![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Département de Microbiologie et Immunologie, Université Paris XI, Faculté de Pharmacie, Châtenay-Malabry Cedex, France;
Unité de Virologie et Immunologie Moléculaires, Jouy-en-Josas Cedex, France;
Laboratoire de Recherches de Technologie Laitière, Rennes Cedex, France; and
Unité d’Ecologie et de Physiologie du Système Digestif, Institut National de la Recherche Agronomique, Jouy-en-Josas, France
**
*
2To whom correspondence should be addressed. E-mail: francoise.forestier{at}cep.u-psud.fr
ABSTRACT
The purpose of this study was to evaluate the immunomodulatory activity
of a peptide derived from bovine ß-casein (ß-CN), the ß-CN
(193–209) peptide, on mouse macrophages that were obtained either from
germfree (GF) or from human flora-associated (HF) mice. Macrophages
were derived from bone marrow (BMDM) in the presence of recombinant
macrophage colony-stimulating factor and exposed to the peptide or
lipopolysaccharide (LPS). Membrane marker expression [F4/80, Mac-1,
major histocompatibility complex (MHC) class II antigens] and
phagocytic activity were assessed by flow cytometry. Production of
tumor necrosis factor-
and interleukin (IL)-6 was measured by
bioassays and production of IL-1, IL-1ß and IL-12 by ELISA. The
expression of cytokine mRNA was determined using semi-quantitative
reverse transcription-polymerase chain reaction. The ß-CN
(193–209) peptide up-regulated MHC class II antigen expression and
phagocytic activity of BMDM from GF and HF mice. Its enhancing effect
on phagocytosis was greater than that after LPS stimulation
(P < 0.01). The peptide induced notable levels of
cytokine mRNA in BMDM from GF and HF mice, but it was a significantly
weaker inducer of cytokine secretion than LPS. Nevertheless, although
flora implantation had no stimulatory influence on basal MHC class II
and basal cytokine levels, cells from HF mice were more susceptible
than those from GF mice to the peptide effects on these variables.
These results indicate that the ß-CN (193–209) peptide could enhance
antimicrobial activity of macrophages without proinflammatory effects.
KEY WORDS: • milk peptide • macrophage • membrane antigen • phagocytosis • cytokine • mice
There has been increased interest in the study of the relationship
between nutrition and immunity due to the hypothesis that consumption
of specific foods may reduce susceptibility for the establishment
and/or progression of immunological diseases. Besides a nutritional
role, milk proteins are of physiological importance as a potential
source of biologically active peptides (1
). Some have
beneficial effects on the digestive (2
, 3
), cardiovascular
(4
, 5
) and nervous systems (6
). Others seem to
be involved in host defense both by direct antimicrobial effects
(7
) and by immunomodulatory properties (8
).
Functional peptides are inactive when constituting part of the
precursor proteins. However, they can be released during the
fermentation process of milk by lactic acid bacteria or during
gastrointestinal digestion (9
, 10
) and may function as
regulatory substances acting on intestinal and peripheral target sites
of the organism. Indeed, it has been shown that bioactive peptides
derived from caseins, such as ß-casomorphins and phosphopeptides, can
be released during gastrointestinal passage (1
) and that,
after milk or yogurt ingestion, peptides can be detected in the plasma
of human adults (9
).
Many immunomodulatory peptides are derived from the main milk proteins,
the caseins, and they correspond mainly to residues 106–169 of bovine
-casein (caseinomacropeptides) and residues 63–68, 191–193,
193–202 of bovine ß-casein
(ß-CN)3
. Both suppressive and enhancing effects on immune variables have been
found (11
–14
).
In an earlier study it was shown that the mitogenic activity of a
polypeptidic fraction obtained by pepsin-chymosin treatment of
bovine caseins, on primed lymph node cells and unprimed spleen cells of
rats, was located in residues 193–209 of ß-CN (15
).
This C-terminal peptide of bovine ß-CN, named ß-CN (193–209),
can be obtained in a purified form in large amounts (16
).
Its effects on macrophages have not been investigated; however, these
cells play an important role in innate and adaptative immunity by their
capacity to produce a variety of inflammatory mediators and their
ability to present antigens and to ingest and kill microorganisms
(17
).
In the present study, we investigated the in vitro effects of the ß-CN (193–209) peptide on the expression of membrane markers as well as on the phagocytic activity and cytokine production of mouse macrophages derived in vitro from bone marrow precursors (BMDM). For comparison, the effects of lipopolysaccharide (LPS), a potent activator of macrophages, were analyzed in parallel.
We chose to study the effects of the milk-derived peptide on
macrophages from human flora-associated (HF) mice, and, because
intestinal flora modulates some macrophage properties
(18
, 19
), we compared their response with that of BMDM from
germfree (GF) mice.
