![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Department of Bioresource Science, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido 080-8555, Japan and * Laboratory of Food Biochemistry, Division of Applied Bioscience, Graduate School of Agriculture, Hokkaido University, Sapporo, Hokkaido 060-8589, Japan.
1To whom correspondence should be addressed.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: • rats • mushroom (Agaricus bisporus) fiber • sugar beet fiber • cholesterol • LDL receptor mRNA
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, Ripsin et al. 1992
). The hypocholesterolemic effect of plant fibers
may be due to fiber-induced alterations of intestinal absorption,
intestinal or pancreatic hormone secretion, lipoprotein metabolism,
bile acid metabolism, or fermentation by-products and their effects
on hepatic cholesterol synthesis (Kay 1982
).
Sonoyama et al. (1995)
reported that the plasma
cholesterol concentration was significantly lower in rats fed sugar
beet fiber than in those fed fiber-free or cholestyramine diets,
and this difference was due mainly to a lower HDL cholesterol
concentration. Short-chain fatty acids
(SCFA),2
particularly propionate, a fermentable metabolite of soluble fibers,
may be involved in lowering serum cholesterol concentrations
(Chen and Anderson 1984
).
Dietary cholesterol presumably suppresses hepatic LDL receptor
activity in hamsters (Ma et al. 1986
). The
rate-limiting enzyme in endogenous sterol biosynthesis is
3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, which
catalyzes the synthesis of mevalonate (Goldstein and Brown 1990
). The activity of HMG-CoA reductase is also regulated
by changes in the exogenous cholesterol concentration (Goldstein and Brown 1990
). Hara et al. (1999)
reported
that SCFA suppress cholesterol synthesis in rat liver and intestine.
However, they did not determine the effects of dietary fiber on the LDL
receptor mRNA and HMG-CoA reductase mRNA concentrations in liver.
Some mushrooms in Bisodiomycotina have the ability to lower serum
cholesterol concentration. It has been reported that hiratake
(Pleurotus ostreatus) lowers the serum cholesterol
concentration in rats (Bobek et al. 1996
) and that
mannentake (Ganoderma lucidum) can lower blood pressure and
serum cholesterol concentration of spontaneously hypertensive rats
(Kabir et al. 1988
). However, their results were due to
the antihyperliposis effect of the mushroom fruit body. In this study,
we examined the effects of diets containing mushroom (Agaricus
bisporus) fiber, sugar beet fiber and cellulose on serum lipids,
liver lipids, hepatic enzyme activity and hepatic mRNAs.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Male F344/DuCrj rats (8 wk old) were purchased from Charles River
Japan (Yokohama, Japan). Rats were housed individually in cages in a
room with a 12-h light:dark cycle. Temperature and humidity were
controlled at 23 ± 1°C and 60 ± 5%, respectively. The
rats were divided randomly into three groups of five. There were no
significant differences in body weights and serum total cholesterol
concentrations at the start of the experiment. The composition of each
diet is shown in Table 1
. The experimental groups were fed a diet that contained 50 g/kg of
mushroom fiber (MSF) or sugar beet fiber (BF) for 4 wk. The
compositions of the MSF and BF diets (g/100 g) were as follows:
moisture, 3 and 4.5; total dietary fiber, 50.3 (insoluble fiber, 47.0;
water-soluble fiber, 3.3) and 81.1 (insoluble fiber, 26.1;
water-soluble fiber, 55.0); protein (N x 6.25), 19.8 and 9.3;
lipid, 1.2 and 0.6; carbohydrate, 15.6 and 1.5; ash, 10.1 and 3.0,
respectively. Total dietary fiber, insoluble fiber, water-soluble
fiber, protein, lipid, carbohydrate, moisture and ash were determined
by AOAC procedures (AOAC 1990
). The control group
consisted of rats fed 50 g/kg of cellulose. The mushroom and sugar beet
fibers were kindly provided by Mr. Y. Kawasaki, from the agricultural
cooperative of Shihoro, Hokkaido, Japan and by Nippon Beet Sugar,
Hokkaido, Japan, respectively. The rats were allowed free access to
experimental diets and water for 4 wk. Body weight and food consumption
were recorded weekly and every day, respectively. All animal procedures
described conformed to NIH guidelines (NRC 1985
).
