![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Immunocompromised Host Section, Pediatric Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 and * Molecular and Clinical Nutrition Section, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892
3To whom correspondence should be addressed. E-mail: markL{at}intra.niddk.nih.gov.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
KEY WORDS: • ascorbic acid transporter • gene • exon • intron • polymorphism
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
. Humans rely upon dietary intake of vitamin C because,
unlike most mammals, they do not synthesize vitamin C de novo
(2)
. Vitamin C is accumulated within cells by two distinct
mechanisms involving transport of two different substrates
(3)
. In one mechanism, vitamin C is the transported
substrate and the process is sodium dependent. In the second mechanism,
oxidized vitamin C (dehydroascorbic acid) is transported independently
of sodium by one of three different glucose transporters and
immediately reduced intracellularly to vitamin C (4
–6)
.
Recently, the cDNA sequences were described for two distinct human
sodium (Na+)-dependent vitamin C transporters,
SVCT14
and SVCT2 (encoded by SLC23A2 and SLC23A1,
respectively) (7
–9)
. These human cDNA sequences were
determined using an amplification strategy based upon the previously
reported orthologs in rats, svct1 and svct2
(10)
. The cDNA sequences were first identified as
nucleobase transporters YSPL3 and YSPL2 (SVCT1 and SVCT2, respectively)
(11)
. Sequence homology between the deduced human cDNAs is
65% for the amino acid sequence and 58% for the nucleotide sequence,
scattered throughout the predicted coding region. Tissue expression
patterns differ between the genes. SLC23A2 is restricted to
absorptive intestinal and renal tissues and the liver, whereas
SLC23A1 is ubiquitously expressed in most cell types
(7
,9)
. Lastly, fluorescent in situ hybridization analysis
was used to determine the chromosomal location of the two human
transporters. SLC23A2 mapped to the long arm of chromosome 5
(5q31.2–31.3) (7)
and SLC23A1 mapped to the
short arm of chromosome 20 (20p12.2–12.3) (12)
.
The cDNA sequence of SLC23A2 had been described previously
with an open reading frame (ORF) of 1797 bases encoding a 598 amino
acid residue protein (7
–9)
. In this paper, we report the
gene structure of SLC23A2 and its transcription start point
(TSP). We searched for common polymorphisms, known as single nucleotide
polymorphisms (SNP) by resequencing the ORF and 5'/3' flanking regions
of the gene in two control populations, but did not find any.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
An amplification-based screening technique was used to identify bacterial artificial clones (BAC) containing the SLC23A2 gene from a commercial human genomic library (GenomeSystems, St. Louis, MO). Two sets of polymerase chain reaction (PCR) primers were used for the initial screening and isolation of a BAC clone. The first set corresponded to a region in the mid-portion of the cDNA, TGTCTACCGCTGGGGCAA (forward) and TGCAATAGCCATGATGTC (reverse), generating a 314-bp fragment. The second set of screening primers corresponded to a region in the carboxyl terminus of the cDNA, GTCTGATACAGTGGAAAG (forward) and TCAGACCTTGGTGCACAC (reverse), generating a 230-bp fragment.
Sequence analysis of BAC clones.
On the basis of the published cDNA sequence (8)
, short
oligonucleotide primers were generated to amplify regions of the gene
to be sequenced directly. Amplification reactions were performed with
the following: 0.5 µmol/L of each primer, 50 mmol/L
KCl, 10 mmol/L Tris-HCl, 2.5 mmol/L MgCl, and 200
µmol/L of dNTPs. PCR conditions included a 10-min
denaturing step at 95°C followed by 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. The predicted
amplicon sizes were confirmed by gel electrophoresis before direct
sequence analysis. Purified PCR products were sequenced bidirectionally
on an ABI377XL with ABI Prism dRhodamine terminator cycle sequencing
ready reaction kit with AmpliTaq DNA Polymerase, FS (Applied
Biosystems, Foster City, CA). Sequence data were analyzed using
AssemblyLign, and MacVector version 6.5 (both Oxford Molecular,
Madison, WI) and Sequencher 3.1.1 (Applied Biosystems). Repeat Masker2
(version 7/16/00;
http://ftp.genome.washington.edu/cgi-bin/RepeatMasker) was used to
perform a masked query of the entire gene sequence to determine
repetitive sequence elements. Similarly, the program Mat Inspector v2.2
(http://www.gsf.de/cgi-bin/matsearch2.pl) was utilized to identify
consensus sequence binding sites in the 320-bp upstream region
(13)
.
