeys consumed water ad libitum. After 4 wk of acclimatization, marmosets were anesthetized with ketamine-xylazine [10 and 0.5 mg/kg, respectively, intramuscular (i.m.)] and inoculated intranasally (i.n.) with tissue culture media containing either Ad-36 virus (5 x 105 plaque forming units; Ad-36 group) or no virus (control group). Blood samples were drawn before inoculation (baseline) and also 10, 17 and 28 wk postinoculation and used for antibody screening (using the serum neutralization method described below) and for determination of serum cholesterol and triglycerides. Using the stable isotope dilution method described below, total body fat was determined at baseline and at 28 wk postinoculation, when the experiment was terminated and the monkeys were killed by administration of an i.m. injection of 10 mg/kg ketamine and 0.5mg/kg xylazine followed by an intravenous (i.v.) injection of 100 mg/kg pentobarbital. Visceral fat (intraperitoneal fat) was carefully removed from each carcass and weighed. Samples (1 g each) of the visceral fat, liver, skeletal muscle, lung and brain of all monkeys were flash-frozen in liquid nitrogen to screen for Ad-36 DNA using a nested polymerase chain reaction (PCR) assay.
|
Rhesus and marmoset procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Wisconsin at Madison. Monkeys were housed individually in cages that allowed auditory, visual and olfactory contact. The Ad-36 group and the uninfected control marmosets were housed in two separate rooms under biosafety level 2 containment.
Tissue culture techniques.
A549 cells (human lung carcinoma cells) obtained from American Type Culture Collection (ATCC, Manassas, VA) were used to grow Ad-36. Minimum essential medium Eagle (MEM) (Cat # M-0643, Sigma Chemical, St. Louis, MO) with nonessential amino acids, Earle’s salts, L-glutamine, 10% fetal bovine serum and 2.9% NaHCO3 (v/v), pH 7.4, was used for growing the cells.
Virus growth.
Ad-36 was obtained from the ATCC. The virus was plaque purified as previously described (6
,7
) and grown in A549 cells. A working stock of virus was prepared as previously described (6
,7
) and was titrated on A549 cells, divided into aliquots and stored at -80°C.
Serum neutralization test for detecting antibodies.
Rhesus plasma and marmoset serum were tested for the presence of Ad-36 antibodies. The assay used A549 cells and was conducted as a constant-virus-decreasing-serum method, as previously described (6
,7
). The absence of cytopathic effect (CPE) of the virus on A549 cells in the presence of the test serum is considered an indication of effective neutralization of the virus and the serum is considered to have antibodies against the virus. Samples were considered antibody positive if the serum titer was 
1:8. A few rhesus samples demonstrated cell-toxicity up to 1:16 dilutions. For these samples, a more stringent criterion of titer (1:32) was used to denote antibody positivity.
Cholesterol assay.
Fasting total cholesterol was determined in duplicate with a cholesterol-oxidase-peroxidase method (Cat # 352–500P; Sigma Chemical) using 10 µL of serum.
Development of a nested PCR assay for detection of Ad-36 DNA.
Four primers were designed to unique regions of the Ad-36 fiber protein gene for use in nested PCR detection of viral DNA. Sequences of primers were as follows: outer forward primer (5'-GTCTGGAAAACTGAGTGTGGATA), outer reverse primer (5'-ATCCAAAATCAAATGTAATAGAGT), inner forward primer (5'-TTAACTGGAAAAGGAATAGGTA), inner reverse primer (5'- GGTGTTGTTGGTTGGCTTAGGATA). DNA was isolated using a QIAamp Tissue Kit (Cat #29304; Qiagen, Valencia, CA). Negative PCR controls were water and DNA from uninfected A-549 cells. Positive PCR control was DNA from Ad-36 infected A-549 cells. DNA was denatured for 2 min at 95°C and subjected to 35 cycles of PCR (94°C for 1 min, 55°C for 1 min, 72°C for 2 min) followed by incubation at 72°C for 5 min. PCR products were visualized on a 1% agarose gel with a size marker. Nested PCR products from positive control (Ad-36 DNA) and infected marmoset brain tissue were sequenced to confirm amplification of targeted region of the gene.