|
Blood samples (1 mL) were collected between 0800 and 1000 h from the jugular veins of food-deprived rats. The samples were drawn into tubes without an anticoagulant. After the samples stood at room temperature for 2 h, serum was prepared by centrifugation at 1500 x g for 20 min. At the end of the 4-wk experiment, all fecal excretions over a 2-d period were collected. Fecal dry weights did not differ among groups. The rats were killed by ether inhalation, and the livers quickly removed, washed with cold saline (9 g NaCl/L), blotted dry on filter paper and weighed before freezing for storage.
Chemical analysis.
Total cholesterol, HDL cholesterol and triglyceride (TG) concentrations in the serum were determined enzymatically using commercially available reagent kits (assay kits for the TDX system; Abbott Laboratory, Irving, TX). The VLDL + intermediate density lipoprotein (IDL) + LDL cholesterol concentration was calculated as follows: VLDL + IDL + LDL cholesterol = total cholesterol - HDL cholesterol.
Total lipids were extracted from liver and feces by a mixture of
chloroform/methanol (2:1, v/v) (Folch et al. 1957
). The
neutral steroid in each total lipid obtained by saponification was
acetylated (Matsubara et al. 1990
) and analyzed by
gas-liquid chromatography (GLC) using a Shimadzu 14A chromatograph
(Kyoto, Japan) with a DB17 capillary column (0.25 mm x 30 m; J&W
Scientific, Folsom, CA) with nitrogen as the carrier gas. Acidic
steroids in feces were measured by GLC following the method of
Grundy et al. (1965)
. A part of the cecum was taken out
into desalting water in a vial, without exposure to air, and suspended.
The suspension of cecum was deproteinized by perchloric acid (final
concentration 50 g/L) cooled in ice, and the supernatant was added to a
NaOH solution to precipitate perchloric acid and to form potassium
salts of the SCFA. Individual SCFA were measured by GLC with a glass
column (2000 mm x 3 mm) packed with 80–100 mesh chromosorb
W-AW DMCS with H3PO4 (100 mL/L) as the
liquid phase after the addition of H3PO4
according to the procedure of Hara et al. (1994)
.
Rat liver enzyme preparation.
The liver was homogenized in 2 volumes of cold medium containing 50 mmol/L KCl, 2 mmol/L MgCl2, 20 mmol/L Tris-HCl (pH 7.6) and 250 mmol/L sucrose in a Potter-Elvehjem–type homogenizer. After homogenization with only four strokes, the mixture was centrifuged at 1000 x g for 10 min, and the supernatant was then centrifuged at 12000 x g for 15 min. The supernatant from this centrifugation was further fractionated by centrifugation at 105000 x g for 60 min and the resulting pellet was called the microsomal (Ms) fraction. This Ms fraction was washed by centrifugation at 12000 x g for 15 min and then at 105000 x g for 60 min in the suspension medium, and finally suspended in 150 mmol/L KCl (pH 7.6) containing 1 mmol/L EDTA.
Determination of HMG-CoA reductase (EC 1.1.1.34) activity.
