![]() |
|
|
Interdepartmental Graduate Program in Nutritional Science and Department of Kinesiology, University of Wisconsin-Madison, Madison, WI 53706
2To whom correspondence should be addressed. E-mail: ji{at}education.wisc.edu
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: exercise fatty acid synthase fructose insulin transcription factor rats
| INTRODUCTION |
|---|
|
|
|---|
Although CHO feeding has consistently been shown to induce hepatic
lipogenic enzymes, fructose (F) ingestion in particular results in a
greater effect than glucose or complex CHO, such as cornstarch (C),
despite a lower insulin response (3
,9
10
11
12)
. Therefore, CHO
induction of FAS must be attributed at least partially to mechanisms
independent of insulin. For example, the CHO response element (ChoRE)
found within the first intron of the FAS gene has sequence similarity
to known glucose/CHO response elements in other lipogenic and
glycolytic genes and its binding has been shown to increase with a high
F diet (13
,14)
.
Endurance exercise causes various hormonal and metabolic changes that
alter the cellular milieu in a number of tissues, including liver
(15
16
17)
. Prolonged exercise consistently results in a
decrease in insulin secretion and an elevation of plasma glucagon and
catecholamine levels, both of which could decrease lipogenesis
(8
,19)
. In addition, endurance exercise decreases liver
glycogen and blood glucose levels, which could attenuate lipogenic
precursors and glycolytic metabolites in the liver. We have previously
reported that an acute bout of exercise suppresses induction of both
FAS mRNA and enzyme activity normally observed in rats starved and
refed a high CHO diet (3)
. We also demonstrated that
exercise attenuated nuclear protein binding to the IRS/A and ChoRE of
the FAS gene in liver extracts, which was postulated to be partially
responsible for the down-regulation of FAS enzyme activity
(20)
. However, the effect of exercise on ICE binding has
never been examined.
In the current study we investigated whether the exercise-induced down-regulation of FAS was due to a decrease in plasma insulin concentration and subsequent attenuation of the binding of IRS/A in rat liver. Liver nuclear protein binding to ChoRE and ICE in response to hormonal changes, diet and exercise was also investigated. To accomplish this goal, we used a streptozotocin (STZ)-treated rat model of type I diabetes in conjunction with high F or high C feeding to separate dietary and hormonal effects on FAS induction.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sixty-four male Wistar rats (age, 2 mo; body weight,
150 g;
Harlan Sprague-Dawley, Madison, WI) were used in the current study. The
rats were housed individually in the animal facilities at the
University of Wisconsin-Madison, using a reverse 12-h light/dark
cycle (7:0019:00 dark; 19:007:00 light) and consumed a nonpurified
diet (Ralston-Purina, St. Louis, MO) and tap water ad libitum.
The Animal Use Protocol was approved by the University of
Wisconsin-Madison Research Animals and Resource Center Review
Committee. After a 1-wk acclimation period, rats were randomly divided
into either STZ-treated (n = 32) or normal
controls (n = 32).
Streptozotocin treatment.
STZ rats were injected intraperitoneally with three doses of STZ (10 mg/kg body), dissolved in citric acid buffer (pH 7.4) after 20 h food deprivation and at a similar time of the day for the following two consecutive days. Control rats were injected with equal volumes of citric acid buffer at the same time as STZ injection. Rats had free access to food and water after STZ or buffer injections. Development of diabetes in STZ rats was confirmed by hyperglycemia (see below).
Dietary treatment.
In the present study, we used the same starved, refed regimen as
previously described (3)
. Briefly, 2 d after the
final STZ or buffer treatment, food was withheld from all rats for
48 h, during which time rats had free access to tap water. At this
time, rats were randomly assigned to two dietary groups
(n = 16). Each diet contained 50% of the
metabolizable energy from either complex CHO C or F and the other 50%
from a basal diet containing all the nutrients, vitamins and minerals
as previously described (3
,12)
. The density (on
weight-to-volume basis), volume and energy content of the two diets
were identical. Refeeding began early in the dark (active) cycle and
food was removed after 10 h of feeding. Food consumption was
immediately calculated for each rat.
Exercise.
After refeeding, a rat in each of the dietary groups was randomly
assigned to either an exercised (E) group (n = 8)
or a rested (R) group (n = 8). E rats were
subjected to an acute bout of treadmill running at 18 m/min, 5% grade
for 3 h or to exhaustion, whichever came first, and killed
immediately. A relatively low workload was chosen to extend running
time in rats, because dramatic alterations of plasma insulin and
glucagon levels are observed primarily in the later stage of prolonged
exercise when blood glucose levels tend to decrease (21)
.