Virus isolation.
Adenovirus infection in marmosets was confirmed by collecting fecal samples (wk 4 and 9 after Ad-36 inoculation) and growing the virus on cell cultures as described earlier (7
).
Body composition analysis by stable isotope dilution method.
Blood (1 mL) was drawn followed by i.v. administration of 0.1 g/kg deuterium oxide. The dose was determined by weighing the syringe before and after administration. A second blood sample was obtained 2 h after the dose. Equilibration time for the stable isotope is 60–75 min for rhesus monkeys; therefore, 2 h was considered an adequate equilibration period for the marmosets. Isotope dilution spaces were determined by forcing the serum through a 100,000-Da exclusion filter and distilling and reducing over zinc for mass spectrometric determination of the isotopic abundance. Dilution space was calculated from the isotopic enrichment of the 2-h sample relative to the predose sample. Fat-free mass was calculated from total body water, assuming a hydration ratio of 0.732. Body fat was calculated by subtracting fat-free mass from the total body mass.
|
Statistical analysis |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
Multivariate (O’Brien) test.
Before conducting univariate tests and to increase power, a multivariate test, in which the dependent variable Y, was defined as Y = (ZWeight - ZCholesterol) was used (14
). When Y was regressed on Ad-36 status, monkey, and the polynomials of age in the mixed effects model, the effect of Ad-36 status was significant (F = 8.14; df = 1,96; P = 0.005). Thus, there was a clear effect of Ad-36 status on combination of weight and cholesterol. We then examined each dependent variable separately.
Univariate tests. Univariate tests were conducted only when the multivariate test was significant. Each dependent variable (weight and cholesterol) was regressed on Ad-36 antibody status, monkey and polynomials of age in a mixed-effect model.
Study 2.
Groups were compared using Student’s t test. Values in the text are means ± SD.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
During the 90-mo period, all 15 monkeys showed Ad-36 antibodies at some point in time. Because blood samples were obtained at 6-mo intervals, the exact date of seroconversion during the preceding 6 mo of the first positive sample is unknown. The appearance of antibodies in the plasma did not demonstrate an annual pattern. Of 15 monkeys, 8 were seronegative at baseline. Only these monkeys were included in the statistical analysis to compare the body weights and cholesterol levels before and after the first appearance of Ad-36 antibodies. The remaining 7 monkeys were seropositive for Ad-36 antibodies at baseline and were excluded from statistical analysis.
Before separate univariate tests were conducted, a multivariate test (see Methods) was conducted that indicated a clear effect of Ad-36 status on the combination of weight and cholesterol (P = 0.005).
The monkeys were completely free of antibodies from -18 to -6 mo before the first positive sample; this was designated as the "baseline" period, whereas the period from +6 to +18 mo after seroconversion was designated as the "postinfection period." Body weight and plasma cholesterol level changes for 18 mo before and 18 mo after the first appearance of Ad-36 antibody are presented in Figures 1
and 2
. Time point "0 mo" denotes the first antibody positive serum sample for each monkey.
|
|
Body weight changed little during the baseline period, decreasing by 0.3% (0.04 ± 1.5 kg; P = 0.87). In contrast, the body weight increased by 10% in 6 mo and by 15% (1.7 ± 0.8 kg, P < 0.03) at 18 mo during the "postinfection" period (Fig. 1)
. In the full statistical model, the effect of Ad-36 antibody status was significantly associated with weight gain (F = 5.47; df = 1,96; P = 0.021). The parameter estimate for the effect of Ad-36 antibody status was 0.81 kg, indicating that the generation of Ad-36 antibodies was associated with an increase in body weight of 0.81 kg.
Cholesterol.
Plasma cholesterol levels were stable during the baseline period, but decreased by 23% (P = 0.06) during the 6 mo immediately after the appearance of Ad-36 antibodies and remained low for at least 18 mo during the postinfection period (Fig. 2)
. In the full statistical model, the effect of Ad-36 antibody status was significant (F = 5.33; df = 1,96; P = 0.023). The parameter estimate for the effect of Ad-36 antibody status was 0.49 mmol/L, indicating that the generation of Ad-36 antibodies was associated with a decrease in plasma levels of cholesterol by 0.49 mmol/L. Thus, when controlled for age, and after the first appearance of Ad-36 antibody, the rhesus monkeys had greater body weights and lower cholesterol levels.