Southern blot hybridization.
The complete gene size and intron/exon sizes were confirmed by
sequential Southern blot analysis of the BAC clone digested with three
separate, rare, six-base cutting restriction endonucleases, BamHI,
Bgl II and Hind III (New England Biolabs, Beverly, MA). Individual
oligonucleotides, end-labeled with P-32 
-ATP (Amersham,
Arlington Heights, IL), were used to probe the blot under standard
conditions. Amplicons were sequenced to confirm all intron/exon
borders, all of which conformed to the AG/GT splice junction rule
(14)
.
Search for novel single nucleotide polymorphisms.
Possible SNP were identified by currently available bioinformatics.
Initially, the four separate, published human cDNA sequences were
aligned and compared. A publicly available program (SNPpipeline)
(http://lpgws.nci.nih.gov:82/perl/snp/snp_cgi.pl) (15)
was used to align and compare all expressed sequence tag (EST)
sequences containing portions of the SLC23A2 cDNA
sequence. All fragments were aligned and possible SNP identified for
validation in genomic DNA assays. As part of a large-scale National
Cancer Institute–sponsored effort to identify common SNPs, the Cancer
Genome Anatomy Project-Genetic Annotation Initiative (CGAP-GAI),
SNPs were identified by direct sequencing of 8 CEPH (Center d’Etude
Polymorphisme Humaine) Caucasian (CA) individuals. Separately, cDNA
derived from 16 anonymous African American (AA) blood donors were
analyzed. These were collected under an IRB approved protocol in the
Department of Transfusion Medicine, Clinical Center, NIH (courtesy of
Dr. Susan F. Leitman). Assays for validating possible SNPs were
designed for genomic DNA using flanking, unique oligonucleotides.
Start of transcription and analysis of 5' upstream region of SLC23A2 gene.
The initiation of the SLC23A2 transcript was estimated
by alignment of existing ESTs and comparison with the published
sequences (7
–9)
. The start of transcription was confirmed
by ribonuclease protection assay. The oligonucleotide probe for the
assay was made by PCR using two oligonucleotide primers,
TCCACTCCCTCTTTCTCCGC (forward) and GGCACAGGTTTGAGCAGTTCC (reverse),
which gave a 334-bp product. This product was cloned (Topo TA Cloning
Kit for Sequencing, Invitrogen, Carlsbad, CA), and a new 410-bp
oligonucleotide probe, which contained a T7 primer site, was made using
a vector specific primer, M13 forward, and the gene-specific
reverse primer. The T7 polymerase reaction and labeling of the primer
with radioactive nucleotides (P-32 
-CTP; Amersham) were performed
according to the directions of a commercially available kit
(Maxiscript, In vitro Transcription Kit, Ambion, Austin, TX). The
ribonuclease protection reaction was done with polyA RNA from human
intestine (Clontech, Palo Alto, CA) according to the directions from
another kit (RPA III, Ribonuclease Protection Assay, Ambion). Size
fractionation was determined by comparing the mobility pattern to
radiolabeled DNA standards (Promega, Madison, WI) on a denaturing 6%
polyacrylamide gel.
Novel sequence corresponding to the 5' upstream was determined by direct sequence analysis of the BAC clone using a modified version of standard cycle sequence technique (provided by GenomeSystems) using a short oligonucleotide primer GTCCTCCTGGGCCCTCAT.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
,17)
. In the reference clone,
there are eight repeats of a hexanucleotide repeat (CTGGGG) in intron
8.