R rats rested for the same amount of time without food or water as
their E counterparts ran before being killed. The experiments were
scheduled so that an E and an R rat were always killed sequentially
within 15 min. To avoid diurnal variation of hepatic lipogenic enzyme
activity, all rats were killed within a 2-h period during the same time
of day.
Liver tissue and blood collection.
After decapitation, the abdominal cavity of each rat was opened and the liver quickly excised and frozen in liquid N2. The liver samples were stored at -80°C until processing and assay. The mixed arteriovenous blood was collected in a conical tube containing 100 µL heparin (6 g/L) and chilled on ice. The blood sample was centrifuged at 500 x g for 15 min and plasma was stored at -80°C until hormone and plasma glucose assays were performed.
Plasma glucose and hormonal analyses.
Plasma glucose concentration was measured using a glucose oxidase assay (Sigma Diagnostics Glucose Kit 510-DA; Sigma Chemical, St. Louis, MO). Plasma glucagon and insulin were determined using RIA kits obtained from Diagnostic Products (Los Angeles, CA) and Linco Research (St. Louis, MO), respectively.
Northern blot analysis.
Total RNA was isolated from frozen livers by the method of Chomczynski
and Sacchi (22)
with Trizol Reagent (Gibco Life
Technologies, Gaithersburg, MD). Nucleic acid concentration was
estimated by absorbance at 260 nm. RNA quality was examined with gel
electrophoresis and ethidium bromide staining. Pilot experiments were
performed to determine optimal RNA conditions. In most cases, 15 µg
total RNA per lane was loaded onto a 0.8% agarose/formaldehyde gel and
run at low voltage
20 h to facilitate separation. The gel was then
soaked in 10X SSC to remove residual formaldehyde and in 0.05 mol/L
NaOH (20 min) to facilitate transfer of the RNA to the nylon membrane.
The RNA was transferred by capillary action with 20X SSC overnight onto
a nylon filter and covalently bound to the filter by ultraviolet
cross-linking (Stratagene, La Jolla, CA).
The cDNA probes for FAS and 18s were labeled with
[
-32P] dCTP using random primer extension
(23)
with a labeling kit (Megaprime; Amersham, Arlington
Heights, IL). Northern blots were prehybridized at 42°C overnight in
a solution consisting of 50% formamide, 5X Denhardts solution, 5X
SSPE and 0.1% SDS. Radiolabeled probes were added at a level of 33
MBq/L hybridization solution and allowed to hybridize
overnight. The stringency washes consisted of two 20-min washes with 1X
SSC; 0.5% SDS at 45°C and two 20-min washes with 0.5X SSC; 0.5% SDS
at 50°C, and one 20-min wash with 0.1X SSC; 0.5% SDS at 60°C.
Filters were wrapped in plastic while still damp and exposed to film at
-80°C. After autoradiography, the probe was stripped from filters
with a solution of 50% formamide, 2X SSPE at 65°C for 60 min.
FAS signals were quantified using a scanning densitometer (Biorad model GS-670; BioRad, Richmond, CA). FAS values were expressed relative to the densities of the respective 18s values.
Gel mobility shift assays.
Nuclear extracts were prepared as by the method of Dignam et al.
(24)
with modifications by Andrews and Faller
(25)
. The following single-stranded oligonucleotides
were obtained from Gibco Life Technologies. FAS-IRS-A
(-71/-50):TCAGCCCATGTGGCGTGGCCGC FAS-ChoRE
(+283/+303):GGCCGCTGTCACGTGGGCGCC FAS-ICE
(-109/-85):CGACGCTCATTGGCCTGGGCGG
Each single-stranded probe was 5' end-labeled by
incubating with [
-32P]dATP and T4
polynucleotide kinase (Promega, Madison, WI). The labeling reaction (25
µL) was allowed to proceed for 30 min at 37°C and stopped by adding
0.5 mol/L EDTA and bringing to a volume of 100 µL with 1X TE buffer
(100 mmol/L Tris-Cl, pH 8.0 and 10 mmol/L EDTA). After chloroform
extraction, free [
-32P]ATP was removed by
spin chromatography and then ethanol precipitation. Complementary
labeled stands were annealed by combining equal amounts of each
oligonucleotide in TE buffer (pH 8.0), heating to 90°C and allowing
to cool slowly to room temperature.
