|
|
|
|

,**2
*
Departments of Animal Sciences and
**
Veterinary Pathobiology and
Division of Nutritional Sciences, The University of Illinois at Urbana-Champaign, Urbana, IL 61801
2To whom correspondence should be addressed. E-mail: hgaskins{at}uiuc.edu.
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: antibiotic PCR-DGGE fiber intestinal microbiota microbial ecology
| INTRODUCTION |
|---|
|
|
|---|
Aberrant host responsiveness to specific organisms such as
Helicobacter spp. (9
,10)
or Mycobacteria
(11
,12)
and to various facultative and anaerobic
indigenous bacteria (13
,14)
is implicated in chronic
intestinal disorders such as inflammatory bowel disease. Additionally,
general disturbances in bacterial community structure, resulting from
antibiotics or changes in diet, induce epithelial damage and intestinal
inflammation by disrupting the homeostasis that exists between the host
and the indigenous microbiota (15
16
17
18
19
20)
.
Analysis of intestinal microbial ecosystems is complicated by the
complex nature of local bacterial communities, which may consist of
hundreds of different bacterial species (6
,21)
. Until
recently, microbial ecologists relied largely on techniques requiring
cultivation of organisms on selective media. Although studies utilizing
cultivation-based techniques have been useful for analysis of
specific groups of bacteria, several limitations are associated with
cultivation-based approaches, particularly for surveying the
intestinal ecosystem (21)
. In addition to being time- and
labor-intensive, the use of selective media specific for different
types of bacteria imposes an a priori bias on the types of bacteria
that can be enumerated. Further, only 2040% of bacterial species
from mammalian gastrointestinal tracts can be cultured and identified
using known cultivation techniques. Therefore, up to 80% of intestinal
bacterial species may not be represented using cultivation-based
techniques (21
22
23)
.
The introduction of higher resolution molecular techniques has improved
analyses of complex microbial populations (24
25
26
27)
. The
most important advance has been the use of 16S rRNA or rDNA as a
molecular fingerprint to identify and classify organisms, allowing
development of cultivation-independent techniques for analyzing
community diversity (26
27
28
29)
. Polymerase chain
reaction-denaturing gradient gel electrophoresis
(PCR-DGGE)3
is a PCR-based technique in which DNA is isolated from a mixed
sample and amplified using conserved 16S rDNA bacteria-domain
primers (30
,31)
. Although all PCR products are of
approximately equal size, when electrophoresed on a polyacrylamide gel
containing an increasing gradient of DNA denaturants, individual
amplicons cease to migrate as the double-stranded products denature
according to their G + C content (27
,30
,32)
. This approach
thus allows separation of individual sequences based on G + C content,
corresponding to the different microbial species within the sample
(27
,30
,32)
. The banding patterns from mixed samples can be
compared to evaluate the relative similarity of microbial communities
from different habitats or treatments. Further, after electrophoresis,
individual bands can be excised from the gel for sequencing and
phylogenetic identification, thus providing means to characterize
complex microbial populations within the sample independent of
bacterial cultivation. PCR-DGGE analysis of microbial communities
therefore allows an objective comparison of these communities, which is
unbiased by an a priori decision on the type of bacteria to be
analyzed.
PCR-DGGE has been widely used for analysis of environmental microbial
communities (32
33
34
35)
, although fewer studies have utilized
PCR-DGGE to analyze gastrointestinal microbial ecosystems
(21
,36
37
38
39)
. In this study, C57BL/6NHsd mice were fed
either a nonpurified diet (LC-diet) or a low residue diet (LR-diet) and
treated with or without the broad-spectrum antibiotic cefoxitin to
address the hypothesis that a LR-diet and antibiotic will alter
fecal microbial populations and decrease microbial diversity. A further
objective of the study was to assess the utility of PCR-DGGE to
detect perturbations of the intestinal microbiota.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The C57BL/6NHsd strain was established in the ERML Animal Care facility at UIUC from mice imported from Harlan (Indianapolis, IN). Mice were weaned at 3 wk of age to either Ensure (LR-diet; Abbott Laboratories, Ross Products Division, Columbus, OH) or standard nonpurified diet (LC-diet; Teklad LM-485 7041, Harlan Teklad, Madison, WI). Dietary proximate analyses were as follows: protein (199 g/kg), energy (16.9 MJ/kg), fat (57 g/kg) and fiber (44 g/kg) for the LC-diet, and protein (159 g/kg), energy (18.8 MJ/kg), fat (159 g/kg) and fiber (0%) for the LR-diet. Mice were housed individually in a conventional (nonspecific pathogenfree) facility under a 12-h light:dark cycle and allowed unrestricted access to food and water. Cages had mesh bottoms, which allowed passage of feces to a paper lining underneath the cage for collection. Animal protocols were approved by the Animal Care and Use Committee at the University of Illinois and complied with the NIH Guide for the Care and Use of Laboratory Animals.
Upon initiation of the 14-d study, mice averaged 17 wk of age. They were divided into four experimental groups (n = 5/group; one LR-diet + cefoxitin mouse died before study began) in a 2 x 2 factorial design consisting of LC-diet or LR-diet plus or minus a continuous supply of the broad-spectrum antibiotic cefoxitin (25 ppm in autoclaved drinking water; treatment initiated on d 1).
Fecal DNA isolation and PCR-DGGE analysis.
Fecal samples from C57BL/6NHsd mice were collected on the mornings of d
1, 2, 7 and 14. All fecal samples were snap-frozen in liquid
nitrogen and stored at -80°C until DNA isolation. DNA was isolated
from fecal samples following a modification of previously described
extraction methods (40
,41)
. Specifically, fecal samples
were vortexed in 20 mL of sterile PBS for 10 min and then centrifuged
for 2 min at 30 x g. The supernatant, which
contained the bacteria, was removed and centrifuged for an additional 5
min at 12,000 x g. The supernatant from this step
was discarded, and the pellet subjected to lysozyme treatment for 30
min at 37°C, at which time stop solution (0.1 mol/L NaCl, 0.48 mol/L
Tris, pH 8.0, 10% SDS) was added for 30 min at 37°C. These samples
were subjected to three freeze-thaw cycles (-80°C and room
temperature, respectively), proteinase K treatment (30 min at 37°C),
and extraction by phenol, phenol/chloroform/isoamyl alcohol (25:24:1)
and chloroform, followed by isopropanol precipitation in ammonium
acetate (2.5 mol/L final concentration). The mass of feces from some
samples did not yield a sufficient amount of DNA for PCR-DGGE
analysis; therefore, only three samples from each treatment group were
used for PCR-DGGE.
