Journal of Nutrition LabDiet, Your World of Nutritional Answers

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, K.
Right arrow Articles by Toraya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, K.
Right arrow Articles by Toraya, T.
(Journal of Nutrition. 2000;130:1894-1900.)
© 2000 The American Society for Nutritional Sciences


Article

Extremely Low Activity of Methionine Synthase in Vitamin B-12–Deficient Rats May Be Related to Effects on Coenzyme Stabilization Rather than to Changes in Coenzyme Induction

Kazuhiro Yamada, Tetsunori Kawata*, Masahiro Wada{dagger}, Tomoko Isshiki*, Junko Onoda*, Tomiko Kawanishi*, Akiko Kunou*, Tadahiro Tadokoro{dagger}, Takamasa Tobimatsu, Akio Maekawa{dagger} and Tetsuo Toraya1

Faculty of Engineering and * Faculty of Education, Okayama University, Okayama 700-8530, Japan and {dagger} Faculty of Applied Bioscience, Tokyo University of Agriculture, Setagaya-ku, Tokyo 156-8502, Japan

1To whom correspondence should be addressed.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Severely vitamin B-12 (B-12)–deficient rats were produced by feeding a B-12–deficient diet. The status of B-12 deficiency was confirmed by an increase in urinary methylmalonate excretion and decreases in liver B-12 concentrations and cobalamin-dependent methionine synthase activity. Rat liver methionine synthase existed almost exclusively as the holoenzyme. In B-12–deficient rats, the level of methionine synthase protein was lower, although the mRNA level was not significantly different from that of control rats. When methylcobalamin, the coenzyme for methionine synthase, was administered to the B-12–deficient rats, growth, liver B-12 concentrations and urinary excretion of methylmalonate were reversed although not always to control (B-12–sufficient) levels in a short period. During this recovery process, methionine synthase activity and its protein level increased, whereas the mRNA level was unaffected. We reported previously that rat apomethionine synthase is very unstable and is stabilized by forming a complex with methylcobalamin. Thus, the extremely low activity of methionine synthase in B-12–deficient rats may be related to effects on "coenzyme stabilization" (stabilization of the enzyme by cobalamin binding) rather than to changes in "coenzyme induction."


KEY WORDS: • vitamin B-12 • cobalamin • methionine synthase • vitamin B-12 deficiency • rats


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cobalamin (Cbl)2 is the predominant form of vitamin B-12 (B-12) compounds (corrinoids) occurring in nature. It serves as a cofactor for two enzymes in mammalian cells (Kolhouse and Allen 1977Citation , Mellman et al. 1977Citation ). One is adenosylcobalamin (AdoCbl)-dependent methylmalonyl-CoA mutase, which catalyzes the interconversion between methylmalonyl-CoA and succinyl-CoA. This enzyme is needed for the pathways involving propionyl-CoA, such as the metabolism of odd-chain fatty acids and branched-chain amino acids. Methylmalonic aciduria is the disease resulting from dysfunction of methylmalonyl-CoA mutase. The urinary level of methylmalonic acid (MMA) is thus used as a specific marker for B-12 deficiency except for the cases of inborn errors of methylmalonyl-CoA mutase and Cbl metabolism (Fenton and Rosenberg 1978Citation ). The other enzyme is methylcobalamin (MeCbl)-dependent methionine synthase, which catalyzes the methyl transfer from 5-methyltetrahydrofolate (MeH4F) to homocysteine, forming tetrahydrofolate (H4F) and methionine (Banerjee and Matthews 1990Citation ). Methionine synthase plays an indispensable role in both folate and methionine metabolism. A defect of methionine synthase causes hyperhomocyst(e)inemia. Elevated homocyst(e)ine in blood is believed to be a risk factor for cardiovascular diseases (McCully 1969Citation ) and neural tube defects (Steegers-Theunissen et al. 1991Citation ).

During catalysis by methionine synthase, Cbl acts as an intermediate methyl carrier. The intermediate cob(I)alamin is highly nucleophilic and easily oxidized to cob(II)alamin under aerobic conditions (Banerjee and Matthews 1990Citation ). Because the enzyme containing cob(II)alamin is catalytically inactive, methionine synthase requires strictly anaerobic conditions for full activity (Chen et al. 1995Citation ). The oxidatively inactivated enzyme requires S-adenosylmethionine (AdoMet) and a reducing system for reactivation. The physiologic partners for this reactivation are two proteins, F and R, and NADPH in Escherichia coli (Fujii and Huennekens 1974Citation ). Recently, human cDNA for methionine synthase reductase was cloned (Leclerc 1998Citation ). Gulati et al. (1997)Citation reported, however, that the physiologic partners required for this reductive activation of the mammalian enzymes are at least two proteins, as in E. coli. Chemical reducing agents, such as aquacobalamin (aqCbl)/dithiothreitol (DTT), the fully reduced form of riboflavin 5'-phosphate (FMNH2) and titanium(III) citrate, are used for an in vitro assay of methionine synthase.