All binding reactions were performed at room temperature in 30 µL;
however, conditions for the reactions were dependent on the
oligonucleotide probe. For FAS-IRS/A: 10 mmol/L Tris HCl (pH 8.0), 50
mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT, 10% glycerol and 0.5 µg
poly[dI-dC]. For FAS-ChoRE: 10 mmol/L HEPES (pH 8.0), 50 mmol/L NaCl,
50 mmol/L KCl, 5 mmol/L MgCl2, 2 mmol/L DTT,
17.5% glycerol and 1 µg poly [dI-dC]. For FAS-ICE: 20 mmol/L HEPES
(pH 7.9), 1 mmol/L DTT, 60 mmol/L KCl, 0.5 mmol/L EDTA, 5% glycerol
and 30 mg/L poly [dI-dC]. Each reaction contained
1.5
MBq (0.10.5 ng) of radiolabeled
oligonucleotides and the indicated amounts of nuclear extracts in a
total volume of 30 µL. For competition experiments, unlabeled
competitor DNA was added to the mixture before addition of labeled
probe. After 20 min at room temperature, the samples were subjected to
4% nonreducing PAGE in 1X TG buffer (25 mmol/L Tris-Cl and 250
mmol/L glycine). The dried gels were exposed to X-ray film at
-70°C with an intensifying screen.
Enzyme assays.
Maximal activity of FAS was measured in liver cytosol according to
Nepokroeff et al. (26)
. Briefly, frozen liver was
homogenized in phosphate bicarbonate buffer [70 mmol/L
KHCO3, 85 mmol/L K2HPO4, 9 mmol/L
KH2PO4 and 1 mmol/L DTT (pH 8.0)]. The
homogenate was centrifuged at 20,000 x g for 10
min and the supernatant was recentrifuged at 105,000 x g for 60 min. Enzyme activity was measure
spectrophotometrically by following the oxidation of NADPH at 340 nm
for 3 min at 30°C. Protein content was determined by the Bradford
method (27)
with bovine serum albumin as the standard.
Statistical analyses.
Three-way ANOVA was used to determine significant differences (P < 0.05) in means among the various treatment groups. The main effects are diet (F vs. C), exercise (E vs. R) and insulin status (diabetics vs. normal). When the overall F test was significant, a post hoc least significant difference test (SYSTAT Inc., Evanston, IL) was used.
| RESULTS |
|---|
|
|
|---|
Body weight before the starvation/refeeding regimen was significantly
less in STZ-treated rats than in normal rats (P < 0.05; Table 1
). After 10 h refeeding, body weight remained lower in STZ versus
normal rats (P < 0.05) and C- and F-fed rats did
not differ. Food intake, expressed both as absolute and relative values
(g/100 g body) during the refeeding period was significantly higher in
F-fed rats (P < 0.05). Furthermore, STZ rats had
lower absolute food intake than normal rats (P < 0.05), but their relative food intake was not different from that of
the normal rats.
|
Plasma glucose.
Rats treated with STZ showed clear hyperglycemia (P < 0.001; Table 2
). STZ treatment increased plasma glucose 1- to 2-fold in the R rats but
no significant difference was observed between C- and F-fed rats. E
resulted in a significantly lower plasma glucose concentration in
STZ-treated rats but not in normal rats (P < 0.05,
STZ x E interaction).
|
Plasma insulin concentration was decreased with both STZ treatment
(P < 0.05) and E (P < 0.05; Table 2
).
STZ-treated rats had significantly higher plasma levels of glucagon
than normal controls (P < 0.05, main effect only).
Diet and exercise did not significantly affect plasma glucagon status.
STZ treatment resulted in a higher glucagon:insulin ratio than normal
controls (P < 0.05). Furthermore, E tended to increase
this ratio across all groups (0.05 < P < 0.1).
Fatty acid synthase mRNA levels.
Northern analysis was performed on hepatic total cellular RNA and major
transcripts were detected corresponding to 9.0 and 8.6 kb (Fig. 1
A). The blot also depicts the relative abundance of 18s RNA,
used as a reference for data normalization. F-fed R normal rats had
2.5-fold higher FAS mRNA abundance (P < 0.05) compared
with their C-fed counterparts (Fig. 1
b). STZ treatment
suppressed FAS mRNA levels by > 60% (P < 0.05)
in both C- and F-fed rats; however, F-fed, STZ-treated rats
still had significantly higher FAS mRNA abundance than did C-fed
STZ rats in the R state (P < 0.05). Liver FAS mRNA
levels were significantly decreased by E (P < 0.05). E
decreased FAS mRNA levels by 65% and 40% (P < 0.05)
in F-fed normal and STZ-treated rats, respectively. Thus, E
completely abolished FAS induction caused by F feeding. Furthermore,
this exercise effect was not influenced by insulin status, i.e., F
induction of FAS mRNA in STZ-treated rats was also significantly
attenuated with E.