The gene is organized into 14 separate exons, 13 of which include
coding sequence; there is an intron in the 3' untranslated region (UTR)
of 1568 bp (Fig. 1
and Table 1
). A combination of Southern blot analysis and sequence analysis of the
PCR-amplified fragments was used to define the exon/intron
boundaries, which conform to the GT/AG splice junction conventions
(14)
(Table 1)
. The sequence of each of the 14 exons was
confirmed by direct sequence analysis of fragments amplified from
control genomic DNA (Fig. 1)
. The composite exon sequence data confirm
the predicted product of translation, namely, 598 amino acids. The
sizes of individual coding exons varied between 68 bp (e.g., exon 4)
and 265 bp (e.g., exon 12). Interestingly, the largest exon of
434 bp was the last one, which contains 3' UTR sequence only. Notably,
all introns were relatively small; the largest was 1568 bp and the
smallest was 103 bp.
|
|
(Fig. 2
, Panel
A). This site mapped directly to the 5' end of the cDNA sequence reported
by Wang et al. (9)
, whereas the other sequences reported
were incomplete, terminating in the region between the start of
translation and the newly defined start of transcription. In the region
immediately upstream of the start of translation of the
SLC23A2 gene, 320 bp were sequenced and analyzed for
possible consensus binding sites for transcription binding factors
(13)
(Fig. 2
, Panel B). Relative to the A in
the initiation codon, there are several notable features, i.e., a
consensus site for a CAAT box between -64 bp and -53 bp; a TATA 1 box
between -189 bp and -180 bp; two overlapping AP-1 binding sites
between -57 bp and -47 bp and also -52 bp and -42 bp; and a site
for GATA1 between -92 bp and -78 bp.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
,17)
.
The start of transcription was mapped to -47 bp by
ribonuclease protection assay. This site correlated exactly with the 5'
end of the cDNA clone reported by Wang et al. (9)
. The 5'
sequence immediately upstream to the start of transcription is notable
for several features. First, there are several motifs frequently
associated with the start site, namely, a TATA box and a CAAT box.
There are no apparent binding sites for transcription factors specific
to either renal or intestinal expression. By mapping the primary
sequence, it is now possible to initiate functional studies targeted at
understanding the cis-acting elements that control
expression. This is especially important in a gene whose expression
profile is restricted to a small number of tissues.
With the completion of the first map of the human genome, the
opportunity to study the biological and clinical implications of
variations in known genes has emerged as a major initiative. In the
coming years, there will be intense effort to dissect the contribution
of variations in genes to disease susceptibility, outcome and
pharmacologic responses (19)
. To accomplish these goals,
characterization of common SNPs is a high priority because the SNP
variant is the most common form in the human genome. Currently, the
density of SNPs in the vicinity of genes has been estimated to be one
in every 1300 base pairs (20
–23)
.
We utilized two different approaches to find potential SNPs in the
SLC23A2 gene, i.e., direct sequence analysis of anonymous
reference subjects and mining existing genetic databases (e.g.,
employing the SNPipeline) (15)
. These approaches did not
identify a single common SNP in the coding region in two different
sample populations. Possible sites identified by the latter approach
were not confirmed in genetic analysis of sample control subjects. It
is possible that the discrepancies identified by the alignment of EST
sequences identified rarer variants (i.e., those with a frequency of
<1% or those that are specific to a small group or population). We
did align the published cDNA sequences and found a series of
discrepancies between our data and that of Faaland et al.
(11)
, suggesting sequence errors in the latter cDNA
clones. Thus, there was no evidence for the presence of a common SNP in
the ORF nor the 5' or 3' UTRs of the gene in two reference populations.
Our findings have interesting evolutionary and biological implications.
The combination of a compact genomic organization and absence of common
coding SNP in SLC23A2 suggests that the gene provides an
essential function and has not undergone significant variation. It is
possible that this reflects a conserved function that might be common
to similar orthologs. In this regard, comparison to other mammalian
orthologs will be informative and perhaps provide insights into the
gene, its organization and function. It is surprising that its size is
very small (<8 kb in total) in relation to the number of exons (14
total) and the observed paucity of repetitive sequence elements
(
18% overall). Still, SLC23A2 has a highly homologous
sodium-dependent transporter, SLC23A1, which has been
cloned from human and rat cDNA libraries. Preliminary data indicate
that the size and complexity of the related gene for SVCT2,
SLC23A1, is significantly larger than SLC23A2.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Indicates that the two first authors contributed
equally to this manuscript.