Study 2: infection of marmosets with Ad-36.
Body weights of both groups did not differ at the time of inoculation (336.4 ± 19.8 g vs. 346.3 ± 27.8 g, P = 0.65; for the Control and the Ad-36–infected groups, respectively). The serum neutralization assay showed an absence of Ad-36 antibodies in the control group at all times during the experiment. Two of the three Ad-36–inoculated marmosets were antibody positive at both 10 and 17 wk postinoculation. Ad-36 could not be isolated from the fecal samples of the control group at any time during the study. However, the infective virus was isolated at both 4 and 9 wk postinoculation from the fecal samples of the two Ad-36 inoculated marmosets that had detectable Ad-36 antibodies. The nested PCR assay, however, detected Ad-36 DNA in the adipose tissue, liver, skeletal muscle, lung and the brain samples of all three Ad-36 inoculated marmosets, but not in any monkey in the control group. The nested PCR assay results for the adipose tissue of the two groups are presented in Figure 3
. Isolation of Ad-36 virus from fecal samples and the presence of viral DNA in the tissue of all infected males demonstrated that marmosets were readily infected with Ad-36.
|
) and total body fat gain (36.3 ± 6.1 g vs. 23.0 ± 3.0 g, P = 0.013) than controls. The mean weight gain of 41 g represented a 12% increase in the Ad-36 group compared with a 3.2% increase in the control group, a threefold difference. The Ad-36 group tended to have more visceral fat than controls (7.3 ± 2.5 g vs. 4.4 ± 0.9 g, P = 0.089). Despite the gain in fat mass and body weight, serum cholesterol levels were lower in the Ad-36 group than in controls (change from baseline: -0.79 ± 0.28 mmol/L vs. 0.10 ± 0.08 mmol/L, P = 0.006; Fig. 5
). The change in serum triglycerides from baseline tended to be greater in infected marmosets that in controls (-0.52 ± 0.23 mmol/L vs. 0.14 ± 0.53 mmol/L, P = 0.122).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
,7
). Ad-36 is serologically different from at least 47 of the other 49 human adenoviruses (15
–22
); it was first isolated in 1978 in Germany from the feces of a diabetic girl suffering from enteritis (17
). Relative antigenic uniqueness was one of the main reasons for selecting Ad-36 to test for the adiposity-promoting effect. The concept of virus-induced obesity is of greater importance if shown to be relevant to human obesity. Although we have demonstrated the adipogenic and hypolipidemic effects of a human virus in animals such as chickens and mice, we can not conclusively extrapolate the results, without verification, to human obesity. Differences in lipid metabolism between lower animals and primates preclude such a direct extrapolation. For instance, the energy metabolism of chickens is based on free fatty acids, not glucose, and insulin is of minor importance. Such metabolic differences clearly warranted the use of a higher model to establish the relevance of the findings to human obesity. In addition, because of ethical reasons, humans can not be infected experimentally with Ad-36 to verify its adipogenic effect directly. Therefore, we decided to use nonhuman primate species as the best way of determining the relevance of Ad-36 in human obesity.
In our rhesus monkey study, the fact that all of the 15 monkeys had Ad-36 antibodies at some time during the 90-mo period suggests a covert epidemic of Ad-36 infection in the rhesus monkey colony at WRPRC. The source of Ad-36 infection in monkeys is not yet known. However, transmission from humans is a possibility. Although most adenoviruses are species specific in their replication cycle, we have recovered infectious Ad-36 virus from Ad-36–infected chickens (6
,7
) and have detected naturally occurring antibodies to Ad-36 in chickens as well as rats (unpublished data). The ability of Ad-36 to infect and replicate in widely disparate vertebrate species is in itself unusual. Therefore, the presence of naturally occurring antibodies in rhesus monkeys to a human adenovirus is not very surprising.