|
The specificity of nuclear protein binding to IRS/A, ICE and ChoRE was
determined by the competition gel mobility shift assays. A single major
DNA-protein complex was detected with labeled FAS-IRS/A (Fig. 2
A, panel A, lane 1). This complex was successfully
competed away by increasing concentrations (1- to 100-fold) of
unlabeled IRS/A oligonucleotides (Fig. 2
A, panel
A, lanes 25). However, adding increasing
concentrations of unlabeled ICE or a consensus NFkB oligonucleotide
probe did not affect binding to the labeled IRS/A (Fig. 2
A,
panel A, lanes 616), indicating that the band
detected was specific. To determine whether the binding of
transcription factors was affected by nutritional and metabolic
factors, liver nuclear extracts were prepared from pooled nuclear
extracts from each treatment group (Fig. 2
a, panel
B). Diet and STZ treatment had no effect on IRS/A binding (Fig. 2
b). However, IRS/A binding was increased overall by
exercise (main effect, P < 0.05).
|
ß oligonucleotide did not result in competition with ICE
(panel A, lanes 1115). Although addition of
unlabeled IRS/A at low concentration (1- to 10-fold) did not compete
with ICE, a 50- to 100-fold molar excess of IRS/A did result in
disappearance of the lower major band (panel A, lanes
910). It remains to be elucidated whether this competition
between IRS/A and ICE binding was simply an experimental artifact or
revealed an unknown mechanism. A gel shift experiment with nuclear
extracts pooled from each treatment group is shown in Figure 3
|
|
Refeeding fructose resulted in a twofold increase in FAS enzyme
activity above levels found in C-fed rats regardless of exercise
status (Fig. 5
). STZ treatment abolished this increase in F-fed rats (P
< 0.05), but had no significant effect in C-fed rats. E did
not affect FAS activity in C- or F-fed normal rats but resulted in
an increase in FAS activity in STZ-treated rats (P
< 0.05).
|
| DISCUSSION |
|---|
|
|
|---|
STZ treatment severely hampered FAS mRNA expression in both diet groups
and suppressed FAS activity in F-fed rats. These defects due to
impaired insulin status were not completely corrected by fructose
feeding, indicating that normal insulin status is required for the
CHO-induced gene expression of FAS, at least with the
starvation/refeeding rat model. Our data were consistent with a large
body of literature demonstrating the essential role of insulin in
diet-induced lipogenic enzyme induction (6
,7)
. The
insulin effect has been shown to be conferred by activated IRS/A
binding in the promoter region of the FAS gene (6
,7
,28)
.
Furthermore, this binding has been shown to involve upstream
stimulatory factors (7
,29
,30)
. However, in the current
study, IRS/A binding was not affected by STZ treatment, suggesting that
impaired FAS gene expression in the diabetic rats is not caused by
diminished IRS/A binding in the liver. Perhaps only a minimal amount of
insulin is required to elicit sufficient IRS/A binding in diabetic
rats, which supports the hypothesis that insulin plays only a
permissive role in the lipogenic enzyme induction due to starvation and
refeeding (6
,7
,28)
. However, the mechanism by which
insulin regulates dietary induction of FAS is not entirely clear
(18
,19)
. Several recent studies have demonstrated that
other transcription factors are involved in the insulin-mediated
up-regulation of FAS gene expression (31
,32)
. For example,
the FAS promoter region contains an E-box motif (-64/-59) that
was part of the well-defined IRS/A (-71/-50) and can bind with
other basic helix-loop-helix transcription factors, such as adipocyte
determination differentiation dependent factor 1/sterol regulatory
element binding protein (SREBP) 1 to elicit transactivation of FAS
(33)
. Moreover, transcription of adipocyte determination
differentiation dependent factor 1/SREBP1 in hepatocytes was found to
be controlled positively by insulin and negatively by glucagon and cAMP
(34)
. Recently, it was observed in STZ-treated rats
that one SREBP isoform (SREPB-1a) is unchanged in livers compared with
normal controls, while another isoform (SREBP-1c) is decreased
(31)
. In fact, the SREBP-1c:1a ratio is 96% lower in
STZ-treated livers but returns to normal upon administration of
insulin. These studies raise the possibility that the
down-regulation of FAS induction during starvation/refeeding found
in STZ-treated rats was caused by alterations in binding of other
transcription factors to the FAS promoter not measured in the current
study. However, the relative physiologic importance of the newly
defined gene sequences remains to be determined.