MATERIALS AND METHODS
Obtainment of the ß-CN (193–209) peptide
ß-CN preparation.
The peptide ß-CN (193–209) was isolated from ß-casein prepared
using the method described by Manson and Annan (20
) with
the following modifications: after dissociation of ß-CN at low
temperature (4°C), microfiltration and ultrafiltration were used to
isolate ß-CN from depleted casein micelles (21
).
Preparation of ß-CN (193–209).
The method for isolation of ß-CN (193–209) was derived from the
procedure described by Bouhallab et al. (16
). Conditions
for hydrolyzing ß-CN were slightly modified for ß-CN concentration
(5 g/L), molar ratio chymosin/ß-CN (1/8000) and duration of
hydrolysis (2 h 30 min). Then, the reaction was stopped by heat
inactivation of the enzyme (80°C, 15 min). The pH of the mixture was
subsequently adjusted to 4.6 with 1 mol/L of HCl to precipitate and
remove by centrifugation (7000 x g for 20 min)
unhydrolyzed casein and large fragments derived from it. After
readjusting the pH to 6.5, the supernatant was ultrafiltered
(Spiral-wound UF cartridge S10T3 MWCO 3 Kda; Amicon, Lexington, MA) and
the ultrafiltrate was concentrated with a membrane (Filtron membrane 1
Kda) and then freeze-dried. The peptide was obtained with a purity
of 95% based on area obtained from reversed-phase HPLC profile.
Reversed-phase HPLC was carried out on a Vydac C18 column 218TO54
(Touzard & Matignon, Vitry sur Seine, France). Elution was obtained
with a linear gradient from 0 to 60% in acetonitrile containing 14.2
mmol/L of trifluoroacetic acid over 30 min at a flow rate 1 mL/min.
Absorbance was recorded at 214 nm. The peptide was identified by
sequencing and electrospray mass spectrometry as described by Bouhallab
et al. (16
).
The peptide sequence is tyr-gln-glu-pro-val-leu-gly-pro-val-arg-gly-pro-phe-pro-ile-ile-val, with a molecular mass of 1881 Da.
The peptide was reconstituted in endotoxin-free RPMI 1640 medium
and used at the concentration of 500 mg/L, which was the effective dose
on T-lymphocyte proliferation (15
).
Experimental animals.
Eight- to 10-wk-old female C3H/He GF mice, responsive to LPS, were
obtained from Centre de Développement des Techniques
Avancées pour l’Expérimentation Animale (Orléans,
France). They were maintained in sterile isolators (La Calhène,
France) and consumed ad libitum a commercial rodent diet (RO3–40; UAR,
Villemoisson sur Orge, France; 13400 kJ/kg, 220 g of protein/kg,
750 g of cereals and fat/kg and 30 g of vitamin and mineral
mixture/kg), sterilized by 
-irradiation (4 Mrad). Two experimental
groups of 15 mice were studied: GF and HF mice.
HF mice were obtained after two gastric inoculations, at a 24-h interval, of GF mice with 0.5 mL of a 10-2 dilution of a fresh human fecal homogenate prepared in an anaerobic glove box. To assess implantation of HF, fecal samples were collected once a week after the second oral inoculation, and the predominant microflora (i.e., >108 bacteria/g of intestinal contents) analyzed. Briefly, feces were suspended in a diluent in an anaerobic glove box and then serial 10-fold dilutions from 10-1 to 10-9 were prepared. From the appropriate dilutions, a 0.1-mL aliquot was then spread on a nonselective prereduced solid brain–heart infusion medium (Difco, Detroit, MI) supplemented with 5 g/L of yeast extract (Difco) and 5 mg/L of hemin (Sigma Chemical, St Quentin Fallavier, France). After 5 d at 37°C in anaerobic conditions, 96 colonies were randomly chosen and cultured again on brain–heart infusion medium plates. Genera and bacterial groups were recognized on the basis of colonial and cellular morphology, motility, spore formation, catalase production, Gram staining and oxygen sensitivity. As in the human fecal sample, Bacteroides (45%), Eubacterium (17%), Peptostreptococcus (24%), Clostridium (7%) and Plectridium (1%) were the strictly anaerobe bacteria found in dominant flora of HF mice, whereas Escherichia coli and Streptococcus were found in subdominant flora. GF mice were checked weekly for contamination with microorganisms. Mice were killed by cervical dislocation 3 wk after the last gastric inoculation.
Animal protocols were performed in accordance with the regulations of the French Ministry of Agriculture and Fisheries concerning protection of experimental animals (decision number 005698).
Obtainment of bone marrow-derived macrophages.