This procedure followed the method of Lippe et al. (1985)
with some modifications (Yu-Ito et al. 1982
). A 1.5-mg sample of protein was suspended in 200
µL of a solution containing 250 mmol/L NaCl, 50 mmol/L
potassium phosphate (pH 7.2), 10 mmol/L EDTA and 10 mmol/L
dithiothreitol (DTT). The sample was preincubated for 20 min at 37°C
and the reaction started by adding 25 µL of a solution
containing 300 mmol/L glucose-6-phosphate, 25 µL 30
mmol/L NADP, 1 IU glucose-6-phosphate dehydrogenase (EC
1.1.1.49) and 50 µL of 0.14 mmol/L
[314-C]HMG-CoA (740 MBq/L, specific activity 1.8
kBq/nmol). After 30 min incubation at 37°C, the reaction was stopped
with 0.1 mL of 2 mol/L HCl and the sample left for 30 min at 37°C to
allow lactonization of mevalonic acid. It was then cooled in ice and
centrifuged for 10 min at 3000 x g. To the
supernatant were added 10 µL of 0.5 mol/L
mevalonolactone (carrier) and 100 mg
Na2S2O3. The final pH of the
solution was 6.5. After double extraction with 2 mL of benzene, the
extract was applied to a silica-gel TLC plate and developed in
benzene/acetone (1:1, v/v). The silica gel of the mevalonolactone
region, detected with I vapor, was scraped off, transferred to a
scintillation vial containing Pico-aqua cocktail (Packard
Instrument, Meriden, CT) and the radioactivity measured with a
scintillation spectrometer (Packard Instrument, Downers Grove, IL).
Determination of cholesterol 7
-hydroxylase (EC 1. 14.13.17)
activity.
The procedure followed is described elsewhere (Fukushima and Nakano 1995
). Microsomal protein (1 mg) was added to a 0.1
mol/L potassium phosphate buffer (pH 7.4), 50 mmol/L NaF, 5 mmol/L DTT,
1 mmol/L EDTA, 200 g/L glycerol and 0.15 g/L
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate, and the
mixture was incubated for 5 min at 37°C. The reaction was initiated
by adding NADPH regeneration components, with final concentrations of 5
mmol/L sodium isocitrate, 5 mmol/L MgCl2, 0.5 mmol/L NADPH
and 0.075 U of isocitrate dehydrogenase, all in a final
reaction volume of 1.0 mL. The reaction mixture was incubated at 37°C
for 20 min, unless otherwise indicated, in a shaking (90 strokes/min)
water bath. The reaction was terminated by adding 30
µL of 200 g/L sodium cholate, and 1
µg of 7ß-hydroxycholesterol as an internal recovery
standard. The final reaction was initiated by adding 44
µL of 1 g/L cholesterol oxidase (EC 1.1.3.6) in a 10
mmol/L potassium phosphate buffer (pH 7.4) containing 1 mmol/L DTT and
200 g/L glycerol. This reaction mixture was incubated for 10 min at
37°C, and the reaction terminated by adding 2 mL of 950 g/L ethanol.
The cholesterol metabolites from this reaction mixture were extracted
by adding 6 mL of petroleum ether, vortexing, incubating at 37°C for
3 min and then centrifuging (1200 x g) for 3 min.
The upper ethereal layer was collected and dried at 40°C under a
nitrogen gas atmosphere. Residues from the various extractions were
analyzed by C-18 reverse-phase, HPLC (Shimadzu 10A), using a Zorbax
ODS (4.6 mm x 0.25 m, 5–6 µm MAC-MOD Analytical,
Ford, PA) column equilibrated with acetonitrile/methanol (7:3, v/v).
The residues were resuspended in 0.1 mL of the same solvent mixture,
and 0.02 mL was injected into the column. The metabolites were eluted
with the same solvent system at a flow rate of 0.8 mL/min. After 15
min, the flow rate was increased to 2.0 mL/min for 15 min. The amount
of product formed was determined by monitoring the absorbance of the
effluent at 240 nm and calculating the number of nanomoles from a
calibration curve.
RNA isolation, reverse transcriptase-polymerase chain reaction (RT-PCR) and Southern blot analysis.