STZ-treated rats had higher plasma glucagon concentration and an
increased glucagon/insulin ratio, regardless of diet. As an
anti-lipogenic hormone, glucagon blocks the increase in lipogenesis
caused by either starvation/refeeding or insulin administration in rats
(35
,36)
. The inhibitory effect of glucagon may result from
increased hepatic cAMP, which mimics glucagon in vitro
(36
,37)
. The importance of cAMP is highlighted by the fact
that the FAS promoter region also contains ICE that can bind the
transcription factor NF-Y (6
,7
,28)
. This region has
been shown to be responsive to cAMP and its activation can attenuate
up-regulation of FAS by insulin (8)
. Despite elevated
plasma glucagon, ICE binding was not increased in STZ-treated rats.
Thus, attenuated FAS expression in the diabetic rats might be mediated
by some other mechanisms that were not revealed by the current study.
For example, high levels of glycolytic metabolites are required to
elicit FAS induction by CHO (18
,19)
. Katsurada et al.
observed 4.6- and 3.3-fold increases in FAS mRNA and enzyme
activity, respectively, when diabetic rats were starved and refed
fructose for 16 h (2)
. However, transcription rate
increased only 60%, indicating FAS induction was mediated not by
increased transcription, but enhanced stability of FAS mRNA. Whether
the decreased FAS mRNA levels in STZ-treated rats was due to lower
glycolytic intermediate concentrations in currently unknown.
F-fed rats showed 2.5-fold higher FAS mRNA and 2-fold higher FAS
activity than C-fed rats. Furthermore, in the STZ-treated
diabetic rats wherein FAS gene expression was heavily suppressed, FAS
mRNA and activity were induced by F to a greater extent than by C and
reached the same levels as C-fed normal rats. These data,
consistent with many previous studies, clearly demonstrated the
prominent lipogenic potential of F (3
,11
,38
39
40)
.
F-fed normal and diabetic rats consumed 40% and 60% more food
than their C-fed counterparts, which could play an important role
in explaining the greater FAS induction. However, the mechanism
underlying the observed fructose effect cannot be entirely due to
greater energy intake because previous studies using a pair-feeding
or meal-feeding regimen revealed a greater lipogenic effect with
fructose feeding despite isocaloric intake (3
,39
,40)
. FAS
up-regulation by fructose feeding has been shown to coincide with
increased IRS/A binding in rat and mouse liver (28
,41)
.
Therefore, a direct involvement of fructose in promoting FAS gene
transcription was suggested. These studies were echoed by our recent
experiment showing that refeeding a high F diet for 6 h to
food-deprived rats significantly increased both IRS/A and ChoRE
binding, along with a dramatic elevation (50-fold) of FAS gene
transcription rate (20)
. In the present study, we observed
an increased transcription factor binding to FAS-ChoRE in the
F-fed rats, but IRS/A binding was not altered. There are two
possible explanations for the discrepancy. There might have been a
transient increase in IRS/A binding during the early phase of
refeeding. By studying the time course of FAS induction by F, Katsurada
et al. (2)
revealed a peak FAS transcription rate at
4 h of refeeding, whereas FAS mRNA levels did not reach the
maximal value until 16 h. Because increased nuclear protein
binding is the overture of transactivation of FAS gene, we speculate
that IRS/A binding might indeed have increased but then returned to
normal at 910 h when rats were killed. Alternatively, F induction of
FAS might have resulted primarily from increased mRNA stability,
whereas increased transcription due to IRS/A and/or ChoRE binding might
only play a minor role. F metabolites stimulate lipogenesis in rat
liver more effectively than glucose (4)
. Incubating HepG2
cells with D-glucose, lactate and citrate, but not
L-glucose, increased the half-life of FAS mRNA from 4.4
to 30 h, suggesting that the observed effects were mediated by
glycolytic intermediates (5)
. In a previous study, we
observed a greater hepatic pyruvate content in rats starved and refed a
F diet for 12 and 24 h, which coincided with a greater FAS mRNA
abundance (3)
. However, the importance of these potential
regulatory mechanisms has not been confirmed under physiological
conditions.