Bone marrow-derived macrophages were obtained as previously
described (18
). For each GF and HF group, bone marrow
cells from five mice were pooled and cultured for 7 d at 37°C in
the presence of recombinant macrophage colony-stimulating factor
(40 µg/L, LPS < 0.1 ng/µg; R&D Systems, Europ LTD, Abingdon,
UK), in cold RPMI 1640 medium containing 25 mmol/L of HEPES, 2 mmol/L
of glutamine, 5 x 10-5 mol/L of 2-mercaptoethanol, 1
x 105 IU/L of penicillin and 100 mg/L of streptomycin
(complete medium), supplemented with 100 mL/L of heat-inactivated
fetal calf serum without LPS (<0.06 µg/L; Sigma Chemical). More than
90% of the cells had macrophage morphology (large cells with irregular
outlines, abundant cytoplasm and oval or indented nucleus) as
determined on stained cytospin preparations; the contaminant cells were
lymphocytes.
Stimulation of bone marrow-derived macrophages. After 7 d in culture, the monolayers were washed with phosphate-buffered saline and cells from each pool were cultured in complete medium (control), in medium supplemented with 1 mg/L of LPS (E. coli, serotype 055: B5; Sigma Chemical) and in medium supplemented with 500 mg/L of ß-CN (193–209) peptide. Stimulations were performed in duplicate for 6 h for mRNA studies or over 24 h for surface phenotype determination, measurement of phagocytosis and cytokine secretion. Supernatants collected at 24 h were stored at -80°C.
Cell surface phenotype analysis. F4/80 (IgG2b, PE) and Mac-1 (M1/70, PE) antibodies were purchased from Caltag (San Francisco, CA), CD3 [29B, IgG2b, fluorescein isothiocyanate (FITC)], CD45R (13/2, IgG2a, FITC) and Ia molecule [OX6, IgG1, FITC, anti-major histocompatibility complex (MHC) class II] antibodies from Sigma Chemical.
Cells were stained as previously described (18
) and flow
cytometry analysis was performed using a FACSCALIBUR flow cytometer
(Becton Dickinson, Oxford, UK) equipped with a 488-nm argon laser. The
analysis was made on 10,000 events on each sample by using the Cell
Quest Program (Becton Dickinson). The data were expressed as a
percentage of stained cells.
Phagocytosis assays. One milliliter of complete medium supplemented with 50 mL/L of fetal calf serum and containing 2.5 x 107 fluorescent latex beads (Fluoresbrite carboxy Y.G, 2 µm; Polysciences, Warrington, PA) was added to the washed monolayers stimulated as described above. The plates were incubated at 37°C in a humidified atmosphere of 5% CO2 for 30 min. After two washes with cold phosphate-buffered saline, analysis was performed using a FACSCALIBUR flow cytometer. The flowcytometric fluorescence setting and fluorescence intensity of one FITC-latex bead were established using a suspension of FITC-latex beads in medium. In the assays, only the events showing a fluorescence intensity corresponding to the cumulative fluorescence of at least three FITC-latex beads were considered positive for phagocytic activity. The fluorescence histograms of cell number versus fluorescence intensity were analyzed. Quantification of phagocytosis was expressed according to the percentage of positive cells that had ingested at least three FITC-latex beads (phagocytic activity) and the mean number of ingested beads (phagocytic index) per each positive cell. It was established by electron microscopy that the beads were actually internalized by the cells rather than just attached to the plasma membrane (data not shown).
Cytokine bioassays.
Tumor necrosis factor (TNF) activity was measured in a cytolytic assay
using actinomycin D-treated L-929 cells as previously
described (22
).
IL-6 activity was determined in an IL-6-dependent B9 cell proliferation
assay, using methyl tetrazolium bromide for detection
(23
).
To express results in IU/L, titrations were compared with the
laboratory standard calibrated against international standards titered
at 4 x 107 IU/L for TNF- and 1 x 108 IU/L for IL-6 (National Institute for Biological
Standards and Controls, Potters Bar, UK). Samples and standards
were run in duplicate. The sensitivity of the assays was 1.6 x 105 IU/L for TNF- and 5 x 105 IU/L for
IL-6.
Cytokine immunoassays.
The concentrations of Il-1, IL-1ß and the biologically active
IL-12p70 heterodimer were selectively measured with a two-site
sandwich ELISA (Intertest-1X, -1ßX and -12X, respectively;
Genzyme, Cambridge, MA). Recombinant mouse IL-1, IL-1ß or IL-12
was used as the standard. The detection limit was 15 ng/L for IL-1,
10 ng/L for IL-1ß and 5 ng/L for IL-12. Each cytokine determination
was performed in duplicate.
RNA isolation and cDNA preparation.
After a 6-h stimulation with LPS or ß-CN (193–209) peptide,
macrophage supernatants were removed and total RNA was extracted using
Trizol-reagent (Life Technologies, Cergy-Pontoise, France).