Although B-12–deficient animals are useful for elucidating physiologic functions of B-12, it is difficult to keep them in severe dietary B-12 deficiency. Because nitrous oxide is a specific inhibitor for methionine synthase both in vitro (Drummond and Matthews 1994Citation ) and in vivo (Deacon et al. 1978Citation ), nitrous oxide-exposed animals are often used as models of B-12-deficiency due to methionine synthase dysfunction. We bred B-12–deficient rats under strictly controlled feeding conditions (Doi et al. 1989aCitation ). The liver B-12 concentrations of these rats are <5% those of control rats. Other B-12–deficient models with markedly decreased B-12 levels include rats (Watanabe et al. 1991Citation ), fruit bats (Metz and Westhuyzen 1987Citation ) and sheep (Kennedy et al. 1990Citation ). B-12 deficiency results from cobalt deficiency in sheep. We reported previously the effects of dietary B-12 deficiency on methionine metabolism (Doi et al. 1989aCitation and 1989bCitation ), protein efficiency (Kawata et al. 1995Citation ), testicular morphology (Kawata et al. 1992Citation ) and plasma C3 concentrations (Wada et al. 1998Citation ) in rats.

We found that methionine synthase activity in strictly B-12–deficient rats is extremely low (Doi et al. 1989aCitation ). In this paper, we attempted to determine how the enzyme activity is lowered in B-12 deficiency by examining the relationship between B-12 status and methionine synthase activity. We also examined levels of the enzyme protein and the mRNA expressed in livers of B-12-deficient rats because liver is one of the most important organs for both methionine metabolism and Cbl storage. Recently, Chen et al. (1997)Citation reported relative levels of methionine synthase mRNA in human tissues. Gulati et al. (1999)Citation demonstrated with cultured cells that supplementation of B-12 to the culture enhances methionine synthase activity by post-transcriptional regulation. However, it is difficult to study effects of strict B-12 deficiency on the enzyme protein and mRNA levels with cultured cells because B-12 bound to transcobalamin II (TCII) in serum is inevitably taken up by the cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals.

Male and female Wistar rats (10 wk old) were purchased as parent rats from Clea, Tokyo, Japan and fed a B-12–deficient diet containing soybean oil during pregnancy and lactation (Doi et al. 1989aCitation ). The composition of this diet was the same as that described in Table 1Citation , except that soybean protein isolate was increased to 250 g/kg of diet, glucose (anhydrous) decreased to 603.5 g/kg of diet and 100 g of soybean oil/kg of diet (Wako Pure Chemicals, Osaka, Japan) used instead of lard. Male rats born to these dams were used in the following experiments. Newborn rats, weaned on d 23 after birth, were divided into experimental groups. Each rat had free access to the food and water. Fresh diet was provided daily. The room was maintained at a constant temperature (22 ± 3°C) with a 12-h light:dark cycle. Rats were housed individually in stainless steel screen-bottomed cages or metabolic cages when necessary.


View this table:
[in this window]
[in a new window]
 
Table 1. Composition of vitamin-B-12–deficient diet

 
Diets.

The B-12–deficient diet was prepared according to our previous paper (Doi et al. 1989aCitation ), except that concentrations of minerals and vitamins were as in the AIN-76 diet (AIN 1977Citation ). The composition of diet is shown in Table 1Citation ; the diet was in powdered form and stored at 4°C. B-12–supplemented (control) rats were fed 1 µg of cyanocobalamin/d (Wako Pure Chemicals) by oral administration of a 50-µL solution. During pregnancy and lactation, the dams were fed the B-12–deficient diet containing soybean oil; the composition of the diet is described above.

Experimental design.

Two independent experiments were conducted as follows. Both experiments were performed with control, B-12–deficient and MeCbl-administered B-12–deficient rats. In recovery tests with MeCbl-administered groups, the rats were fed 0.1 µg/g body MeCbl (Eizai, Tokyo, Japan) by intraperitoneal injection. In Experiment 1, MeCbl was injected three times (160, 108 and 60 h before killing) to B-12–deficient rats. These three groups of rats were fed for 90 d after weaning. In Experiment 2, B-12–deficient rats were given a single, intraperitoneal injection of MeCbl 20 or 40 h before killing. These rats were fed for 120 d.