An acute bout of exercise significantly decreased F-induced hepatic FAS mRNA levels both in the normal and STZ-treated rats. We initially hypothesized that the exercise-induced down-regulation of FAS was caused by decreased plasma insulin and diminished nuclear protein binding to IRS/A and ChoRE. This hypothesis can be rejected based on the following findings. First, like F-fed rats, C-fed rats had lowered plasma insulin concentration with exercise but C-fed rats did not show decreased FAS mRNA or activity. Second, IRS/A binding was not decreased but instead increased with exercise. Third, ChoRE binding was not affected by exercise. Therefore, exercise-induced down-regulation of FAS is not directly caused by attenuated plasma insulin levels or by impaired IRS/A-ChoRE binding in the liver.
Exercise significantly increased nuclear protein binding to ICE, an
inverted CCAAT box located adjacent to IRS/A in the FAS promoter. This
region has been shown to bind the transcription factor NF-Y in
response to cAMP and its occupancy can attenuate up-regulation of
FAS by insulin in vitro (8)
. Our finding suggests that ICE
may play a more important role in FAS gene regulation during exercise
than other gene regulatory sequences investigated so far. Although
exercise simultaneously increased IRS/A and ICE binding in rat liver
extracts, the magnitude of increase appeared to be greater for the
latter in the F-fed rats (Fig. 3
b), which might be
sufficient to block the inductive effect of IRS/A and ChoRE. However,
it is unclear why exercise can increase ICE binding in the liver.
Plasma glucagon concentration was not elevated in exercised rats,
possibly due to the milder work intensity in the current study, but
other cAMP-generating hormones, such as catecholamines and
vasopressin, could increase their plasma concentrations during
prolonged exercise (21)
. Coupled with lower insulin, the
hormonal milieu was in favor of producing high levels of hepatic cAMP
that might activate ICE binding.
A major finding that has not been reported before is that exercise can
decrease hepatic FAS mRNA levels in the STZ diabetic rats refed F
despite severely impaired insulin status. In addition to the mechanisms
mentioned above, these rats had decreased plasma glucose levels with
exercise, raising the possibility that FAS mRNA in STZ-treated rats
was less stable. F-fed diabetic rats and C-fed normal rats had
similar FAS mRNA abundance in the resting state, but plasma insulin
concentration in the former was only one third of the latter (Table 2)
,
suggesting that diabetic rats rely heavily on mechanisms other than
insulin to induce lipogenic enzymes upon F feeding. Presumably, they
have greater glycolytic intermediate levels that stabilize mRNA
(18
,19)
. An acute bout of exercise has previously been
shown to decrease hepatic pyruvate and gluconeogenic precursors
(16)
; thus, FAS mRNA in the STZ-treated rats could be
more susceptible to degradation during prolonged exercise.
FAS enzyme activity was not down-regulated by exercise. This is not
unexpected because the 10-h refeeding time was chosen primarily to
manifest altered nuclear protein binding and mRNA transcription,
whereas enzyme protein synthesis usually takes longer. In our previous
study and others, peak FAS activity was reached at 2448 h after the
onset of refeeding (3)
. FAS activity measured at 10 h
may still have been too low to show significant inhibition due to
exercise.
In summary, we have shown for the first time that an acute bout of prolonged physical exercise could down-regulate hepatic FAS gene expression independent of rats insulin status. Exercise-induced down-regulation of FAS mRNA in both normal and diabetic rats was not caused by decreased plasma insulin level or IRS/A binding but coincided with increased binding of ICE. Diminished hepatic glycolytic intermediates during exercise might play a role in destabilizing FAS mRNA, especially in the STZ-treated rats.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
3 Abbreviations used: C, cornstarch; CHO,
carbohydrate; ChoRE, carbohydrate response element; E, exercised; F,
fructose; FAS, fatty acid synthase; ICE, inverted CCAAT-box
element; IRS/A, insulin response sequence; R, rested; SREBP, sterol
regulatory element binding protein; STZ, stemptozotocin. ![]()
Manuscript received December 11, 2000. Initial review completed January 11, 2001. Revision accepted May 15, 2001.
| LITERATURE CITED |
|---|
|
|
|---|
1. Goodridge A. G. (1987) Dietary regulation of gene expression: enzymes involved in carbohydrate and lipid metabolism. Ann. Rev. Nutr. 7:157-185.[Medline]
2. Katsurada A., Iritani N., Fukuda H., Matsumara Y., Nishimoto N., Noguchi T. & Tanaka T. (1990) Effects of nutrients and hormones on transcriptional and post-transcriptional regulation of fatty acid synthetase in rat liver. Biochem. J. 190:427-433.