This isolation procedure is an improvement to the single-step acid
guanidium thiocyanate-phenol-chloroform extraction method
(24
). Quantity of RNA was determined by measuring the
absorbance at 260 nm and purity by the 260/280 ratio.
Messenger RNA was then reverse-transcribed. Total RNA (1 µg) was mixed with desoxynucleoside triphosphate mixture (25 mmol/L each; Promega, Charbonnières, France) and 50 µmol/L of oligo dT12–18 (Bioprobe System Laboratories, Montreuil-sous-Bois, France) and incubated at 70°C for 10 min. Five units of avian myeloblastosis virus reverse transcriptase (Promega), 25 U of Rnase inhibitor (Rnasin; Promega) and 1x RT buffer (Promega) were added and the reaction volume was adjusted to 25 µL with diethylpyrocarbonate-treated water. The reaction mixture was incubated at 42°C for 90 min followed by heating for 3 min at 95°C. The resulting cDNA was stored at -20°C until use.
Polymerase chain reaction (PCR) procedure. The reaction mixture consisted in 1x PCR buffer [10 mmol/L of Tris HCl (pH 8.3), 50 mmol/L of KCl and 1.5 mmol/L of MgCl2], 33 pmol 3' and 5' specific primers4 (Life Technologies) for the different cytokines studied and desoxynucleoside triphosphate mixtures (1.25 mmol/L each). After layering with mineral oil, a hot start was applied at 95°C for 3 min before adding 4 U of high Taq DNA polymerase (Bioprobe System Laboratories). Conditions of the PCR were as follows: denaturation at 95°C for 2 min, primer annealing at 57°C for 2 min, and primer extension at 72°C for 2 min, ended with a terminal elongation of 10 min at 72°C. Thirty cycles were performed in a thermal cycler (model 480; Perkin-Elmer Cetus, Emeryville, CA). The numbers of PCR cycles were previously determined to generate PCR product during the exponential phase of amplification. The absence of contaminants was routinely checked by reverse transcription (RT)-PCR of negative control samples, in which the RNA samples were replaced with sterile water.
PCR products were visualized by electrophoresis on agarose gels (15 g/L, 1 mol/L Tris, 0.9 mol/L boric acid and 0.01 mol/L EDTA) stained with ethidium bromide, and the detected PCR amplicon was compared with a 100-bp ladder (Amersham Pharmacia Biotech, Orsay, France). Relative levels of PCR products were quantified by densitometric analysis of gel photographs (VISIOLAB, Biocom, Les Ulis, France). To compare the relative cytokine mRNA expression levels among samples, the values are presented as the ratio of the band intensity of the cytokine-specific RT-PCR product over that of the corresponding constitutively expressed ß2 microglobulin (ß2m) gene.
The conditions of RT-PCR were shown to provide reliable detection of twofold or greater differences in mRNA levels.
Statistical analysis.
For each group of 15 mice (GF or HF), data were obtained from three
pools of BMDM stimulated in duplicate. Within groups,
post-treatment data vs. baseline data as well as peptide treatment
data vs. LPS treatment data were analyzed by using Student’s paired
t test or the nonparametric test of Kruskall-Wallis
(25
). Comparisons between treatment effects in GF and HF
groups were performed on data from which the control value was
subtracted, using Student’s unpaired t test.
Differences were considered significant at P < 0.05.
RESULTS
Membrane marker expression.
The expression of Mac-1 (CD11b/CD18) and Ia antigen (MHC class II) did
not differ between unstimulated cells from GF and HF mice (Table 1
). In contrast, F4/80 expression, a marker of mature macrophages, was
slightly lower (P < 0.05) in unstimulated cells from
GF mice than in cells from HF mice (Table 1)
.
|
). Figure 1
shows typical flow cytometry profiles of marker expressions on cells
from GF and HF mice.
|
It seemed that there was a higher percentage of phagocytic cells in
unstimulated macrophages from GF mice than in those from HF mice
(P < 0.01), and peptide stimulation enhanced
significantly the percentage of positive cells and the phagocytic index
both in GF and HF mouse groups (P < 0.01; Table 2
). However, as seen for unstimulated cells (Table 2)
, the percentage of
phagocytic cells was higher for GF than for HF mice (P
< 0.01). The increase in phagocytic cells was greater than that
after LPS stimulation (250% increase vs. 160%, P < 0.01 for GF mice and 419% increase vs. 240%, P < 0.01 for HF mice; Table 2
). Figure 2
shows typical cytometry profiles of latex beads uptake after peptide
stimulation of cells from GF and HF mice.
|
|
LPS stimulation increased mRNA expression (Fig. 3
) and protein secretion (Fig. 4
) of the different cytokines tested in cells from GF and HF mice.