Serum neutralization is considered the "gold standard" to specifically detect neutralizing antibodies. In addition to the previously reported minimal antigenic cross-reactivity of Ad-36 (16
–22
), we confirmed that Ad-36 does not cross-react with other human adenoviruses such as Ad-2, Ad-31 or Ad-37 (unpublished data). Therefore, it is unlikely that the antibodies detected in the rhesus monkey plasma that neutralized Ad-36 were antibodies to other human adenoviruses. Antibodies to simian adenovirus(es) that may cross-react with Ad-36 are a possibility, although cross-reactivity between a simian adenovirus and Ad-36 has not been reported.
In rhesus monkeys, a positive correlation of age with body weight and serum cholesterol would have been expected. The increase in body weight and drop in cholesterol during the postinfection period that persisted even after controlling for age supports our hypothesis that these changes were associated with the appearance of Ad-36 antibodies.
A comparison of body weight and plasma cholesterol changes between antibody positive and antibody-free monkeys would have been optimal to eliminate the effect of age on these variables. However, all 15 rhesus monkeys developed Ad-36 antibodies at different times during the study period, thus precluding such a comparison. Nevertheless, the following measures ensure that the changes in body weight and cholesterol observed were not age related.
The age of the monkeys ranged from 8 to 14 y. The age of the first appearance of antibodies varied among the monkeys. Regardless of the age of seroconversion, there was little change in body weights or plasma cholesterol in the 18 mo before the first appearance of antibodies. Thus, although the period before the onset of antibodies represents different ages for individual monkeys, their body weights were stable during this period. Such a stabilization of body weight is expected in adult rhesus monkeys who have completed their growth. Also, an age-related decline in plasma cholesterol is not expected in freely fed rhesus monkeys. In effect, each monkey acted as his own control for body weight and cholesterol comparisons before and after the seroconversion. As stated earlier, we further ascertained the age effect by controlling statistically for age, and found a clear effect of seroconversion on body weight and cholesterol that was independent of age. These measures demonstrate that the observed changes were not age related.
In the marmoset experiment, the persistence of Ad-36 DNA in various tissues of all marmosets 6 mo postinfection is an important finding, demonstrating the spread of Ad-36 in their bodies, even though one marmoset failed to generate detectable levels of antibodies. In addition, the presence of Ad-36 DNA in the adipose tissue is particularly intriguing because our preliminary data showed Ad-36 induced up-regulation of 3T3-L1 cell (rodent embryonic preadipocytes) differentiation (11
,12
). Future experiments should investigate the Ad-36–induced up-regulation of fat cell differentiation as a possible mechanism of Ad-36–induced obesity in monkeys. Similarly, Ad-36–induced hypothalamic damage is another possible mechanism that should be investigated. Canine distemper virus may promote obesity in mice by inducing hypothalamic damage (1
). Although we did not find histopathological hypothalamic lesions in Ad-36–infected mice in an earlier study (6
), the presence of Ad-36 DNA in the brains of the infected group warrants such an investigation in marmosets.
Considering the very small starting body weights of the marmosets, the mean postinoculation weight gain of 41g represents a 12% increase in the Ad-36 group, which is approximately threefold greater than the 3.2% mean weight gain in the control group. Also, the Ad-36 group had an 11.5% total fat gain vs. 6.8% in the control group and 66% more visceral fat than the controls. Given the very small size of marmosets, these findings are of major biological importance.
The data presented in this paper suggest that Ad-36 plays a role in increasing body weight in nonhuman primates such as rhesus monkeys and marmosets; either animal could be used as a surrogate model with which to study the role of Ad-36 in human obesity. However, as a model, marmosets appear to have some advantages over rhesus monkeys because they are smaller, easier to house and handle and less expensive. In addition, in our initial screening of monkeys from the WRPRC colony for Ad-36 antibodies, < 4% of the marmosets were antibody positive. This very low prevalence of Ad-36 antibodies in marmosets gives a much better chance to select antibody-free marmosets for a prospective study (rhesus monkeys from the WRPRC had much greater and frequent contact with humans, whereas the marmosets are housed in a more controlled environment to prevent inadvertent infections). Additionally, the fact that marmosets have a life-expectancy of 8 y (vs. 30–40 y for rhesus monkeys) means that in future prospective studies, marmosets could be tracked relatively easily during their complete life-cycle to ascertain the long-term consequences of Ad-36 infection.