For PCR-DGGE analyses, each DNA sample was amplified using primers
specific for conserved sequences flanking the variable V3 region of the
16S rDNA, as described previously (31)
. Each reaction
mixture contained 125 ng of DNA, 5 µL of 25%
acetamide, 25 pmol of forward primer
(5'CGCCCGCCGCGCGCGGCGGGCGGGGGGGGCACGGGGGGCCTACGGGAGGCAGCAG3'), 25
pmol of reverse primer (5'ATTACCGCGGCTGCTGG3'), 0.2 mmol/L dNTPs, 5
µL of 10X Ex Taq Buffer (TaKaRa Shuzo, Otsu, Japan)
and 5 U TaKaRa Ex Taq DNA polymerase. The forward primer
contains a 40-bp region of high G + C content (the "GC clamp") at
the 5' end, which prevents complete dissociation of the DNA strands
(31)
. To reduce spurious PCR products, touchdown PCR was
performed (31)
. After a single cycle of 94°C melting for
5 min, 64°C annealing for 1 min and 72°C for 3 min, 19 cycles were
performed in which the annealing temperature was decreased 1° every
other cycle. Nine cycles were then performed using an extension of
55°C, followed by a single cycle of 94°C for 1 min, 55°C for 1
min and 72°C for 10 min.
After visual confirmation of the
200-bp PCR product using agarose
gel electrophoresis, mung-bean nuclease (Stratagene, La Jolla, CA)
was added to remove single-stranded DNA (37)
. For each
sample, 3 µL of 10X mung-bean buffer and 0.75
U mung-bean nuclease were added to 15
µL of the PCR product. After 10 min incubation at
37°C, mung-bean nuclease reactions were stopped by addition of 10
µL DGGE gel loading buffer (0.05% bromophenol blue,
0.05% xylene cyanol and 70% glycerol in sterile nanopure
H20). Reactions were stored at -20°C until PCR-DGGE
analysis, which was performed within 5 d of PCR.
DGGE was performed using the Bio-Rad D-Code System
(Hercules, CA) as described previously (37)
. To separate
PCR fragments, 3560% linear DNA-denaturing gradients (100%
denaturant is equivalent to 7 mol/L urea and 40% deionized formamide)
were formed in 8% polyacrylamide gels using a Bio-Rad Gradient
Former. Gels were polymerized on GelBond PAG gel support films (FMC,
Rockland, ME). PCR products were loaded in each lane and electophoresis
performed at 150 V for 2 h at 60°C, then for 1 h at 200 V.
Additionally, bacterial reference ladders representing known bacterial
strains were loaded to allow standardization of band migration and gel
curvature among different gels (42)
. After
electrophoresis, gels were silver-stained (31)
and
scanned using a GS-710 Calibrated Imagining Densitometer (BioRad). When
time- or antibiotic-dependent differences in PCR-DGGE banding
profiles were observed, bands were excised, reamplified as described
for PCR-DGGE, cloned using a TOPO TA cloning kit (InVitrogen,
Carlsbad, CA) and sequenced using an automated sequencing system
(Applied Biosystems, Foster City, CA) at the W. M. Keck Center for
Comparative and Functional Genomics, University of Illinois
Biotechnology Center (Urbana, IL). Sequence data were analyzed using
Sequencher 3.0 (Gene Codes, Ann Arbor, MI), and a BLAST search
(43)
was performed to identify sequences.
Estimates of microbial richness and diversity.
Diversity Database version 2.1 of "The Discovery Series" (BioRad)
was first used to analyze PCR-DGGE banding patterns by measuring
migration distance and intensity of the bands within each lane of a gel
(42)
. This information was then used to analyze banding
patterns via several measures of community diversity, including band
number, Shannons index and Wards algorithm (44
45
46)
.
These indices measure ecological diversity using various parameters,
including species richness (the number of different species) and
evenness (the distribution of individual species in the ecosystem)
(46)
. These diversity indices were developed originally
for macroecological analyses to evaluate evenness and species richness,
but have also been validated for cultivation- and molecular-based
analyses of microbial diversity (34
,47
48
49)
. In the
description of the indices that follows, "species" refers to
individual bands on the PCR-DGGE gels. However, because the bands
on the PCR-DGGE gels correspond to the percentage of G + C content
within the melting domains for the V3 PCR amplicon, bacterial species
with similar G + C content in the amplified V3 region may form
assemblages and appear as a single band, resulting in fewer bands
(50)
.
Band number corresponds to the number of individual bands in a single
lane. Band frequency was calculated by measuring the percentage of all
samples from all time points containing each individual band.
Shannons index measures the proportional abundances of species in a
community, emphasizing community richness (46)
.
Shannons index is calculated by the following equation:
![]() |
where pi is the proportion of
individuals in the population belonging to the ith species;
for analysis of DGGE patterns, pi
corresponds to the proportional abundance of band i
(34
,44
,51)
. Sorensons pairwise similarity coefficient
Cs, sometimes referred to as the Dice
coefficient, is a similarity index used to compare species composition
of different ecosystems (37
,52
53
54
55)
.
Cs values were determined as follows:
![]() |
where a is the number of PCR-DGGE bands in lane
1, b is the number of PCR-DGGE bands in lane 2 and
j is the number of common PCR-DGGE bands
(46
,53
,56)
. Thus, two identical profiles create a
Cs value of 100%, whereas completely different
profiles result in a Cs value of 0%. Each sample
was compared with every other sample; therefore, mean percentage
similarities (Cs values) can be compared for each
diet/treatment group for itself and in relation to all other groups.