However, compared with results from GF mice, secretion by cells from HF
mice was reduced for IL-1 (85%), IL-1ß (88%) and IL-12 (54%;
Fig. 4
), although mRNA levels were similar to those in cells from GF
mice (Fig. 3)
.
|
|
;
however, compared with LPS data, mRNA expression was lowered 50% or
more for TNF- and IL-12p35 (Fig. 3)
. Secretion of IL-1, IL-1ß
and IL-12p70 was low, whereas IL-6 and TNF- were not induced
(Fig. 4)
.
Peptide stimulation of macrophages obtained from HF mice increased
cytokine mRNA levels (Fig. 3)
. Moreover, it induced IL-6, TNF- and
IL-12 secretion to levels significantly higher than those observed in
GF mice (Fig. 4)
. However, the ß-CN (193–209) peptide was a weaker
inducer of cytokine secretion than was LPS (Fig. 4)
, although the
levels of mRNA induced in BMDM from HF mice by both treatments were
similar (Fig. 3)
. Figure 5
shows representative gels of cytokine mRNA expression after peptide
stimulation of BMDM from GF and HF mice.
|
DISCUSSION
Various data demonstrate the presence of peptides with
immunomodulatory activities in milk proteins and some of them have been
shown to stimulate phagocytosis by mouse peritoneal macrophages
(11
, 12
, 26
). However, effects on other variables, such as
membrane markers and cytokines, have not been investigated.
In this study, we analyzed the effects of a peptide purified from bovine ß-CN, ß-CN (193–209), on several functions of murine macrophages in vitro derived from BMDM of two kinds of mice, differing by the intestinal digestive flora, i.e., GF and adult HF mice.
The peptide ß-CN (193–209) increased the expression of MHC class II
molecules in BMDM from GF and HF mice. Expression of these molecules is
a prerequisite for antigen presentation and stimulation of CD4
T-lymphocytes (27
) and their up-regulation is
likely to reflect a functional activation of macrophages
(17
). Stimulation by the peptide ß-CN (193–209) also
enhanced the percentage of phagocytic BMDM, whatever the bacterial
status of mice. Phagocytosis plays an important role in innate immunity
by destroying pathogens and in adaptive immunity by processing the
antigens (28
); thus, together with MHC class II antigen
up-regulation, the increase in phagocytic activity suggests that
the ß-CN (193–209) peptide could influence the specific immune
response.
We investigated the capacity of ß-CN (193–209) to induce the
production of the major proinflammatory and immunoregulatory cytokines:
IL-1, TNF- and IL-6, which are among the first cytokines produced in
response to pathogenic bacteria (29
) and IL-12, which
stimulates IFN- production in T and NK cells and directs the
development of CD4+ T-lymphocytes toward the
Th1 phenotype (30
). Despite an ability to induce notable
mRNA levels, the ß-CN (193–209) peptide was a very weak inducer of
cytokine secretion. This discrepancy between mRNA levels and protein
release may be related to message instability, absence of translation
or lack of secretion. Using flow cytometry to detect intracellular
cytokines, we observed that there was no intracellular retention of
cytokines (data not shown), suggesting regulation at
post-transcriptional level.
Compared with LPS, which is a potent activator of macrophages, the
peptide was a better stimulus of phagocytosis but a markedly lower
inducer of cytokine secretion. Membrane receptors for the peptide are
not known but they certainly are not the same as the LPS receptors;
consequently, the signaling pathways activated by the two stimuli may
be different, which could explain why results obtained with LPS and
ß-CN (193–209) differ in intensity. Moreover, the responses of
macrophages to a single stimulus are not regulated by the same
signaling pathway; for example, it has been shown that after LPS
stimulation, the signal transduction events leading to phagocytosis and
proinflammatory protein expression are distinct (31
).
Therefore, the signaling pathway leading to phagocytosis may be
activated by the peptide, whereas the one leading to cytokine secretion
is not fully primed. Contrary to the effects of LPS, the moderate
secretion of cytokines induced by the ß-CN (193–209) peptide could
be sufficient to exert physiological effects on innate immunity and on
the induction of specific immune responses without any
pro-inflammatory risk.
Peptide activity was investigated comparatively in macrophages
originating from GF and HF mice. It was surprising to find that BMDM
from GF mice had a higher phagocytic activity than cells from HF mice.
This observation is contradictory to previous studies reporting that
macrophages from GF mice had impaired functions (32
–34
);
however, this discrepancy may be due to the different origins of the
macrophages tested (bone marrow-derived vs. peritoneal) and/or the
mouse strain.