A survey from three different states in the United States showed a 30% prevalence of Ad-36 antibodies in obese but only a 5% prevalence of the antibodies in nonobese subjects (13
). The antibody-positive obese subjects also had significantly lower serum cholesterol levels (13
). Body weight gain and hypocholesterolemia in response to Ad-36 infection in two divergent primate species support the hypothesis that the virus may play a causative role in human adiposity and demonstrate the suitability of the two animal models for further of the phenomenon. In addition, the relationship of Ad-36 with body composition and serum lipids in these models suggests that in the future, investigators studying body weight, obesity, obesity treatment or evaluation of serum lipids in rhesus monkeys or marmosets would be wise to take into account the status of infection with Ad-36 because Ad-36 may add extraneous variance to the outcome.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Supported by funds from the Wisconsin Alumni Research Foundation’s Beers-Murphy Clinical Nutrition Center, University of Wisconsin Medical School Research Committee and the William Hardy Endowment for Obesity Research of Wayne State University.
4 Abbreviations used: Ad, adenovirus; ATCC, American Type Culture Collection; CPE, cytopathic effect; IACUC, Institutional Animal Care and Use Committee; i.m., intramuscular; i.n., intranasal; i.v., intravenous; MEM, minimum essential media Eagle; PCR, polymerase chain reaction; WRPRC, Wisconsin Regional Primate Research Center.
Manuscript received 2 May 2002. Initial review completed 19 May 2002. Revision accepted 20 June 2002.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSStatistical analysisRESULTSDISCUSSIONLITERATURE CITED |
|---|
1. Lyons, M. J., Faust, I. M., Hemmes, R. B., Buskirk, D. R., Hirsch, J. & Zabriskie, J. B. (1982) A virally induced obesity syndrome in mice. Science (Wash., DC) 216:82-85.
2. Carter, J. K., Ow, C. L. & Smith, R. E. (1983) Rous-associated virus type 7 induces a syndrome in chickens characterized by stunting and obesity. Infect. Immun. 39:410-422.
3. Gosztonyi, G. & Ludwig, H. (1995) Borna disease: neuropathology and pathogenesis. Curr. Top. Microbiol. Immunol. 190:39-73.[Medline]
4. Dhurandhar, N. V., Kulkarni, P. R., Ajinkya, S. M. & Sherikar, A. A. (1992) Effect of adenovirus infection on adiposity in chickens. Vet. Microbiol. 31:101-107.[Medline]
5. Dhurandhar, N. V., Kulkarni, P. R., Ajinkya, S. M., Sherikar, A. A. & Atkinson, R. L. (1997) Screening of human sera for antibody against avian adenovirus. Obes. Res. 5:464-469.[Medline]
6. Dhurandhar, N. V., Israel, B. A., Kolesar, J. M., Mayhew, G. F., Cook, M. E. & Atkinson, R. L. (2000) Adiposity in animals due to a human virus. Int. J. Obes. 24:989-996.
7. Dhurandhar, N. V., Israel, B. A., Kolesar, J. M., Mayhew, G. F., Cook, M. E. & Atkinson, R. L. (2001) Transmissibility of adenovirus-induced adiposity in a chicken model. Int. J. Obes. 25:990-996.
8. Dhurandhar, N. V. & Atkinson, R. L. (2000) Viruses and obesity. Curr. Opin. Endocrinol. Diabetes 7:247-251.
9. Kolesar, J. M., Miller, J. A., Dhurandhar, N. V. & Atkinson, R. L. (2000) Direct quantification of AD-36 adenovirus DNA by capillary electrophoresis with laser-induced fluorescence. J. Chromatogr. B. 744:1-8.
10. Atkinson, R. L. & Dhurandhar, N. V. (2000) From cells to organisms: new thoughts on the etiology of obesity. Ntambi, J. T. eds. Adipocyte Biology and Signaling 2000:165-174 IOS Press Amsterdam, The Netherlands. .
11. Dhurandhar, N. V., Sheele, J., Israel, B. A. & Atkinson, R. L. (1999) Adenovirus that induces adiposity in animals also influences in-vitro differentiation of preadipocytes. Obes. Res. 7:39S.