Total RNA was isolated by the acid guanidium-phenol-choloroform
method, using Isogen (Nippon Gene, Tokyo, Japan) from liver
(Chomczynski and Sacchi 1987
). mRNA encoding
apolipoprotein (apo) B, LDL receptor, HMG-CoA reductase,
cholesterol 7-hydroxylase and GAPDH (used as an invariant control)
was analyzed by semiquantitative RT-PCR and subsequent Southern
hybridization of the PCR products with each inner oligonucleotide
probe. Total RNA samples were treated with DNase RQ1 (Promega, Madison,
WI) to remove genomic DNA and subjected to RT-PCR by using Moloney
murine leukemia virus reverse transcriptase (GIBCO, Gaithersburg, MD)
and EX-Taq polymerase (Takara, Tokyo, Japan) with apo B primers of
oligonucleotides (upstream primer, 5'-GAAAGCATGCTGAAAACAACC-3';
downstream primer, 5'-AGGCCTGACTCGTGGAAGAA-3'), LDL receptor primers of
oligonucleotides (upstream primer, 5'-ATTTTGGAGGATGAGAAGCAG-3';
downstream primer, 5'-CAGGGCGGGGAGGTGTGAGAA-3'), HMG-CoA reductase
primers of oligonucleotides (upstream primer,
5'-GCGTGCAAAGACAATCCTGGAG-3'; downstream primer,
5'-GTTAGACCTTGAGAACCCAATG-3'), cholesterol 7-hydroxylase of
oligonucleotides (upstream primer,
5'-GCCGTCCAAGAAATCAAGCAGT-3'; downstream primer,
5'-TGTGGGCAGCGAGAACAAAGT-3') and GAPDH primers of oligonucleotides
(up-stream primer, 5'-GCCATCAACGACCCCTTCATT-3', down-stream primer,
5'-CGCCTGCTTCACCACCTTCTT-3'). The reaction mixtures for the PCR
contained 25 pmol of each primer, 1.25 U EX-Taq
polymerase, 1x PCR buffer (Takara), and 200 µmol/L
dNTP in a 50-µL reaction volume. The expected sizes of
DNA fragments amplified with these primers were 725 bp for apo B, 931
bp for the LDL receptor, 245 bp for HMG-CoA reductase, 306 bp for
cholesterol 7-hydroxylase and 702 bp for GAPDH. Temperature cycling
was as follows: first cycle, denaturation at 94°C for 3 min,
annealing at 60°C for 1 min and extension at 72°C for 2 min.
Subsequent cycles were denaturation at 94°C for 1 min, annealing at
60°C for 1 min and extension at 72°C for 2 min. The thermal cycling
was completed by terminal extension at 72°C for 10 min. In total, 25
cycles were performed for the apo B and the LDL receptor
amplifications, 30 cycles for HMG-CoA reductase and cholesterol
7-hydroxylase, and 20 cycles for GAPDH. Amplification products were
electrophoresed on a 2% agarose gel, and transferred to a nylon
membrane (Biodyne B, Pall Bio-Support, East Hills, NY). Blots were
hybridized with an apo B probe of a 54-base oligonucleotide
(5'-TCCTTGCTTACCAAAAAGAGCTTCCAGTGTTGGCTCAAAGCCCTTTCCTTCTAA-3'),
LDL receptor probe of a 54-base oligonucleotide
(5'-GTGAACTTGGGTGAGTGGGCACTGATCTGAGGGGCAGGCAGGCACATGTACTGG-3'),
HMG-CoA reductase probe of a 54-base oligonucleotide
(5'-GATCTGTTGTGAACCATGTGACTTCTGACAAGATGTCCTGCTGCCAATGCTGCC,
cholesterol 7-hydroxylase probe of a 54-base oligonucleotide
(5'-CCCGAAGGCCTGTTTAAGTGATGACTCTCAGCCGCCAAGTGACATCATCCAGTG-3')
and GAPDH probe of a 54-base oligonucleotide
(5'-TGATGACCAGCTTCCCATTCTCAGCCTTGACTGTGCC GTTGAACTTGCCGTGGG-3'). The
probe was 3'-tailing labeled with digoxigenin, using a DIG
oligonucleotide tailing kit (Boehringer Mannheim, Germany).
Prehybridization, hybridization and detection were carried out with a
DIG luminescent detection kit (Boehringer Mannheim) as recommended by
the manufacturer. The relative quantity of mRNA was estimated by
densitometry scanning with X-ray film.
Statistical analysis.