Although flora implantation had no stimulatory effect on basal MHC
class II antigen expression and basal cytokine levels, cells from HF
mice seemed to be more susceptible than cells from GF mice to the
peptide effects on these variables. Conversely, in response to LPS
stimulation, BMDM from HF mice secreted less IL-1, IL-1ß and IL-12
than BMDM from GF mice. Thus, it seems that depending on the stimulus
and the function studied, intestinal flora may have stimulatory or
inhibitory effects on macrophages. This observation confirms that the
digestive microflora influences the immune system of the host not only
at the intestinal (35
), but also at the systemic, level.
The mechanisms by which this peptide exerts its immunomodulatory
effects on macrophages are unknown. Other peptides derived from bovine
ß-CN, such as the tripeptide LLY (residues 191–193) and the
hexapeptide PGPIPN (residues 63–68), have been shown to stimulate in
vitro phagocytosis by murine peritoneal cells (4
). The
segment between residues 60 and 68 of ß-CN has been named the
"strategic zone" because it contains peptides endowed with
different biological potentialities (12
). The ß-CN
(193–209) peptide may belong to another strategic zone because this
sequence contains ß-casokinin-10 (residues 193–202), which is an
immunomodulatory peptide, suppressing or stimulating lymphocyte
proliferation, depending on the concentration and an inhibitor of the
angiotensin-converting enzyme (14
). Inhibitors of
angiotensin-converting enzyme prevent the inactivation of
bradykinin, which stimulates macrophages, enhances lymphocyte migration
and increases secretion of cytokines (36
). It is not known
whether the activity of ß-CN (193–209) can be attributed to the
193–202 fragment.
To exert effects in vivo, peptides must be released from the precursor
protein and reach their target sites. Some bioactive peptides derived
from milk proteins have been shown to be released in the organism under
physiological conditions (9
, 37
, 38
). Others have been shown
to exert beneficial physiological effects, such as control of
gastrointestinal functions or inhibition of the development of
infections in patients with pre-acquired immunodeficiency syndrome
(10
). The ß-CN (193–209) peptide has been identified in
the products of hydrolysis of ß-CN by Lactococcus lactis
(39
), the proteolytic system of which is comparable to
that of lactic acid bacteria present in human intestine
(40
). Consequently, this peptide might be produced in the
human digestive tract after milk consumption. However, in vitro
stimulation of macrophages required relatively high doses of peptide,
but due to the high quantity of casein in cow’s milk, we cannot rule
out the possibility that such levels might be obtained in vivo. To
ascertain this supposition, additional studies are needed to determine
the ß-CN (193–209) peptide concentration in intestinal lumen and
serum of mice fed bovine casein. In addition, this peptide could also
be produced commercially and used as an ingredient in functional foods.
In summary, this study showed that the ß-CN (193–209) peptide up-regulates MHC class II antigen expression on bone marrow-derived macrophages, increases their phagocytic activity and induces only a low release of cytokines. These effects suggest that the peptide ß-CN (193–209) might exert an anti-infectious immunostimulating activity without pro-inflammatory effects through a modulation of macrophage properties.
Furthermore, this study highlights the fact that GF and gnotobiotic experimental animal models are interesting tools to investigate the immunomodulatory effects of food components in a human digestive microbial environment.
ACKNOWLEDGMENTS
We thank Gwénaelle Henry for her help in the preparation of the peptide and Dr. Morgant for statistical analysis of the data.
FOOTNOTES
1 This work was funded in part by Action
Incitative Programmée nutrition et immunité
(Convention AIP 96/383/P00156 Institut National de la Recherche
Agronomique). 
3 Abbreviations used: ß-CN, ß-casein;
ß2m, ß2 microglobulin; BMDM, bone
marrow-derived macrophages; FITC, fluorescein isothiocyanate; GF,
germfree; HF, human flora; IL, interleukin; LPS, lipopolysaccharide;
MHC, major histocompatibility complex; PCR, polymerase chain reaction;
RT, reverse transcription; TNF, tumor necrosis factor.
4 The nucleotide sequences for murine 3' and 5'
primers, respectively, were as follows: TNF-, 5'
TCTCATCAGTTCTATGGCCC 3' and 5' GGGAGTAGACAAGGTACAAC 3'; IL-6, 5'
GTTCTCTGGGAAATCGTGGA 3' and 5' TGTACTCCAGGTAGCTATGG 3'; IL-1, 5'
CAGTTCTGCCATTGACCATC 3' and 5' TCTCACTGAAACTCAGCCGT 3'; IL-1ß, 5'
TTGACGGACCCCAAAAGATG 3' and 5' AGAAGGTGCTCATGTCCTCA 3'; IL-12p35, 5'
GATCATGAAGACATCACACGG 3' and 5' AGAATGATCTGCTGATGGTTG 3'; IL-12p40, 5'
CAGTACACCTGCCACAAAGGA 3' and 5' GTGTGACCTTCTCTGCAGACA 3';
ß2m, 5' TGACCGGCTTGTATGCTATC 3' and 5'
CAGTGTGAGCCAGGATATAG 3'.