After collection of blood from hearts of rats under anesthesia (Somnopentyl; pentobarbital sodium, 64.8 g/L; Pitman-Moore, Mundelein, IL), liver was removed. The liver samples were frozen in liquid nitrogen immediately after killing and stored until use at -80°C for enzyme and mRNA assays and at -20°C for determination of B-12 concentrations. The protocols complied with the Guideline for Animal Experimentation (Japanese Association for Laboratory Animal Science 1987Citation ).

Determination of urinary MMA and liver B-12 concentrations.

Urine was collected from rats in metabolic cages for 24 h, filtered and stored at -20°C until use. Urinary levels of MMA and creatinine were determined by the colorimetric methods of Giorgio and Plaut (1965)Citation and Cook (1971)Citation , respectively. MMA excretion data were expressed as mol MMA/mol creatinine.

B-12 concentrations were determined by a microbiological assay using Lactobacillus delbrueckii lactis (formerly Lactobacillus leichmannii) ATCC 7830 (AOAC 1990Citation ). The medium for L. delbrueckii lactis was purchased from Nissui Pharmaceutical, Tokyo, Japan. B-12 was extracted from rat liver by boiling in the presence of KCN (Hayashi et al. 1960Citation ), essentially as described by Frenkel et al. (1980)Citation .

Methionine synthase activity.

Methionine synthase activity was determined with Ti(III) citrate as a reducing agent, as described by Chen et al. (1995)Citation . Ti(III) citrate was prepared from TiCl3 (Nacalai tesque, Kyoto, Japan) by the method of Zehnder and Wuhrmann (1976)Citation . MeH4F barium salt was obtained from Sigma-Aldrich, St-Louis, MO.

A portion of rat liver (~0.5 g) was homogenized in 5 volumes of 0.15 mol/L potassium phosphate buffer (pH 7.2) by a glass-Teflon homogenizer with an ice-cold jacket. After centrifugation (100,000 x g) of liver homogenate at 4°C for 1 h, the supernatant was used as crude extract.

The holoenzyme activity was determined in duplicate for each rat. Reaction mixtures contained 0.56 mmol/L homocysteine (Sigma-Aldrich), 40 µmol/L AdoMet (Sigma-Aldrich), 2 mmol/L Ti(III) citrate, 160 µmol/L [methyl-14C]MeH4F (Amersham Pharmacia Biotech, Uppsala, Sweden) (33.3 Bq/nmol), crude extract and 0.15 mol/L potassium phosphate buffer (pH 7.2) in a total volume of 250 µL. The enzyme reaction was carried out under a H2 atmosphere at 37°C for 10 min and then stopped by quick chilling and the addition of 2 volumes of ice-cold water. The mixture was passed through the Dowex 1 (Cl-) (Dow Chemical, Midland, MI) column, and 14C radioactivity in the methionine-containing fraction was measured. The total activity was determined by the same procedure as the holoenzyme activity, except that 50 µmol/L MeCbl was added to the reaction mixture.

Protein was assayed by the colorimetric method of Bradford (1976)Citation using bovine serum albumin as a standard.

Western blot analysis.

Liver extracts of control, B-12–deficient and MeCbl-administered rats were examined for levels of methionine synthase protein by Western blot analysis with rabbit anti-rat methionine synthase antiserum. The extracts were applied (50 µg proteins/lane) and subjected to SDS-PAGE on a 50 g/L acrylamide gel (Laemmli 1970Citation ) and then electroblotted to a polyvinylidene difluoride membrane (Perkin-Elmer, Wellesley, MA) using 50 mmol/L Tris-200 mmol/L glycine containing 50 mL/L methanol and 2 g/L SDS. Antiserum raised against rat methionine synthase was used as primary antibody, and alkaline phosphatase-conjugated anti-rabbit immunoglobulin G was used as secondary antibody. The bands were visualized by reaction of alkaline phosphatase with 5-bromo-4-chloro-3-indolyl phosphate in the presence of nitroblue tetrazolium. The anti-rat methionine synthase antibody used for the Western blot analysis was obtained by immunizing rabbit with catalytically inactive enzyme polypeptide as an antigen (Yamada et al. 1999Citation ), which was overexpressed in E. coli from rat methionine synthase cDNA (Yamada et al. 1998Citation ).

Levels of methionine synthase mRNA.

Total RNA was extracted from rat livers by the acid guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi 1987Citation ). Purification of the poly(A)+ RNA was performed by using OligoTex dT30 "Super" (Daiichi Pure Chemicals, Tokyo, Japan). Levels of methionine synthase mRNA expressed in rat livers were normalized to the ß-actin mRNA.