4 AA, African American; ATG, translation
initiation codon; BAC, bacterial artificial clones; CA, Caucasian; EST,
expressed sequence tags; MIR, mammalian interspersed repeat; ORF, open
reading frame; PCR, polymerase chain reaction; SINE, short interspersed
repeat; SNP, single nucleotide polymorphism; SVCT, sodium-dependent
vitamin C transporter; TSP, transcription start point; UTR,
untranslated region.
Manuscript received March 26, 2001. Initial review completed May 22, 2001. Revision accepted June 20, 2001.
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
1.
Levine M., Rumsey S. C., Daruwala R., Park J. B. & Wang Y. (1999) Criteria and recommendations for vitamin C intake. J. Am. Med. Assoc. 281:1415-1423.
2.
Nishikimi M., Fukuyama R., Minoshima S., Shimizu N. & Yagi K. (1994) Cloning and chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man. J. Biol. Chem. 269:13685-13688.
3.
Welch R. W., Wang Y., Crossman A., Jr, Park J. B., Kirk K. L. & Levine M. (1995) Accumulation of vitamin C (ascorbate) and its oxidized metabolite dehydroascorbic acid occurs by separate mechanisms. J. Biol. Chem. 270:12584-12592.
4.
Rumsey S. C., Kwon O., Xu G. W., Burant C. F., Simpson I. & Levine M. (1997) Glucose transporter isoforms GLUT1 and GLUT3 transport dehydroascorbic acid. J. Biol. Chem. 272:18982-18989.
5.
Rumsey S. C., Welch R. W., Garraffo H. M., Ge P., Lu S. F., Crossman A. T., Kirk K. L. & Levine M. (1999) Specificity of ascorbate analogs for ascorbate transport. Synthesis and detection of [(125)I\]6-deoxy-6-iodo-;1>l;0>-ascorbic acid and characterization of its ascorbate-specific transport properties. J. Biol. Chem. 274:23215-23222.
6.
Rumsey S. C., Daruwala R., Al-Hasani H., Zarnowski M. J., Simpson I. A. & Levine M. (2000) Dehydroascorbic acid transport by GLUT4 in Xenopus oocytes and isolated rat adipocytes. J. Biol. Chem. 275:28246-28253.
7. Wang H., Dutta B., Huang W., Devoe L. D., Leibach F. H., Ganapathy V. & Prasad P. D. (1999) Human Na(+)-dependent vitamin C transporter 1 (hSVCT1): primary structure, functional characteristics and evidence for a nonfunctional splice variant. Biochim. Biophys. Acta 1461:1-9.[Medline]
8. Daruwala R., Song J., Koh W. S., Rumsey S. C. & Levine M. (1999) Cloning and functional characterization of the human sodium-dependent vitamin C transporters hSVCT1 and hSVCT2. FEBS Lett 460:480-484.[Medline]
9. Wang Y., Mackenzie B., Tsukaguchi H., Weremowicz S., Morton C. C. & Hediger M. A. (2000) Human vitamin C (L-ascorbic acid) transporter SVCT1. Biochem. Biophys. Res. Commun. 267:488-494.[Medline]
10. Tsukaguchi H., Tokui T., Mackenzie B., Berger U. V., Chen X. Z., Wang Y., Brubaker R. F. & Hediger M. A. (1999) A family of mammalian Na+-dependent L-ascorbic acid transporters. Nature (Lond.) 399:70-75.[Medline]
11. Faaland C. A., Race J. E., Ricken G., Warner F. J., Williams W. J. & Holtzman E. J. (1998) Molecular characterization of two novel transporters from human and mouse kidney and from LLC-PK1 cells reveals a novel conserved family that is homologous to bacterial and Aspergillus nucleobase transporters. Biochim. Biophys. Acta 1442:353-360.[Medline]
12. Stratakis C. A., Taymans S. E., Daruwala R., Song J. & Levine M. (2000) Mapping of the human genes (SLC23A2 and SLC23A1) coding for vitamin C transporters 1 and 2 (SVCT1 and SVCT2) to 5q23 and 20p12, respectively. J. Med. Genet. 37:E20.[Medline]
13.