Wards algorithm was utilized to construct a dendrogram of the
bacterial populations for each day. Wards algorithm is defined as
![]() |
where p and q represent two clusters that
are joined within a single cluster; k is the index of the
cluster formed by joining clusters p and q,
i is the index of any remaining clusters other than clusters
p, q or k;
np is the number of samples in the
pth cluster, nq the number of
clusters in the qth cluster, n the number of
clusters in the kth cluster formed by joining the
pth and the qth clusters (n = np + nq), and
dpq is the distance between cluster
p and cluster q as discussed by Sneath and Sokal
(45)
and the Diversity Database Manual (BioRad).
Statistics.
Statistical analysis of diversity and similarity indices was performed using SAS (Version 6.09; SAS Institute, Cary, NC). The General Linear Models procedure was used to compare differences due to antibiotic and diet for all indices. Cefoxitin- and diet-dependent differences were determined by the least significant difference test with an assigned P-value of < 0.05. Measures of central tendency for banding pattern frequency distribution were calculated using the Data Analysis package from Microsoft Excel (Redmond, WA).
| RESULTS |
|---|
|
|
|---|
Fecal samples collected from individual C57BL/6NHsd mice on d 1, 2, 7
and 14 of cefoxitin treatment were used for PCR-DGGE of the V3
region from 16S rDNA (Fig. 1
). The Diversity Database software was used to analyze PCR-DGGE gel
banding patterns. This software analyzes PCR-DGGE banding patterns
by measuring migration distance and intensity of the bands within each
lane of a gel. A chromatograhic representation of selected gel lanes is
presented in Figure 2A
and B
. Several diet- and cefoxitin-dependent differences
in PCR-DGGE banding patterns were observed. Additionally, several
PCR-DGGE bands occurred more frequently or with greater intensity
in certain diet or treatment groups. For example, the frequency and
density of band A was much higher in feces from mice treated with
cefoxitin than from untreated mice (Fig. 1)
. This band is shown in the
gel and chromatogram in panels C and D of Figure 2A
, appearing just before relative position 0.20 on
the x-axis. Band A was cloned and four clones randomly
selected and sequenced. Two clones were closely related (96 and 100%)
to GenBank accession number AF157056, previously identified as
Bacteroides distasonis of the altered murine Schaedler flora
(57
,58)
. The other clones were related to the 16S rRNA
sequences from an uncultured human fecal bacterium (95%; gbAF132240)
and a low G + C Gram-positive member of the altered murine
Schaedler flora (93%; gbAF157051). Several diet-specific bands
were also observed, although the differences were not as pronounced as
for band A. For example, band B was observed more frequently in mice
fed the LR-diet than in those fed the LC-diet. Additionally,
band C was detected only in mice fed the LC-diet.
|
|
The percentage of samples containing specific PCR-DGGE bands was
calculated to characterize the distribution frequency of PCR-DGGE
bands among the different samples. Measures of central tendency (mean
± SEM, 32 ± 3%; median, 31%; and mode, 29%)
indicated that of the 32 distinct bands observed across treatments, the
majority of PCR-DGGE bands were expressed in a low percentage of
the samples. Only 5 bands were present in
50% of the samples across
treatments, and there were no bands present in >80% of the samples
(Fig. 3A
).
|
|
Alterations in fecal bacterial populations.
Although H' was not affected by cefoxitin, comparisons
of PCR-DGGE banding patterns using Cs
revealed several diet- and antibiotic-dependent differences in the
bands comprising each fecal microbial population (Fig. 4
). For this comparison, the banding pattern for each sample was compared
with the other members in the same treatment group and to each other
group, thus allowing intragroup and intergroup comparisons of fecal
bacterial populations. Intragroup Cs values were
not affected by antibiotic (Fig. 4)
. However, diet affected the
similarity of bacterial populations; Cs values
were greater (P < 0.05) in fecal bacterial populations
from mice fed the LR-diet alone (69.8 ± 2.9%) compared with
mice fed the LC-diet alone (50.1 ± 3.8%). The similarity
value for the intergroup comparison of the LC- and LR-diets was
decreased to 40.3 ± 1.7%.
|
The effects of diet or cefoxitin on microbial composition were more
clearly distinguished by the cluster analysis based on Wards
algorithm. Distinct clusters by diet were observed on d 1, before
addition of antibiotic (Fig. 5
). Addition of cefoxitin differentially altered microbial populations
for each diet. On d 2, samples grouped together also according to diet.
By d 7 and 14, however, the microbial populations from mice receiving
the two antibiotic-treated diets (LR-diet + cefoxitin and
LC-diet + cefoxitin) more closely resembled each other than they
did populations from the nonantibiotic-treated mice fed the same
diets, forming a cluster separate from the dietary controls.
|
| DISCUSSION |
|---|
|
|
|---|
Although for therapeutic use cefoxitin is injected rather than
administered orally, it alters fecal microbial populations when
injected intravenously or intramuscularly (60)
. Similarly,
oral administration of antibiotics often causes a shift in intestinal
microbial populations, with a decrease in anaerobic populations and a
concomitant increase in aerobic populations (15
,16)
. The
changes in microbial populations occurring with cefoxitin treatment may
also result from the low dose of cefoxitin administered.
Subtherapeutic doses of antibiotics have been shown to select for
antibiotic resistance and transfer of resistance for cefoxitin and
other antibiotics. Therefore, the changes in community composition may
reflect the replacement of antibiotic-susceptible strains by
resistant organisms (61
62
63
64
65)
. In the present study, the
absence of cefoxitin-specific differences in band number and
Shannons index demonstrates that microbial diversity, characterized
by the number and intensity of the different DGGE bands, was unaffected
by cefoxitin. On the other hand, analysis of Cs
values demonstrated that the bacterial species comprising each
microbial community were significantly altered by cefoxitin.