Data are presented as means ± SD. The mean and SD for serum total cholesterol, HDL cholesterol, and VLDL + IDL + LDL cholesterol for each time point were calculated. The significance of differences among treatment groups was determined by ANOVA with Duncan’s multiple-range test (SAS Institute, Cary, NC). Differences were considered significant at P < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The cecal pH in the CP and MSF groups was significantly higher than
that in the BF group. Acetic acid, butyric acid and total SCFA
concentrations in the BF group were significantly higher than those in
the other groups (Table 2)
.
|
). The HDL cholesterol concentration in the MSF group was significantly
lower than that in the CP group, and there were no significant
differences in the triglyceride concentration among groups at the end
of the experiment (Table 3)
.
|
-hydroxylase [CP, MSF and BF: 29.5 ± 4.0, 24.2
± 7.2 and 26.8 ± 11.0 nmol/(h·mg protein), respectively]
activities among the groups at the end of the experimental period.
The relative quantities of mRNAs were determined by the Southern
hybridization of PCR-amplified HMG-CoA reductase cDNA, cholesterol
7-hydroxylase cDNA, apo B cDNA and LDL receptor cDNA in the rat
liver. The levels of HMG-CoA reductase, cholesterol 7
-hydroxylase, apo B and LDL receptor mRNAs were normalized to the
value of GAPDH. The values of the MSF- and BF-fed rats were
expressed relative to the mean values of the CP-diet group, which
were normalized to 100. The relative quantities of hepatic HMG-CoA
reductase mRNA (CP, MSF and BF: 100 ± 73, 122 ± 67 and 149
± 115, respectively), hepatic cholesterol 7 -hydroxylase mRNA
(CP, MSF and BF: 100 ± 38, 110 ± 33 and 127 ± 48,
respectively), and hepatic apo B mRNA (CP, MSF and BF: 100 ± 35,
138 ± 17 and 139 ± 45, respectively) were unaffected by
diets. The relative quantities of hepatic LDL receptor mRNA in the MSF
and BF groups were significantly higher than that in the CP group
(P < 0.05) (Fig. 1
). The hepatic LDL receptor mRNA level correlated negatively
(r = -0.721, P < 0.01) with the serum
VLDL + IDL + LDL cholesterol concentration (Fig. 2
).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
reported that a diet containing 150 g/kg sugar beet fiber reduced ileal
concentrations of apo A-I and apo A-IV mRNA in rats compared
with those in rats fed a fiber-free diet. However, in this study,
there were no significant differences in the HDL cholesterol
concentration between the CP and BF groups, and the discrepancy of the
previous and present results may be attributed to two factors, i.e.,
difference in the BF content of the treatment diets and composition of
the control diets. The HDL cholesterol concentration in the MSF group
was significantly lower than that in the CP group. It may be that MSF
reduces ileal concentrations of apo A-I and apo A-IV mRNA or
enhances liver HDL receptor activity, although there are no data on
ileal concentrations of apo A-I and apo A-IV mRNA or enhanced
liver HDL receptor activity. On the other hand, the LDL-receptor
mRNA level in the MSF and BF groups was significantly higher than that
in the CP group. One of the reasons for the lower serum VLDL + IDL +
LDL cholesterol concentrations in the MSF and BF groups may have been
elevation of the LDL receptor level, because the hepatic LDL receptor
mRNA level correlated negatively with the serum VLDL + IDL + LDL
cholesterol concentration. It has been reported that dietary fish oil
elevates hepatic LDL receptor activity in rats (Ventura et al. 1989
), and dietary high cholesterol and saturated fat suppress
hepatic LDL receptor mRNA in African green monkeys
(Sorici-Thomas et al. 1989
). However, there was no
correlation between plasma LDL cholesterol concentration and hepatic
LDL receptor mRNA (Sorici-Thomas et al. 1989
).
Furthermore, there are limited reports available on the relationship
between dietary fiber and hepatic LDL receptor mRNA. In this
experiment, we used a cholesterol-free diet to eliminate the
possibility of related diet effects on cholesterol metabolism in rats.
The elevation of the hepatic LDL receptor mRNA level observed in both
the MSF and BF fed rats is interesting.