12. Dhurandhar, N. V., Israel, B. A., Kolesar, J. M. & Atkinson, R. L. (2000) Pathophysiology of the human adenovirus that induces adiposity in animals. FASEB J 14:A732(abs.).
13. Atkinson, R. L., Dhurandhar, N. V., Allison, D. B., Bowen, R. & Israel, B. A. (1998) Evidence for an association of an obesity virus with human obesity at three sites in the United States. Int. J. Obes. 22:S57(abs.).
14. O’Brien, P. C. (1984) Procedures for comparing samples with multiple endpoints. Biometrics 40:1079-1087.[Medline]
15. Pereira, H. G., Huebner, R. J., Ginsberg, H. S. & Van Der Veen, J. (1963) A short description of the adenovirus group. Virology 20:613-620.[Medline]
16. Rubin, B. A. (1993) Clinical picture and epidemiology of adenovirus infections (a review). Acta Microbiol. Hung. 40:303-323.[Medline]
17. Wigand, R. H., Gelderblom, H. & Wadell, G. (1980) New human adenovirus (candidate adenovirus 36), a novel member of subgroup D. Arch. Virol. 64:225-233.[Medline]
18. De Jong, J. C., Bijlsma, K., Wermenbol, A. G., Verweij-Uijterwaal, M. W., Van Der Avoort, H. G., Wood, D. J., Bailey, A. S. & Osterhaus, A. D. (1993) Detection, typing and subtyping of enteric adenoviruses 40 and 41 from fecal samples and observation of changing incidences of infections with types and subtypes. J. Clin. Microbiol. 31:1562-1569.
19. De Jong, J. C., Wigand, R., Wadell, G., Keller, D., Muzerie, C. J., Wermenbol, A. G. & Schaap, G. J. (1981) Adenovirus 37: identification and characterization of a medically important new adenovirus type of subgroup D. J. Med. Virol. 7:105-118.[Medline]
20. De Jong, J. C., Wigand, R., Adrian, T. H, Hierholzer, J. C., Kapsenberg, J. G., Muzerie, C. J. & Wermenbol, A. G. (1984) Adenovirus 38: a new human adenovirus species of subgenus D. Intervirology 22:164-169.[Medline]
21. Wigand, R., Adrian, T. & Bricout, F. (1987) A new human adenovirus of subgenus D: candidate adenovirus type 42. Arch. Virol. 94:283-286.[Medline]
22. Hirholzer, J. C., Wigand, R., Anderson, L. J., Adrian, T. & Gold, J. W. (1988) Adenoviruses from patients with AIDS: a plethora of serotypes and a description of five new serotypes of subgenus D (Types 43–47). J. Infect. Dis. 158:804-813.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Pasarica, N. Mashtalir, E. J. McAllister, G. E. Kilroy, J. Koska, P. Permana, B. de Courten, M. Yu, E. Ravussin, J. M. Gimble, et al. Adipogenic Human Adenovirus Ad-36 Induces Commitment, Differentiation, and Lipid Accumulation in Human Adipose-Derived Stem Cells Stem Cells, April 1, 2008; 26(4): 969 - 978. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Desruisseaux, Nagajyothi, M. E. Trujillo, H. B. Tanowitz, and P. E. Scherer Adipocyte, Adipose Tissue, and Infectious Disease Infect. Immun., March 1, 2007; 75(3): 1066 - 1078. [Full Text] [PDF]
|
|
|
|
 |
|
 O Verlaeten, C Casery, S Cavagna, D Naville, P Giraudon, M F Belin, M Begeot, and A Bernard Identification of Urop11, a novel leptin-modulated gene that is upregulated in the hypothalamus of mice with virus-induced obesity J. Mol. Endocrinol., January 1, 2007; 38(1): 3 - 17. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Greenway Virus-induced obesity Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R188 - R189. [Full Text] [PDF]
|
|
|
|
|
|
L. D. Whigham, B. A. Israel, and R. L. Atkinson Adipogenic potential of multiple human adenoviruses in vivo and in vitro in animals Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R190 - R194. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