Specifically, although the intragroup similarities of the
antibiotic-treated mice remained comparable to the diet controls,
an
20% decrease in intestinal bacterial similarities occurred in
the intergroup comparisons between mice fed control diets and mice
treated with cefoxitin. The maintenance of diversity combined with the
decrease in similarity values between the control and
cefoxitin-treated groups indicates the presence of different bands
in the cefoxitin-treated samples rather than an overall change in
community complexity.
Previous studies have reported that diets containing fiber support
increased populations of intestinal bacteria, although total community
structure was not evaluated (18
,66
67
68
69
70
71
72)
. In the present
study, diversity as measured by Shannons index was increased in mice
fed the LR-diet relative to those fed the LC-diet. The
increased number of bands in mice fed the LR-diet is in agreement
with a previous report of increased total counts of cecal bacteria in
mice fed this diet, indicating increased numbers of species as well as
increased overall diversity (73)
. Additionally, comparison
of Cs values demonstrated greater similarity of
the fecal microbiota in LR-dietfed mice than in those fed the
LC-diet, indicating less animal-to-animal variation in LR-dietfed
mice. The reasons for increased diversity (Shannons index) and
similarity of fecal microbial populations from LR-dietfed mice are
unclear. It is possible that the decreased number of bands from mice
fed the LC-diet resulted from a selective loss of
fiber-associated bacteria during extraction of DNA. Additionally,
because of the decreased number of bands in the LC-dietfed mice, the
Cs values in these mice are more sensitive to the
presence or absence of individual bands, thus explaining the lower
Cs values in mice fed the LC-diet. Another
potential explanation for the greater number of bands in mice fed the
LR-diet is that new niches may have been created by the absence of
exogenous fermentable substrate, allowing increased numbers of
bacterial species capable of utilizing endogenous carbohydrate sources
such as host mucin (18
,74
75
76
77
78)
.
Substantial individual-to-individual variation was observed among mice
within each treatment group, with intragroup Cs
values ranging from 50 to 70%. Other molecular-based studies of
gastrointestinal microbial ecology in pigs and humans have also
demonstrated that although the intestinal bacterial community within a
single individual is relatively stable over time, the bacterial
populations from different individuals vary significantly
(42
,79
80
81)
. Such differences are somewhat more surprising
in genetically identical mice that were housed and fed identically and
indicate the complexity of microbe-microbe interactions in
establishment and maintenance of the gut bacterial community.
Although PCR-DGGE provides a convenient method to evaluate entire
microbial ecosystems and also allows analysis of a large number of
samples, this technique is most useful for detecting shifts in
predominant microbial populations. For example, microbial populations
comprising <19% of the total intestinal microbial ecosystem were
not detected using temperature gradient gel electrophoresis (TGGE), an
approach similar to PCR-DGGE (81)
. Additionally, the
apparent community diversity may be decreased using PCR-DGGE
because different bacterial species possessing similar G + C content in
the V3 region of the 16S rDNA gene may be represented in the same
PCR-DGGE band (27
,82)
. Conversely, unrelated species
may have similar or identical rDNA gene sequences
(27
,81
,82)
. For these reasons, the PCR-DGGE band
number generally is lower than the number of bacterial species
detectable by cultivation-based methods and direct cloning
strategies (6
,26
,27
,37
,54
,81)
. These limitations may
account in part for the decreased band number in the present study and
may also have influenced the apparent diversity and similarity values.
On the other hand, although cultivation-based studies have
estimated that the intestinal microbiota may contain up to 400 species
of bacteria (6)
, many of these species are rarely detected
(83)
. Although newer techniques such as direct cloning and
terminal restriction fragment length polymorphism indicate the presence
of
80 microbial species in the mammalian intestine
(23
,54
,81)
, these techniques do not indicate proportional
abundance of microbial species. Therefore, many of the bacterial
species represented both in cultivation-based techniques and in
newer molecular techniques may be minor constituents of the intestinal
microbiota, in agreement with estimates that up to 99% of the
intestinal bacterial population is composed of only 3040 species
(84)
. Similarly, the mouse fecal bacterial community from
the present study, determined by the combined number of bands present
in all samples from all days, consisted of 32 PCR-DGGE bands. The
maximum number of bands within a single sample was 24. These results
are only slightly different than those reported in a study using TGGE,
in which the highest number of bands for any individual human fecal
sample was 38 (81)
. Similarly, we recently observed a
total of 35 PCR-DGGE bands in a set of 9 different pigs
(42)
. These findings indicate a similar degree of
resolution of intestinal microbial communities across animal species
with PCR-DGGE or TGGE and demonstrate the usefulness of
PCR-DGGE for assessing alterations in intestinal microbial
communities.
The aim of this study was to evaluate bacterial population changes
using a cultivation-independent technique. Therefore, extensive
cloning of diet- or treatment-specific bands to identify all of the
members of the population was not attempted. Because of its prominence
in the antibiotic-treated samples, however, band "A" was cloned
and sequenced. Of the four clones sequenced and compared with the
database using BLAST, three species were represented, indicating a
consortium of species within the band. The best match was from two
sequences that were closely related (100 and 96% similarity) to
gbAF157056, a member of the altered murine Schaedler flora formerly
classified as Bacteroides distasonis and now classified as a
member of an unnamed genus in the
Cytophaga-Flavobacterium-Bacteroides phylum
(58)
. The presence of several cefoxitin resistance genes
in intestinal Bacteroides isolates may explain the
prominence of this species in cefoxitin-treated mice
(85)
.