There were no significant differences in the liver cholesterol
concentration, HMG-CoA reductase activity and HMG-CoA reductase
mRNA level among the groups. Hara et al. (1998)
reported
that the products of fermentation of BF by cecal bacteria lower the
plasma cholesterol concentration in rats and that SCFA, as fermentation
products, suppress cholesterol synthesis in the rat liver and intestine
(Hara et al. 1999
). On the other hand, it has been
reported that dietary fiber and the SCFA produced elevated hepatic
cholesterol synthesis (Levrat et al. 1994
,
Moundras et al. 1994
, Stark and Madar 1993
, Younes et al. 1995
). Although the SCFA
concentration was elevated in the cecum of rats fed BF in this study,
no effect of elevated SCFA on cholesterol synthesis in the rat liver
was demonstrated. Illman and Topping (1985)
reported
that raising cecal propionate concentration stimulates hepatic
cholesterol synthesis by increasing fecal steroid excretion;
Illman et al. (1993)
reported that cecal propionate
correlated negatively with plasma cholesterol concentration and
positively with cecal neutral steroids and bile acids. In this study,
there was no correlation between cecal SCFA and serum total
cholesterol, fecal cholesterol, fecal bile acid (r = -0.038, P > 0.05; r = -0.316,
P > 0.05; r = 0.502, 0.05 < P < 0.1, respectively). Furthermore, Evans et al. (1992)
reported that due to their chemical composition and
structure, dietary galactomannans lowered plasma cholesterol and
hepatic cholesterol synthesis. This may result from differences in the
chemical composition and structure of the MSF and BF, although these
data were not considered here.
Kubo and Nanba (1997)
reported that maitake’s
antihyperlipemia effect was due to the acceleration of cholesterol and
bile acid excretion, and of the conversion of cholesterol into bile
acids. Buhman et al. (1998)
reported that feeding
psyllium to rats enhanced fecal bile acid and total steroid excretion
as well as cholesterol 7-hydroxylase activity and cholesterol
7-hydroxylase mRNA levels. De Schrijver et al. (1992)
also reported that rat plasma total cholesterol concentration
diminished with oat bran intake; nonheated and baked oat bran had
comparable effects on plasma cholesterol, and an inverse linear
relationship (r = -0.80, P < 0.01)
was found between plasma cholesterol concentration and fecal excretion
of bile acids. However, it was not demonstrated that oat bran was
involved in accelerating cholesterol conversion into bile acid; there
were no significant differences in cholesterol 7-hydroxylase
activity and cholesterol 7-hydroxylase mRNA level among all groups
in this experiment. There were no correlations between the serum total
cholesterol concentration and fecal bile acid excretion or fecal
cholesterol excretion (r = 0.219, P > 0.05; r = -0.331, P > 0.05,
respectively).
In conclusion, the effects in rats of the mushroom fiber (Agaricus bisporus) and sugar beet fiber diets were evident compared with rats fed cellulose. The fibers elevated hepatic LDL receptor mRNA level in the MSF and BF groups, reduced the HDL cholesterol concentration in the MSF group and lowered serum total cholesterol and VLDL + IDL + LDL cholesterol concentrations in both groups.
|
FOOTNOTES |
|---|
Manuscript received January 18, 2000. Initial review completed February 14, 2000. Revision accepted April 12, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
1. American Institute of Nutrition Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J. Nutr. 1977;107:1340-1348
2. Association of Official Analytical Chemists Helrisk K. eds. Official Methods of Analysis 15th ed. 1990 AOAC Arlington, VA.
3. Bobek P., Ozdin L., Kuniak L. Effect of oyster mushroom (Pleurotus ostreatus) and its ethanolic extract in diet on absorption and turnover of cholesterol in hypercholesterolemic rat. Nahrung 1996;40:222-224[Medline]
4.