Manuscript received 20 March 2001. Initial review completed 27 April 2001. Revision accepted 7 August 2001.
LITERATURE CITED
1. Schlimme, E. & Meisel, H. (1995) Bioactive peptides derived from milk proteins: structural, physiological and analytical aspects. Nahrung 39:1-20.[Medline]
2. Defilippi, C., Gomez, E., Charlin, V. & Silva, C. (1995) Inhibition of small intestinal motility by casein: a role of ß-casomorphins?. Nutrition 11:751-754.[Medline]
3. Yvon, M., Beucher, S., Guilloteau, P., Le Huerou-Luron, I. & Corring, T. (1994) Effects of caseinomacropeptide (CMP) on digestion regulation. Reprod. Nutr. Dev. 34:527-537.
4. Fiat, A. M., Migliore-Samour, D., Jolles, P., Drouet, L., Sollier, C. B. & Caen, J. (1993) Biologically active peptides from milk proteins with emphasis on two examples concerning antithrombotic and immunomodulating activities. J. Dairy Sci. 76:301-310.[Abstract]
5. Masuda, O., Nakamura, Y. & Takano, T. (1996) Antihypertensive peptides are present in aorta after oral administration of sour milk containing these peptides to spontaneously hypertensive rats. J. Nutr. 126:3063-3068.
6. Svedberg, J., de Haas, J., Leimenstoll, G., Paul, F. & Teschemacher, H. (1985) Demonstration of ß-casomorphin immunoreactive materials in in vitro digests of bovine milk and in small intestine contents after bovine milk ingestion in adult humans. Peptides 6:825-830.[Medline]
7. Lahov, E. & Regelson, W. (1996) Antibacterial and immunostimulating casein-derived substances from milk: casecidin, isracidin peptides. Food Chem. Toxicol. 34:131-145.[Medline]
8. Migliore-Samour, D., Floc’h, F. & Jolles, P. (1989) Biologically active casein peptides implicated in immunomodulation. J. Dairy Res. 56:357-362.[Medline]
9. Chabance, B., Marteau, P., Rambaud, J. C., Migliore-Samour, D., Boynard, M., Perrotin, P., Guillet, R., Jolles, P. & Fiat, A. M. (1998) Casein peptide release and passage to the blood in humans during digestion of milk or yogurt. Biochimie 80:155-165.[Medline]
10. Meisel, H. & Bockelmann, W. (1999) Bioactive peptides encrypted in milk proteins: proteolytic activation and thropho-functional properties. Antonie Van Leeuwenhoek 76:207-215.[Medline]
11. Parker, F., Migliore-Samour, D., Floc’h, F., Zerial, A., Werner, G. H., Jolles, J., Casaretto, M., Zahn, H. & Jolles, P. (1984) Immunostimulating hexapeptide from human casein: amino acid sequence, synthesis and biological properties. Eur. J. Biochem. 145:677-682.[Medline]
12. Migliore-Samour, D. & Jolles, P. (1988) Casein, a prohormone with an immunomodulating role for the newborn?. Experientia 44:188-193.[Medline]
13. Otani, H. & Hata, I. (1995) Inhibition of proliferative responses of mouse spleen lymphocytes and rabbit Peyer’s patch cells by bovine milk caseins and their digests. J. Dairy Res. 62:339-348.[Medline]
14. Kayser, H. & Meisel, H. (1996) Stimulation of human peripheral blood lymphocytes by bioactive peptides derived from bovine milk proteins. FEBS Lett 383:18-20.[Medline]
15. Coste, M., Rochet, V., Leonil, J., Molle, D., Bouhallab, S. & Tome, D. (1992) Identification of C-terminal peptides of bovine ß-casein that enhance proliferation of rat lymphocytes. Immunol. Lett. 33:41-46.[Medline]
16. Bouhallab, S., Mollé, D. & Léonil, J. (1993) Continuous hydrolysis of ß-casein in a membrane reactor: preparation of a bioactive peptide. Biotechnol. Lett. 15:697-702.
17. Unanue, E. R. & Allen, P. M. (1987) The basis for the immunoregulatory role of macrophages and other accessory cells. Science 236:551-557.