This study demonstrates the utility of PCR-DGGE analysis for monitoring diet- and antibiotic-induced alterations of the complex intestinal microbial ecosystem and correlating these changes with host responses. This cultivation-independent technique is less time- and labor-intensive than traditional microbiological approaches and could be similarly applied to evaluate other dietary-, drug- or disease-associated alterations of intestinal microbial populations. In addition to screening shifts in microbial populations, differentially expressed bands can be cloned and sequenced to allow an objective identification of organisms whose appearance or loss is associated with diet or disease, with the ultimate goal of defining causal effects.
| FOOTNOTES |
|---|
3 Abbreviations used: CS, Sorensons
similarity coefficient; H', Shannons diversity index;
LC-diet, nonpurified diet; LR-diet, low residue diet;
PCR-DGGE, polymerase chain reaction-denaturing gradient gel
electrophoresis; TGGE, temperature gradient gel electrophoresis. ![]()
Manuscript received October 12, 2000. Initial review completed December 9, 2000. Revision accepted March 6, 2001.
| REFERENCES |
|---|
|
|
|---|
1.
Savage D. C., Blumershine R.V.H. Surface-surface associations in microbial communities populating epithelial habitats in the murine gastrointestinal ecosystem: scanning electron microscopy. Infect. Immun. 1974;10:240-250
2.
Poxton I. R., Brown R., Sawyer A., Ferguson A. Mucosa-associated bacterial flora of the human colon. J. Med. Microbiol. 1997;46:85-91
3. Savage D. C. Mucosal microbiota. Ogra P. L. Mestecky J. Lamm M. E. Strober W. Bienenstock J. McGhee J. R. eds. Mucosal Immunology 1999:19-30 Academic Press San Diego, CA.
4. McGhee J. R., Lamm M. E., Strober W. Mucosal immune responses: an overview. Ogra P. L. Mestecky J. Lamm M. E. Strober W. Bienenstock J. McGhee J. R. eds. Mucosal Immunology 1999:485-506 Academic Press San Diego, CA.
5. Deplancke B., Gaskins H. R. Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am J. Clin. Nutr. 2001;(in press)
6. Moore W. E., Holdeman L. V. The normal flora of 20 Japanese-Hawaiians. Appl. Microbiol. 1974;27:961-979[Medline]
7.
Cebra J. J. Influences of microbiota on intestinal immune system development. Am. J. Clin. Nutr. 1999;69:1046S-1051S
8. McFall-Ngai M. The development of cooperative associations between animals and bacteria: establishing détente among domains. Am. Zool. 1998;38:593-608
9. Foltz C. J., Fox J. G., Cahill R., Murphy J. C., Yan L., Shames B., Schauer D. B. Spontaneous inflammatory bowel disease in multiple mutant mouse lines: association with colonization by Helicobacter hepaticus. Helicobacter 1998;3:69-78[Medline]
10.
Saunders K. E., Shen Z., Dewhirst F. E., Paster B. J., Dangler C. A., Fox J. G. Novel intestinal Helicobacter species isolated from cotton-top tamarins (Saguinus oedipus) with chronic colitis. J. Clin. Microbiol. 1999;37:146-151
11.
Cohavy O., Harth G., Horwitz M., Eggena M., Landers C., Sutton C., Targan S. R., Braun J. Identification of a novel mycobacterial histone H1 homologue (HupB) as an antigenic target of pANCA monoclonal antibody and serum immunoglobulin A from patients with Crohns disease. Infect. Immun. 1999;67:6510-6517
12. El-Zaatari F.A.K., Naser S. A., Hulten K., Burch P., Graham D. Y. Characterization of Mycobacterium paratuberculosis p36 antigen and its seroreactivities in Crohns disease. Curr. Microbiol. 1999;39:115-119[Medline]
13.
Mizoguchi A., Mizoguchi E., Tonegawa S., Bhan A. K. Alteration of a polyclonal to an oligoclonal immune response to cecal aerobic bacterial antigens in TCR-
mutant mice with inflammatory bowel disease. Int. Immunol. 1996;8:1387-1394
14. Cong Y., Brandwein S. L., McCabe R. P., Lazenby A., Birkemeier E. H., Sundberg J. P., Elson C. O. CD4+ T cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T helper cell type I response and ability to transfer disease. J. Exp. Med. 1998;6:855-864
15. Savage D. C., Dubos R. Alterations in the mouse cecum and its flora produced by antibacterial drugs. J. Exp. Med. 1968;129:97-110
16.
Berg R. D. Promotion of the translocation of enteric bacteria from the gastrointestinal tracts of mice by oral treatment with penicillin, clindamycin, or metronidazole. Infect. Immun. 1981;33:854-861
17. Spaeth G., Berg R., Specian R. D., Deitch E. A. Food without fiber promotes bacterial translocation from the gut. Surgery 1990;108:240-247[Medline]
18. Gestel G., Besançon P., Rouanet J.-M. Comparative evaluation of the effects of two different forms of dietary fibre (rice bran vs. wheat bran) on rat colonic mucosa and fæcal microflora. Ann. Nutr. Metab. 1994;38:249-256[Medline]
19. Gaskins H. R., Mackie R. I., May T., Garleb K. A. Dietary fructo-oligosaccharide modulates large intestinal inflammatory responses to Clostridium difficile in antibiotic-compromised mice. Microb. Ecol. Health Dis. 1996;9:157-166
20.
Maciorowski K. G., Turner N. D., Lupton J. R., Chapkin R. S., Shermer C. L., Ha S. D., Ricke S.C. Diet and carcinogen alter the fecal microbial populations in rats. J. Nutr. 1997;129:449-457
21. Vaughan E. E., Schut F., Heilig H.G.H.J., Zoetendal E. G., de Vos W. M., Akkermans A.D.L. A molecular view of the intestinal ecosystem. Curr. Issues Intest. Microbiol. 2000;1:1-12[Medline]
22. Langendijk P. S., Schut F., Janse G. J., Raangs G. C., Kamphuis G. R., Wilkenson M. H., Welling G. W. Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples. Appl. Environ. Microbiol. 1995;61:3069-3075[Abstract]
23.