Buhman K. K., Furumoto E. J., Donkin S. S., Story J. A. Dietary psyllium increases fecal bile acid excretion, total steroid excretion and bile acid biosynthesis in rats. J. Nutr. 1998;128:1199-1203
5. Chen W. J., Anderson J. W. Propionate may mediate the hypocholesterolemic effects of certain soluble plant fibers in cholesterol-fed rats. Proc. Soc. Exp. Biol. Med. 1984;175:215-218[Medline]
6. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-159[Medline]
7. De Schrijver R., Fremaut D., Verheyen A. Cholesterol-lowering effects and utilization of protein, lipid, fiber and energy in rats fed unprocessed and baked oat bran. J. Nutr. 1992;122:1318-1324
8. Evans A. J., Hood R. L., Oakenfull D. G., Sidhu G. S. Relationship between structure and function of dietary fiber: a comparative study of the effects of three galactomannans on cholesterol metabolism in the rats. Br. J. Nutr. 1992;68:217-229[Medline]
9.
Folch J., Lees M., Sloane-Stanley G. H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957;226:497-509
10. Fukushima M., Nakano M. Effects of the lipid-saccharide complex and unsaponifiable matter from sunflowers on liver lipid metabolism and intestinal flora in rats. Biosci. Biotechnol. Biochem. 1995;59:860-863[Medline]
11. Goldstein J. L., Brown M. S. Regulation of the mevalonate pathway. Nature (Lond.) 1990;343:425-430[Medline]
12. Grundy S. M., Ahrens E. H., Jr, Miettinen T. A. Quantitative isolation and gas-liquid chromatographic analysis of total fecal bile acids. J. Lipid Res. 1965;6:397-410[Abstract]
13.
Hara H., Haga S., Aoyama Y., Kiriyama S. Short-chain fatty acids suppress cholesterol synthesis in rat liver and intestine. J. Nutr. 1999;129:942-948
14.
Hara H., Haga S., Kasai T., Kiriyama S. Fermentation products of sugar-beet fiber by cecal bacteria lower plasma cholesterol concentration in rats. J. Nutr. 1998;128:688-693
15. Hara H., Saito Y., Nakashima H., Kiriyama S. Evaluation of fermentability of acid-treated maize husk by rat caecal bacteria in vivo and in vitro. Br. J. Nutr. 1994;71:719-729[Medline]
16. Illman R. J., Storer G. B., Topping D. L. White wheat flour lowers plasma cholesterol and increases cecal steroids relative to whole wheat flour, wheat bran and wheat pollard in rats. J. Nutr. 1993;123:1094-1100
17. Illman R. J., Topping D. L. Effects of dietary oat bran on faecal steroid excretion, plasma volatile fatty acids and lipid synthesis in the rat. Nutr. Res. 1985;5:839-846
18. Kabir Y., Kimura S., Tamura T. Dietary effect of Ganoderma lucidum mushroom on blood pressure and lipid levels in spontaneously hypertensive rats (SHR). J. Nutr. Sci. Vitaminol. 1988;34:433-438
19. Kay R. M. Dietary fiber. J. Lipid Res. 1982;23:221-242[Abstract]
20. Kubo K., Nanba H. Anti-hyperliposis effect of maitake fruit body (Grifola frondosa). Biol. Pharm. Bull. 1997;20:781-785[Medline]
21. Levrat M. A., Favier M. L., Moundras C., Rémésy C., Demigné C., Morand C. Role of dietary propionic acid and bile acid excretion in the hypocholesterolemic effects of oligosaccharides in rats. J. Nutr. 1994;124:531-538
22. Lippe G., Deana R., Cavallini L., Galzigna L. Inhibition of rat liver hydromethylglutaryl-CoA reductase by sulfhydryl reagents, coenzyme A esters synthetic compounds. Biochem. Pharmacol. 1985;34:3293-3297[Medline]
23.
Ma P. T., Gil G., Südhof T., Bilheimer D. W., Goldstein J. L., Brown M. S. Mevinolin, an inhibitor of cholesterol synthesis, induces mRNA for low density lipoprotein receptor in livers of hamsters and rabbits. Proc. Natl. Acad. Sci. U.S.A. 1986;83:8370-8374
24. Matsubara Y., Sawabe A., Iizuka Y. Structures of new linoroid glycosides in lemon (Citrus limon Burm. f.) peelings. Agric. Biol. Chem. 1990;54:1143-1148
25. Moundras C., Behr S. R., Demigné C., Mazur A., Rémésy C. Fermentable polysaccharides that enhance fecal bile acid excretion lower plasma cholesterol and apolipoprotein E-rich HDL in rats. J. Nutr. 1994;124:2179-2188
26. National Research Council Guide for the Care and Use of Laboratory Animals 1985 National Institutes of Health Bethesda, MD. Publication no. 85–23 (rev.)