3. Griffiths M. A., Fiebig R., Gore M. T., Baker D. H., Esser K., Oscai L. & Ji L. L. (1996) Exercise down-regulates hepatic lipogenic enzymes in food-deprived and refed rats. J. Nutr. 126:1959-1971.
4.
Hillgartner F. B., Salati L. M. & Goodridge A. G. (1995) Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol. Rev. 75:47-76.
5.
Semenkovich C. F., Coleman T. & Goforth R. (1993) Physiological concentrations of glucose regulate fatty acid synthetase activity in HepG2 cells by mediating fatty acid sythetase mRNA stability. J. Biol. Chem. 268:6961-6970.
6.
Wang D. & Sul H. S. (1995) Upstream stimulatory factors bind to insulin response sequence of the fatty acid synthase promoter USF1 is regulated. J. Biol. Chem. 270:28716-28722.
7.
Wang D. & Sul H. S. (1997) Upstream stimulatory factor binding to the E-box at -65 is required for insulin regulation of the fatty acid synthase promoter. J. Biol. Chem. 272:26367-26374.
8. Roder K., Wolf S. S., Beck K. F., Sickinger S. & Schweizer M. (1997) NF-Y binds to the inverted CCAAT box, as essential element for cAMP-dependent regulation of the rat fatty acid synthase (FAS) gene. Gene 184:21-26.[Medline]
9. Zakim D., Pardini R. S., Herman R. H. & Sauberlich H. E. (1967) Mechanism for the differential effects of high carbohydrate diets on lipogenesis in rat liver. Biochem. Biophys. Acta 144:242-251.[Medline]
10. Baker N., Learn D. B. & Bruckdorfer K. R. (1978) Re-evaluation of lipogenesis from dietary glucose carbon in liver and carcass of mice. J. Lipid Res. 19:879-893.[Abstract]
11. Carmona A. & Freedland R. A. (1989) Comparison among the lipogenic potential of various substrates in rat hepatocytes: the differential effects of fructose-containing diets on hepatic lipogenesis. J. Nutr. 119:1304-1310.
12. Griffiths M. A., Baker D. A., Novakofski J. E. & Ji L. L. (1993) Effect of excercise training on diet-induced lipogenic enzymes and body composition in rats. J. Am. Coll. Nutr. 12:155-161.[Abstract]
13.
Shih H. & Towle H. C. (1994) Definition of the carbohydrate response element of the rat S14 gene. J. Biol. Chem. 269:9380-9387.
14. Foufelle F., Lepetit N., Bosc D., Delzenne N., Morin J., Raymondjean M. & Ferre P. (1995) Dnase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-response elements. Biochem. J. 308:521-527.
15. Gorski J., Oscai L. B. & Palmer W. K. (1990) Hepatic lipid metabolism is exercise and training. Med. Sci. Sports Exerc. 22:213-221.[Medline]
16.
Coggan A. R., Swanson S. C., Mendenhall L. A., Habash D. L. & Kien C. L. (1995) Effect of endurance training on hepatic glycogenolysis and gluconeogenesis during prolonged exercise in men. Am. J. Physiol. 268:E375-E383.
17. Kjaer M. (1995) Hepatic Fuel Metabolism during Exercise: Exercise Metabolism. Hargreaves M. eds. Human Kinetics 1995 Publishers, Inc. Champaign, IL .
18. Vaulont S. & Kahn A. (1994) Transcriptional control of metabolic regulation genes by carbohydrates. FASEB J 8:28-35.[Abstract]
19. Girard J., Ferre P. & Foufelle F. (1997) Mechanisms by which carbohydrates regulate expression of genes for glycolytic and lipogenic enzymes. Ann. Rev. Nutr. 17:325-352.[Medline]
20.
Fiebig R., Gore M. T. & Ji L. L. (1999) Exercise attenuates nuclear protein binding to gene regulatory sequences of hepatic fatty acid synthase. J. Appl. Physiol. 87:1009-1015.
21. Galbo H. (1983) Hormonal and Metabolic Adaptation to Exercise. 1983:30-39 Thieme-Stratton, Inc. New York, NY .
22. Chomczynski P. & Sacchi N. (1987) Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:152-159.
23. Feinberg A. P. & Vogelstein B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.[Medline]
24.
Dignam J. D., Lebovitz R. M. & Roeder R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl. Acids Res. 11:1475-1489.
25.
Andrews N. C. & Faller D. V. (1991) A rapid micropreparation technique for extraction of DNA from limiting numbers of cells. Nucl. Acids Res. 19:2499-2502.