Suau A., Bonnet R., Sutren M., Godon J.-J., Gibson G. R., Collins M. D., Doré J. Direct analysis of genes encoding 16S rRNA from complex communities reveals
many novel molecular species within the human gut. Appl. Environ. Microbiol. 1999;65:4799-4807
24. Olsen G. J., Lane D. L., Giovannoni S. J., Pace N. R. Microbial ecology and evolution: a ribosomal RNA approach. Annu. Rev. Microbiol. 1986;40:337-365[Medline]
25. Ward D. M., Bateson M. M., Weller R., Ruff-Roberts A. L. Ribosomal RNA analysis of microorganisms as they occur in nature. Adv. Microb. Ecol. 1992;12:219-286
26. Raskin L., Capman W., Sharp R., Poulsen L., Stahl D. Molecular ecology of gastrointestinal ecosystems. Mackie R. I. White B. A. Isaacson R. E. eds. Gastrointestinal Microbiology 1997;2:243-298 Chapman and Hall New York, NY.
27. Muyzer G. DGGE/TGGE a method for identifying genes from natural ecosystems. Curr. Opin. Microbiol. 1999;2:317-322[Medline]
28.
Woese C. R., Fox G. E. Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc. Natl. Acad. Sci. U.S.A. 1977;74:5088-5090
29.
Amann R., Ludwig W., Schleifer K.-H. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 1995;59:143-169
30.
Fischer S. G., Lerman L. S. DNA fragments differing by single base-pair substitutions are separated in denaturing gradient gels: correspondence with melting theory. Proc. Natl. Acad. Sci. U.S.A. 1983;80:1579-1583
31. Muyzer G., Brinkhoff T., Nübel U., Santegoeds C., Schäfer H., Wawer C. 1998) Denaturant gradient gel electrophoresis in microbial ecology. Akkermans A. van Elsas J. D. de Bruijn F. eds. Molecular Microbial Ecology Manual, Vol. 3.4.4 1998:1-27 Kluwer Academic Publishers Boston, MA
32.
Muyzer G., De Waal E. C., Uitterlinden A. G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993;59:695-700
33. Ferris M. J., Muyzer G., Ward D. M. Denaturing gradient gel electrophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl. Environ. Microbiol. 1996;62:340-346[Abstract]
34.
Nübel U., Garcia-Pinchel F., Kühl M., Muyzer G. Quantifying microbial diversity: morphotypes, 16S rRNA genes, and carotenoids of oxygenic phototropes in microbial mats. Appl. Environ. Microbiol. 1999;65:422-430
35.
Whiteley A. S., Bailey M. J. Bacterial community structure and physiological state within an industrial phenol bioremediation system. Appl. Environ. Microbiol. 2000;66:2400-2407
36. Millar M. R., Linton C. J., Cade A., Glancy D., Hall M., Jalal H. Application of 16S rRNA gene PCR to study bowel flora of preterm infants with and without necrotizing enterocolitis. J. Clin. Microbiol. 1996;34:2506-2510[Abstract]
37. Simpson J. M., McCracken V. J., White B. A., Gaskins H. R., Mackie R. I. Application of denaturant gradient gel electrophoresis for the analysis of the porcine gastrointestinal microbiota. J. Microbiol. Methods 1999;36:167-179[Medline]
38.
Walter J., Tannock G. W., Tilsala-Timisjarvi A., Rodtong S., Loach D. M., Munro K., Alatossava T. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl. Environ. Microbiol. 2000;66:297-303
39.
Tannock G. W., Munro K., Harmsen H.J.M., Welling G. W., Smart J., Gopal P. K. Analysis of the fecal microflora of human subjects consuming a probiotic product containing Lactobacillus rhamnosus DR20. Appl. Environ. Microbiol. 2000;66:2578-2588
40.
Tsai Y.-L., Olsen B. H. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl. Environ. Microbiol. 1992;58:2292-2295
41. Wilson K. H., Blitchington R. B. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 1996;62:2273-2278[Abstract]
42.
Simpson J. M., McCracken V. J., Gaskins H. R., Mackie R. I. Denaturing gradient gel electrophoresis analysis of 16S rDNA amplicons to monitor changes in fecal bacterial populations of weaning pigs after introduction of Lactobacillus reuteri strain MM53. Appl. Environ. Microbiol. 2000;66:4705-4711
43. BLAST. Natural Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/BLAST/(accessed 2/3/00)
44. Shannon C. E., Weaver W. The Mathematical Theory of Communication 1949 University of Illinois Press Urbana, IL.
45. Sneath P. H., Sokal R. R. Numerical Taxonomy: The Principles and Practice of Numerical Classification 1973 W. H. Freeman & Company San Francisco, CA.
46. Magurran A. Diversity indices and species abundance models. Ecological Diversity and Its Measurement 1988:8-45 Princeton University Press Princeton, NJ.
47. Krause D. O., Easter R. A., White B. A., Mackie R. I. Effect of weaning diet on the ecology of adherent lactobacilli in the gastrointestinal tract of the pig. J. Anim. Sci. 1995;73:2347-2354[Abstract]
48. Rasmussen L. D., Sörensen S. J. The effect of longterm exposure to mercury on the bacterial community in marine sediment. Curr. Microbiol. 1998;36:291-297[Medline]
49.
Eichner C. A., Erb R. W., Timmis K. N., Wagner-Dobler I. Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl. Environ. Microbiol. 1999;65:102-109
50. Muyzer G., Smalla K. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Leeuwenhoek 1998;73:127-141
51. Ludwig A., Reynolds J. F. Diversity indices. Statistical Ecology: A Primer on Methods and Computing 1988:85-100 John Wiley & Sons New York, NY.
52. Sheehan P. J. Effects on community and ecosystem structure and dynamics. Sheehan P. J. Miller D. R. Butler G. C. Bourdeau P. eds. Effects of Pollutants at the Ecosystem Level 1984:51-99 John Wiley & Sons New York, NY.
53. Murray A. E., Hollibaugh J. T., Orrego C. Phylogenetic compositions of bacterioplankton from two California estuaries compared by denaturing gradient gel electrophoresis of 16 S rDNA fragments. Appl. Environ. Microbiol. 1996;62:2676-2680[Abstract]
54.
Leser T. D., Hvid Lindecrona R., Jensen B. B., Moller K. Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae. Appl. Environ. Microbiol. 2000;66:3290-3296
55.