27.
Olson B. H., Anderson S. M., Becker M. P., Anderson J. W., Hunninghake D. B., Jenkins D.J.A., LaRosa J. C., Rippe J. M., Roberts D.C.K., Stoy D. B., Summerbell C. D., Stewart Truswell A., Wolever T.M.S., Morris D. H., Fulgoni V. L., III Psyllium-enriched cereals lower blood total cholesterol and LDL cholesterol, but not HDL cholesterol, in hypercholesterolemic adults: results of a meta-analysis. J. Nutr. 1997;127:1973-1980
28. Ripsin C. M., Keenan J. M., Jacobs D. R., Jr, Elmer P. J., Welch R. R., Van Horn L., Liu K., Turnbull W. H., Thye F. W., Kestin M. Oat products and lipid lowering. A meta-analysis. J. Am. Med. Assoc. 1992;24:3317-3325
29. Sonoyama K., Nishikawa H., Kiriyama S., Niki R. Apolipoprotein mRNA in liver and intestine of rats is affected by dietary beet fiber or cholestyramine. J. Nutr. 1995;125:13-19
30.
Sorci-Thomas M., Wilson M. D., Johnson F. L., Williams D. L., Rudel L. L. Studies on the expression of genes encoding apolipoproteins B 100 and B 48 and the low density lipoprotein receptor in nonhuman primates. J. Biol. Chem. 1989;264:9039-9045
31. Stark A. H., Madar Z. In vitro production of short-chain fatty acids by bacterial fermentation of dietary fiber compared with effects of those fibers on hepatic sterol synthesis in rats. J. Nutr. 1993;123:2166-2173
32. Ventura M. A., Woollett L. A., Spady D. K. Dietary fish oil stimulates hepatic low density lipoprotein transport in the rat. J. Clin. Investig. 1989;84:528-537
33. Younes H., Levrat M. A., Demigné C., Rémésy C. Resistant starch is more effective than cholestyramine as a lipid-lowering agent in the rat. Lipids 1995;30:847-853[Medline]
34. Yu-Ito R., Oba K., Uritani I. Some problems in the assay method of HMG-CoA reductase activity in sweet potato in the presence of other HMG-CoA utilizing enzymes. Agric. Biol. Chem. 1982;46:2087-2091
This article has been cited by other articles:
|
|
 |
|
  T. C. Rideout, Z. Yuan, M. Bakovic, Q. Liu, R.-K. Li, Y. Mine, and M. Z. Fan Guar Gum Consumption Increases Hepatic Nuclear SREBP2 and LDL Receptor Expression in Pigs Fed an Atherogenic Diet J. Nutr., March 1, 2007; 137(3): 568 - 572. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Hapon, S. M. Varas, G. A. Jahn, and M. S. Gimenez Effects of hypothyroidism on mammary and liver lipid metabolism in virgin and late-pregnant rats J. Lipid Res., June 1, 2005; 46(6): 1320 - 1330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ramjiganesh, S. Roy, H. C. Freake, J. C. McIntyre, and M. L. Fernandez Corn Fiber Oil Lowers Plasma Cholesterol by Altering Hepatic Cholesterol Metabolism and Up-Regulating LDL Receptors in Guinea Pigs J. Nutr., March 1, 2002; 132(3): 335 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Fukushima, T. Ohashi, Y. Fujiwara, K. Sonoyama, and M. Nakano Cholesterol-Lowering Effects of Maitake (Grifola frondosa) Fiber, Shiitake (Lentinus edodes) Fiber, and Enokitake (Flammulina velutipes) Fiber in Rats Experimental Biology and Medicine, September 1, 2001; 226(8): 758 - 765. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