26. Nepokroeff C. M., Lakshmanan M. R. & Porter J. W. (1975) Fatty acid synthase from rat liver. Methods Enzymol 35:37-44.[Medline]
27. Bradford M. (1976) A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principles of protein-dye binding. Anal. Biochem. 72:248-254.[Medline]
28.
Moustaid N., Beyer R. S. & Sul H. S. (1994) Identification of an insulin response element in the fatty acid synthase promoter. J. Biol. Chem. 269:5629-5634.
29.
Vallet V. S., Casado M., Henrion A. A., Bucchini D., Raymondjean M., Kahn A. & Vaulont S. (1998) Differential roles of upstream stimulatory factors 1 & 2 in the transcriptional response of liver genes to glucose. J. Biol. Chem. 273:20175-20179.
30.
Casado M., Vallet V. S., Kahn A. & Voulont S. (1999) Essential role in vivo of upstream stimulatory factors for a normal dietary response of the fatty acid synthase gene in the Liver. J. Biol. Chem. 274:2009-2013.
31.
Shimomura I., Bashmakov Y., Shinji I., Horton J. D., Brown M. S. & Goldstein J. L. (1999) Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc. Natl. Acad. Sci. U.S.A. 96:13656-13661.
32.
Latasa M.-J., Moon Y. S., Kim K.-H. & Sul H. S. (2000) Nutritional regulation of the fatty acid synthase promoter in vivo: sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element. Proc. Natl. Acad. Sci. U.S.A. 97:10619-10624.
33. Kim J. B., Sarraf P., Wright M., Yao K. M., Mueller E., Solanes G., Lowell B. B. & Spiegelman B. M. (1998) Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J. Clin. Invest. 101:1-9.[Medline]
34.
Foretz M., Carling D., Guichard C., Ferre P. & Foufelle F. (1998) AMP-activated protein kinase inhibits the glucose-activated expression of fatty acid synthase gene in rat hepatocytes. J. Biol. Chem. 273:14767-14771.
35.
Lakshmanan M. R., Nepokroeff C. M. & Porter J. W. (1972) Control of the synthesis of fatty acid synthetase in rat liver by insulin, glucagon, and adenosine 3,5-cyclic monophosphate. Proc. Natl. Acad. Sci. U.S.A. 69:3516-3519.
36. Volpe J. J. & Marasa J. C. (1975) Hormonal regulation of fatty acid synthetase, acetyl CoA carboxylase and fatty acid synthesis in mammalian liver. Biochem. Biophys. Acta 380:454-472.[Medline]
37.
Paulauskis J. D. & Sul H. S. (1989) Hormonal regulation of mouse fatty acid synthetase gene transcription in liver. J. Biol. Chem. 264:574-577.
38. Bruckdorfer K. R., Khan I. H. & Yudkin Y. (1972) Fatty acid synthetase activity in the liver and adipose tissue of rats fed with various carbohydrates. Biochem. J. 129:439-446.[Medline]
39.
Volpe J. J. & Vagelos P. R. (1974) Regulation of mammalian fatty acid synthetase: the roles of carbohydrate and insulin. Proc. Natl. Acad. Sci. U.S.A. 71:889-893.
40.
Fiebig R., Griffiths M. A., Gore M. T., Baker D. H., Oscai L., Ney D. M. & Ji L. L. (1998) Exercise training down-regulates hepatic lipogenic enzymes in meal-fed rats: fructose versus complex carbohydrate diets. J. Nutr. 128:810-817.
41. Soncini M., Yet S.-F., Moon Y., Chun J.-Y. & Sul H. S. (1995) Hormonal and nutritional control of the fatty acid synthase promoter in transgenic mice. J. Biol. Chem. 270:30333-30343.
This article has been cited by other articles:
![]() |
S. C Lee, C. A Robson-Doucette, and M. B Wheeler Uncoupling protein 2 regulates reactive oxygen species formation in islets and influences susceptibility to diabetogenic action of streptozotocin J. Endocrinol., October 1, 2009; 203(1): 33 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Rector, J. P. Thyfault, R. T. Morris, M. J. Laye, S. J. Borengasser, F. W. Booth, and J. A. Ibdah Daily exercise increases hepatic fatty acid oxidation and prevents steatosis in Otsuka Long-Evans Tokushima Fatty rats Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G619 - G626. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fu and L. L. Ji Chronic Ginseng Consumption Attenuates Age-Associated Oxidative Stress in Rats J. Nutr., November 1, 2003; 133(11): 3603 - 3609. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||