Northern blot analysis was performed as follows. Poly(A)+ RNA was separated by 10 g/L agarose gel containing formaldehyde and blotted to hybond-N+ membrane (Amersham Pharmacia Biotech). Oligonucleotide probes used for detection of methionine synthase mRNA and ß-actin mRNA were the coding region (3.8 kb) of methionine synthase cDNA (Yamada et al. 1998Citation ) and the ß-actin cDNA (2 kb) containing the coding and 3'-untranslated regions. 32P-Labeled probes were prepared using a rediprime DNA labeling system (Amersham Pharmacia Biotech). The probes were hybridized overnight at 42°C and washed essentially as described by Sambrook et al. (1989)Citation . The radioactivity of the hydridized mRNA bands was analyzed by a BAS1000 system (Fujifilm, Tokyo, Japan).

Because Northern blot analysis seemed inadequate for quantitation of methionine synthase mRNA due to its extremely low level, an analysis of the mRNA levels by reverse transcription-polymerase chain reaction (RT-PCR) was also performed. First-strand cDNAs were synthesized from the total RNA and an oligo(dT)18 primer (Amersham Pharmacia Biotech) by Supertranscriptase II RT (Gibco BRL, Rockville, MD) or Ready-To-Go RT-PCR beads (Amersham Pharmacia Biotech). The PCR primers used for methionine synthase cDNA were TTGTTGAAGACACTGAAGAAGCCAGG and GAACACACCACCACACTCTTGGATGC for forward and reverse directions, respectively. PCR conditions were as follows: AmpliTaq Gold (Perkin-Elmer) DNA polymerase; cycles started after denaturation at 95°C for 6 min; 40 or 45 cycles (25 or 30 cycles for ß-actin cDNA) at 95°C for 60 s and at 64°C for 120 s. PCR products were separated by electrophoresis on 40 g/L agarose gel in Tris-borate buffer (pH 7.5–7.8) containing ethidium bromide and EDTA. Internal control ß-actin cDNA was amplified using CTGGTGGCACCACCATGTACCCAGG and GTCCGCCTAGAAGCATTTGCGGTGC as forward and reverse primers, respectively. The cDNA amplified with this primer pair spans intron-5 of ß-actin genomic DNA.

Statistical analysis.

Data are means ± SD. The data were analyzed by a one-way ANOVA using StatView (version 5.0; SAS Institute, Cary, NC). When variances were heterogeneous, a Kruskal-Wallis nonparametric test was used. Differences among groups were evaluated by Duncan’s new multiple range test or the Scheffé test. Differences with P < 0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Growth.

In both experiments, body weight gains of B-12–deficient rats were 51–57% those of control rats (Fig. 1Citation and Table 2Citation ), in agreement with our previous studies. The growth retardation due to B-12 deficiency was slightly ameliorated within 160 h by administration of MeCbl three times by intraperitoneal injections [Expt. 1; Fig. 1Citation (upper panel) and Table 2Citation ]. However, no significant recovery in body weight gain of B-12–deficient rats was observed 20 or 40 h after a single injection of MeCbl [Expt. 2; Fig. 1Citation (lower panel) and Table 2Citation ].



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Growth curves of control, B-12–deficient and methylcobalamin (MeCbl)-administered rats. (A) Experiment 1; (B) Experiment 2. The arrow in panel A indicates the first injection of MeCbl. Data are means ± SD, n = 6–9 (A) or 6–8 (B). Values at a given time with different letters are significantly different, P < 0.05.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Growth, liver B-12 concentration and urinary methylmalonate (MMA) excretion of control, B-12–deficient and methylcobalamin (MeCbl)-administered rats1

 
Urinary excretion of MMA and B-12 concentration in liver.

Although urinary MMA excretion in control rats was low (<0.2 mol of MMA/mol creatinine), excretion of extremely high levels of MMA was observed in B-12–deficient rats (Table 2)Citation . This indicated that the rats were seriously deficient in B-12. Three injections of MeCbl (Expt. 1) decreased the urinary MMA excretion to the levels of control rats within 160 h.

The hepatic B-12 concentrations in B-12–deficient rats were 3–3.5% that of control rats (Table 2)Citation . The administration of MeCbl to the B-12–deficient rats by three intraperitoneal injections increased the liver B-12 concentrations to 77% that of control rats within 160 h. Significant recovery in the liver B-12 concentrations was also observed in 20 or 40 h even after a single injection of MeCbl. The increase in the B-12 concentration was time dependent as indicated by the significant difference between rats injected 20 h and those injected 40 h before killing.

Methionine synthase activity in liver.