Scala D. J., Kerkhof L. J. Horizontal heterogeneity of denitrifying bacterial communities in murine sediments by terminal restriction fragment length polymorphism analysis. Appl. Environ. Microbiol. 2000;66:1980-1986
56.
Gillan D. C., Speksnijder A.G.C.L., Zwart G., Deridder C. Genetic diversity of the biofilm covering Montacuta ferruginosa (Mollusca, Bivalvia) as evaluated by denaturing gradient gel electrophoresis analysis and cloning of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 1998;64:3464-3472
57. Orcutt R. P., Gianni F. J., Judge R. J. Development of an "Altered Schaedler Flora" for NCI gnotobiotic rodents. Microecol. Ther. 1987;17:59
58.
Dewhirst F. E., Chien C.-C., Paster B. J., Ericson R. L., Orcutt R. P., Schauer D. B., Fox J. G. Phylogeny of the defined murine microbiota: altered Schaedler flora. Appl. Environ. Microbiol. 1999;65:3287-3292
59. O Sullivan D. J. Methods for analysis of the intestinal microbiota. Tannock G. W. eds. Probiotics: A Critical Review 1999:23-44 Horizon Scientific Press Norfolk, England.
60. Finegold S. M., Mathisen G. E., George W. L. Changes in human intestinal flora related to the administration of antimicrobial agents. Hentges D. H. eds. Human Intestinal Microflora in Health and Disease 1983:355-446 Academic Press New York, N.Y.
61.
Onishi H. R., Daoust D. R., Zimmerman S. B., Hendlin D., Stapley E. O. Cefoxitin, a semisynthetic cephamycin antibiotic: resistance to beta-lactamase inactivation. Antimicrob. Agents Chemother. 1974;5:38-48
62. Morelli L, Sarra P. G., Bottazzi V. In vivo transfer of pAMß1 from Lactobacillus reuteri to Enterococcus faecalis. J. Appl. Bacteriol. 1988;65:371-375[Medline]
63. Salyers A., Shoemaker N. B. Resistance gene transfer in anaerobes: new insights, new problems. Clin. Infect. Dis. 1996;23:S36-S43
64. Tannock G. Modification of the normal microbiota by diet, stress, antimicrobial agents, and probiotics. Mackie R. I. White B. A. Isaacson R. E. eds. Gastrointestinal Microbiology 1997;2:243-298 Chapman and Hall New York, NY.
65. Baquero F., Negri M. C., Morosini M. I., Blasquez J. Antibiotic-selective environments. Clin. Infect. Dis. 1998;27:S5-S11
66. Winitz M., Adams R. F., Seedman D. A., Seedman P. N., Jayco L. G., Hamilton J. A. Studies in metabolic nutrition employing chemically defined diets II. Effects on gut microflora populations. Am. J. Clin. Nutr. 1970;23:546-559[Medline]
67.
Attebery H. R., Finegold S. M., Sutter V. L. Effect of a partially chemically defined diet on normal human flora. Am. J. Clin. Nutr. 1972;25:1391-1398
68. Uphill P. F. A quantitative comparison of the faecal microflora of baboons fed a natural diet, or a synthetic diet complete or deficient in pyridoxine or riboflavin. J. Appl. Bacteriol. 1973;36:501-511[Medline]
69. Uphill P. F., Wilde J.K.H., Berger J. Repeated examinations, using the laparotomy sampling technique, of the gastro-intestinal microflora of baboons fed a natural or a synthetic diet. J. Appl. Bacteriol. 1974;37:309-317[Medline]
70. Wise A., Mallet A. K., Rowland I. R. Effect of mixtures of dietary fibers on the enzyme activity of the rat caecal microflora. Toxicology 1986;38:241-248[Medline]
71. Gibson G. R., Roberfroid M. B. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 1995;125:1401-1412
72.
Le Blay G., Bottiere H. M., Cherubt C. Prolonged intake of fructo-oligosaccharides induces a short-term elevation in lactic acid-producing bacteria and a persistent increase in cecal butyrate in rats. J. Nutr. 1999;129:2231-2235
73. Alverdy J. C., Aoys E., Moss G. S. Effect of commercially available chemically defined liquid diets on the intestinal microflora and bacterial translocation from the gut. J. Parent. Enteral Nutr. 1990;14:1-6[Abstract]
74.
Roberton A. M., Stanley R. A. In vitro utilization of mucin by Bacteroides fragilis. Appl. Environ. Microbiol. 1982;43:325-330
75. Hoskins L. C., Agustines M., McKee W. B., Boulding E. T., Kriaris M., Niedermeyer G. Mucin degradation in human colon ecosystems. Isolation and properties of fecal strains that degrade ABH blood group antigens and oligosaccharides from mucin glycoproteins. J. Clin. Investig. 1985;75:944-953
76.
Corfield A. P., Wagner S. A., Clamp J. R., Kriaris M. S., Hoskins L. C. Mucin degradation in the human colon: production of sialidase, sialate O-acetylesterase, N-acetylneuraminate lyase, arylesterase, and glycosulfatase activities by strains of fecal bacteria. Infect. Immun. 1992;60:3971-3978
77. Midtvedt A. C., Carlstedt-Duke B., Midtvedt T. Establishment of a mucin-degrading intestinal microflora during the first two years of human life. J. Pediatr. Gastroenterol. Nutr. 1994;18:321-326[Medline]
78. Roberton A. M., Wright D. P. Bacterial glycosulphatases and sulphomucin degradation. Can. J. Gastroenterol. 1997;11:361-366[Medline]
79. McCartney A. L., Wenzhi W., Tannock G. W. Molecular analysis of the composition of the bifidobacterial and Lactobacillus microflora of humans. Appl. Environ. Microbiol. 1996;62:4608-4613[Abstract]
80. Kimura K., McCartney A. L., McConnell M. A., Tannock G. W. Analysis of fecal populations of bifidobacteria and lactobacilli and investigation of the immunological responses of their human hosts to predominant strains. Appl. Environ. Microbiol. 1997;63:3394-3398[Abstract]
81.