Quandt K., Frech K., Karas H., Wingender E. & Werner T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878-4884.
14.
Burset M., Seledtsov I. A. & Solovyev V. V. (2000) Analysis of canonical and noncanonical splice sites in mammalian genomes. Nucleic Acids Res 28:4364-4375.
15. Buetow K. H., Edmonson M. N. & Cassidy A. B. (1999) Reliable identification of large numbers of candidate SNPs from public EST data. Nat. Genet. 21:323-325.[Medline]
16. Makalowski W. (2000) Genomic scrap yard: how genomes utilize all that junk. Gene 259:61-67.[Medline]
17. Moyzis R. K., Torney D. C., Meyne J., Buckingham J. M., Wu J. R., Burks C., Sirotkin K. M. & Goad W. B. (1989) The distribution of interspersed repetitive DNA sequences in the human genome. Genomics 4:273-289.[Medline]
18. Antonarakis S. E. (1998) Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum. Mutat. 11:1-3.
19. Foster C. B. & Chanock S. J. (2000) Mining variations in genes of innate and phagocytic immunity: current status and future prospects. Curr. Opin. Hematol. 7:9-15.[Medline]
20. Sachidanandam R., Weissman D., Schmidt S. C., Kakol J. M., Stein L. D., Marth G., Sherry S., Mullikin J. C., Mortimore B. J., Willey D. L., Hunt S. E., Cole C. G., Coggill P. C., Rice C. M., Ning Z., Rogers J., Bentley D. R., Kwok P. Y., Mardis E. R., Yeh R. T., Schultz B., Cook L., Davenport R., Dante M., Fulton L., Hillier L., Waterston R. H., McPherson J. D., Gilman B., Schaffner S., Van Etten W. J., Reich D., Higgins J., Daly M. J., Blumenstiel B., Baldwin J., Stange-Thomann N., Zody M. C., Linton L., Lander E. S. & Attshuler D. (2001) A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature (Lond.) 409:928-933.[Medline]
21.
Wang D. G., Fan J. B., Siao C. J., Berno A., Young P., Sapolsky R., Ghandour G., Perkins N., Winchester E., Spencer J., Kruglyak L., Stein L., Hsie L., Topaloglou T., Hubbell E., Robinson E., Mittmann M., Morris M. S., Shen N., Kilburn D., Rioux J., Nusbaum C., Rozen S., Hudson T. J. & Lander E. S. (1998) Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science (Washington DC) 280:1077-1082.
22. Halushka M. K., Fan J. B., Bentley K., Hsie L., Shen N., Weder A., Cooper R., Lipshutz R. & Chakravarti A. (1999) Patterns of single-nucleotide polymorphisms in candidate genes for blood-pressure homeostasis. Nat. Genet. 22:239-247.[Medline]
23. Cargill M., Altshuler D., Ireland J., Sklar P., Ardlie K., Patil N., Shaw N., Lane C. R., Lim E. P., Kalyanaraman N., Nemesh J., Ziaugra L., Friedland L., Rolfe A., Warrington J., Lipshutz R., Daley G. Q. & Lander E. S. (1999) Characterization of single-nucleotide polymorphisms in coding regions of human genes. Nat. Genet. 22:231-238.[Medline]
This article has been cited by other articles:
|
|
 |
|
  G. Davey Smith and S. Ebrahim 'Mendelian randomization': can genetic epidemiology contribute to understanding environmental determinants of disease? Int. J. Epidemiol., February 1, 2003; 32(1): 1 - 22. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X174 Hinf I
DNA markers. Lane 1 is RNA probe hybridized with human intestinal
polyA-RNA and digested with RNase. Lane 2 is RNA probe digested by
RNase. Lane 3 is RNA probe alone. The RNA probe is 410 bp long. The
protected fragment is 41 bp long when adjusted for running property
differences between the DNA marker and RNA. Panel B:
sequence analysis of 320 bp immediately upstream of the initiation
start codon (ATG); 320 bp are shown in the figure. Possible consensus
binding sites for transcription binding factors (AP-1 and GATA1) are
indicated by boxes in the 320-bp upstream region of
SLC23A2. A CAAT and TATA box are each indicated by boxes
(13)