18. Nicaise, P., Gleizes, A., Sandre, C., Forestier, F., Kergot, R., Quero, A. M. & Labarre, C. (1998) Influence of intestinal microflora on murine bone marrow and spleen macrophage precursors. Scand. J. Immunol. 48:585-591.[Medline]
19. Nicaise, P., Gleizes, A., Sandre, C., Kergot, R., Lebrec, H., Forestier, F. & Labarre, C. (1999) The intestinal microflora regulates cytokine production positively in spleen-derived macrophages but negatively in bone marrow-derived macrophages. Eur. Cytokine Netw. 10:365-372.[Medline]
20. Manson, W. & Annan, W. D. (1971) The structure of a phosphopeptide derived from ß-casein. Arch. Biochem. Biophys. 145:16-26.[Medline]
21. Terre, E., Maubois, J. L., Brulé, G. & Pierre, A. (1987) Procédé d’obtention d’une matière enrichie en caséine bêta, appareillage pour la mise en oeuvre de ce procédé et application des produits obtenus par ce procédé comme aliments, compléments alimentaires ou additifs en industrie alimentaire et pharmaceutique ou dans la préparation de peptides à activités biologiques. Brevet FR 2 592:769.
22. Flick, D. A. & Gifford, G. E. (1984) Comparison of in vitro cell cytotoxic assays for tumor necrosis factor. J. Immunol. Methods 68:167-175.[Medline]
23. Aarden, L. A., De Groot, E. R., Schaap, O. L. & Lansdorp, P. M. (1987) Production of hybridoma growth factor by human monocytes. Eur. J. Immunol. 17:1411-1416.[Medline]
24. Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal. Biochem. 162:156-159.[Medline]
25. Siegel, S. (1956) Nonparametric Statistics 1956 McGraw-Hill New York, NY. .
26. Berthou, J., Migliore-Samour, D., Lifchitz, A., Delettre, J., Floc’h, F. & Jolles, P. (1987) Immunostimulating properties and three-dimensional structure of two tripeptides from human and cow caseins. FEBS Lett 218:55-58.[Medline]
27. Pullen, J. K., Eustis-Turf, E., Myers, M. J. & Schook, L. B. (1989) Regulation of MHC gene expression during the differentiation of bone marrow-derived macrophages. Cell. Immunol. 121:398-413.[Medline]
28. Franc, N. C., White, K. & Ezekowitz, R. A. (1999) Phagocytosis and development: back to the future. Curr. Opin. Immunol. 11:47-52.[Medline]
29. Tracey, K. J. & Cerami, A. (1993) Tumor necrosis factor, other cytokines and disease. Annu. Rev. Cell. Biol. 9:317-343.
30. Trinchieri, G. (1994) Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84:4008-4027.
31. Lee, D. J., Cox, D., Li, J. & Greenberg, S. (2000) Rac1 and Cdc42 are required for phagocytosis, but not NF-B-dependent gene expression, in macrophages challenged with Pseudomonas aeruginosa. J. Biol. Chem. 275:141-146.
32. Johnson, W. J. & Balish, E. (1980) Macrophage function in germ-free, athymic (nu/nu), and conventional-flora (nu/+) mice. J. Reticuloendothel. Soc. 28:55-66.[Medline]
33. Morland, B. & Midtvedt, T. (1984) Phagocytosis, peritoneal influx, and enzyme activities in peritoneal macrophages from germfree, conventional, and ex-germfree mice. Infect. Immun. 44:750-752.
34. Mitsuyama, M., Ohara, R., Amako, K., Nomoto, K. & Yokokura, T. (1986) Ontogeny of macrophage function to release superoxide anion in conventional and germfree mice. Infect. Immun. 52:236-239.
35. Moreau, M. C. & Gaboriau-Routhiau, V. (2000) Influence of resident intestinal microflora on the development and functions of the intestinal-associated lymphoid tissue. Fuller, R. Perdigon, G. eds. Probiotics 2000:69-114 Kluwer Academic Publishers Dordrecht, The Netherlands. .
36. Paegelow, I. & Werner, H. (1986) Immunomodulation by some oligopeptides. Methods Find. Exp. Clin. Pharmacol. 8:91-95.[Medline]
37. Umbach, M., Teschemacher, H., Praetorius, K., Hirschhauser, R. & Bostedt, H. (1985) Demonstration of a ß-casomorphin immunoreactive material in the plasma of newborn calves after milk intake. Regul. Pept. 12:223-230.[Medline]
38. Chabance, B., Jolles, P., Izquierdo, C., Mazoyer, E., Francoual, C., Drouet, L. & Fiat, A. M. (1995) Characterization of an antithrombotic peptide from -casein in newborn plasma after milk ingestion. Br. J. Nutr. 73:583-590.[Medline]
39. Juillard, V., Laan, H., Kunji, E. R., Jeronimus-Stratingh, C. M., Bruins, A. P. & Konings, W. N. (1995) The extracellular PI-type proteinase of Lactococcus lactis hydrolyzes ß-casein into more than one hundred different oligopeptides. J. Bacteriol. 177:3472-3478.
40. Kunji, E. R., Mierau, I., Hagting, A., Poolman, B. & Konings, W. N. (1996) The proteolytic systems of lactic acid bacteria. Antonie Van Leeuwenhoek 70:187-221.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