Zoetendal E. G., Akkermans A.D.L., de Vos W. M. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria. Appl. Environ. Microbiol. 1998;64:3854-3859
82.
Palys T., Nakamura L. K., Cohan F. M. Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data. Int. J. Syst. Bacteriol. 1997;47:1145-1156
83. Moore L.V.H., Moore L. H. Intestinal floras of populations that have a high risk of colon cancer. Appl. Environ. Microbiol. 1995;61:3202-3207[Abstract]
84. Draser B. S., Barrow P. A. Intestinal Microbiology 1985 American Society for Microbiology Washington, DC.
85. Salyers A., Shoemaker N. B. Genetics of human colonic Bacteroides.. Mackie R. I. White B. A. Isaacson R. E. eds. Gastrointestinal Microbiology vol. 2 1997:299-320 Chapman and Hall New York, NY
This article has been cited by other articles:
![]() |
S. L. Lodge-Ivey, J. Browne-Silva, and M. B. Horvath Technical note: Bacterial diversity and fermentation end products in rumen fluid samples collected via oral lavage or rumen cannula J Anim Sci, July 1, 2009; 87(7): 2333 - 2337. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Thompson, K. Burkholder, J. Patterson, and T. J. Applegate Microbial Ecology Shifts in the Ileum of Broilers During Feed Withdrawal and Dietary Manipulations Poult. Sci., August 1, 2008; 87(8): 1624 - 1632. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Santos Jr., P. R. Ferket, F. B. O. Santos, N. Nakamura, and C. Collier Change in the Ileal Bacterial Population of Turkeys Fed Different Diets and After Infection with Salmonella as Determined with Denaturing Gradient Gel Electrophoresis of Amplified 16S Ribosomal DNA Poult. Sci., July 1, 2008; 87(7): 1415 - 1427. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Lumpkins, A. B. Batal, and M. Lee The Effect of Gender on the Bacterial Community in the Gastrointestinal Tract of Broilers Poult. Sci., May 1, 2008; 87(5): 964 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Voltan, I. Castagliuolo, M. Elli, S. Longo, P. Brun, R. D'Inca, A. Porzionato, V. Macchi, G. Palu, G. C. Sturniolo, et al. Aggregating Phenotype in Lactobacillus crispatus Determines Intestinal Colonization and TLR2 and TLR4 Modulation in Murine Colonic Mucosa Clin. Vaccine Immunol., September 1, 2007; 14(9): 1138 - 1148. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. O. Santos, B. W. Sheldon, A. A. Santos Jr., P. R. Ferket, M. D. Lee, A. Petroso, and D. Smith Determination of Ileum Microbial Diversity of Broilers Fed Triticale- or Corn-Based Diets and Colonized by Salmonella J. Appl. Poult. Res., January 1, 2007; 16(4): 563 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, Y. Ge, D. Saxena, and P. W. Caufield Genetic Profiling of the Oral Microbiota Associated with Severe Early-Childhood Caries J. Clin. Microbiol., January 1, 2007; 45(1): 81 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
V Mai, B Greenwald, J Glenn Morris Jr, J-P Raufman, and O C Stine Effect of bowel preparation and colonoscopy on post-procedure intestinal microbiota composition. Gut, December 1, 2006; 55(12): 1822 - 1823. [Full Text] [PDF] |
||||
![]() |
M. Castillo, S. M. Martin-Orue, M. Roca, E. G. Manzanilla, I. Badiola, J. F. Perez, and J. Gasa The response of gastrointestinal microbiota to avilamycin, butyrate, and plant extracts in early-weaned pigs J Anim Sci, October 1, 2006; 84(10): 2725 - 2734. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Suchodolski, C. G. Ruaux, J. M. Steiner, K. Fetz, and D. A. Williams Application of Molecular Fingerprinting for Qualitative Assessment of Small-Intestinal Bacterial Diversity in Dogs J. Clin. Microbiol., October 1, 2004; 42(10): 4702 - 4708. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Konstantinov, A. Awati, H. Smidt, B. A. Williams, A. D. L. Akkermans, and W. M. de Vos Specific Response of a Novel and Abundant Lactobacillus amylovorus-Like Phylotype to Dietary Prebiotics in the Guts of Weaning Piglets Appl. Envir. Microbiol., July 1, 2004; 70(7): 3821 - 3830. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Mai and J. G. Morris Jr. Colonic Bacterial Flora: Changing Understandings in the Molecular Age J. Nutr., February 1, 2004; 134(2): 459 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Mai, H. A. Katki, H. Harmsen, D. Gallaher, A. Schatzkin, D. J. Baer, and B. Clevidence Effects of a Controlled Diet and Black Tea Drinking on the Fecal Microflora Composition and the Fecal Bile Acid Profile of Human Volunteers in a Double-Blinded Randomized Feeding Study J. Nutr., February 1, 2004; 134(2): 473 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Collier, M. R. Smiricky-Tjardes, D. M. Albin, J. E. Wubben, V. M. Gabert, B. Deplancke, D. Bane, D. B. Anderson, and H. R. Gaskins Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters J Anim Sci, December 1, 2003; 81(12): 3035 - 3045. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Deplancke, K. Finster, W V. Graham, C. T. Collier, J. E. Thurmond, and H. R. Gaskins Gastrointestinal and Microbial Responses to Sulfate-Supplemented Drinking Water in Mice Experimental Biology and Medicine, April 1, 2003; 228(4): 424 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nagashima, T. Hisada, M. Sato, and J. Mochizuki Application of New Primer-Enzyme Combinations to Terminal Restriction Fragment Length Polymorphism Profiling of Bacterial Populations in Human Feces Appl. Envir. Microbiol., February 1, 2003; 69(2): 1251 - 1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Conour, D. Ganessunker, K. A. Tappenden, S. M. Donovan, and H. R. Gaskins Acidomucin goblet cell expansion induced by parenteral nutrition in the small intestine of piglets Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1185 - G1196. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||