Holomethionine synthase activity in livers of B-12–deficient rats was <5% that of control rats (Table 3Citation ). Total enzyme activity was also <16% that of control rats. These data indicate that the extremely low activity of methionine synthase in B-12–deficient rats does not simply reflect the deficiency of the coenzyme but is attributable to the low level of apoenzyme that is reconstitutable into catalytically active holoenzyme with added MeCbl. The administration of MeCbl three times by injection increased both holoenzyme and total activities in rat livers to 180% those of control rats within 160 h. The ratio of holoenzyme activity to total activity was >0.88–0.90 in both control and MeCbl-administered rats. A single injection of MeCbl also increased both holoenzyme and total activities to 33–38 and 48–52% those of control rats, respectively, in 20 or 40 h with a ratio of holoenzyme activity to total activity of 0.58–0.72.


View this table:
[in this window]
[in a new window]
 
Table 3. Methionine synthase activity in livers of control, B-12–deficient and methylcobalamin (MeCbl)-administered rats1

 
Levels of methionine synthase protein.

Methionine synthase protein levels in liver extracts of control rats were very low, but its band was still detectable by this analysis (Fig. 2Citation ). Extremely faint bands of methionine synthase protein were detected in liver extracts of B-12–deficient rats. The intensity of the methionine synthase band of rats administered MeCbl three times by injection was even stronger than that of control rats (Fig. 2BCitation ). In contrast, the intensity of the band of rats injected once with MeCbl was weaker than that of control rats (data not shown). All of these results are consistent with methionine synthase activities in liver extracts of the three groups of rats. It is thus likely that inactive forms of methionine synthase protein are not present in the liver extracts, suggesting that they are highly susceptible to proteolysis.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of liver extracts from control, B-12–deficient and methylcobalamin (MeCbl)-administered rats. Liver extracts from individual rats containing 50 µg of protein were loaded onto each lane and subjected to SDS-PAGE on a 5% polyacrylamide gel. (A) The protein staining was with Coomassie Brilliant Blue-R250. The positions of molecular weight markers (Sigma MW-SDS-6H) are shown with arrowheads on the left. (B) Detection of methionine synthase protein by Western blotting using anti-rat methionine synthase antiserum. The arrowhead indicates the position of methionine synthase (MS).

 
Levels of methionine synthase mRNA.

Northern blot analysis was performed to compare levels of methionine synthase mRNA in livers of control, B-12–deficient and MeCbl-administered rats. A 5.2-kb transcript was detected (Fig. 3Citation ). This size was in reasonable agreement with the calculated size of 4.5 kb for rat methionine synthase mRNA (Yamada et al. 1998Citation ). The relative intensity of the band was not significantly different among the three groups of rats.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 3. Northern blot analysis of methionine synthase (MS) mRNA in livers of control, B-12–deficient and methylcobalamin (MeCbl)-administered rats. MeCbl was administered by three injections at 160, 108 and 60 h before killing. Poly(A)+RNA (5 µg) extracted and purified from livers of individual rats was loaded onto each lane. The arrowheads indicate the positions of rat methionine synthase and ß-actin mRNA.

 
A typical result of gel electrophoresis of the PCR products in the mRNA assay by RT-PCR is shown in Figure 4Citation . The sequence analysis indicated that the 640-bp PCR product is a part of rat methionine synthase cDNA. The relative amount of the 638-bp PCR product from the first-strand methionine synthase cDNA to the 235-bp PCR product from the ß-actin cDNA (internal standard) did not differ among the control, B-12–deficient and MeCbl-administered rats, irrespective of the number of injections of MeCbl or duration after injections (data not shown). Because the mRNA assay by RT-PCR is more sensitive but sometimes less precise than other assays, an analysis using other primer-pairs in the PCR amplification was also conducted. The results were quite similar to those shown in Figure 4Citation (data not shown). Thus, we concluded that the level of methionine synthase mRNA essentially was not affected by cellular B-12 levels in rat livers.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. Analysis of expression of methionine synthase (MS) mRNA in livers of control, B-12–deficient and methylcobalamin (MeCbl)-administered rats by reverse transcription-polymerase chain reaction (RT-PCR). MeCbl was administered by three injections at 160, 108 and 60 h before killing. The arrowheads indicate the positions of 640-bp and 240-bp PCR products from a part of rat methionine sythase and ß-action cDNA, respectively.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
B-12–deficient rats bred under our experimental conditions (Doi et al. 1989aCitation and 1989bCitation , Kawata et al. 1992Citation and 1995Citation , Wada et al. 1998Citation ) were confirmed to be seriously B-12 deficient, as judged by high levels of urinary MMA excretion, a clinical marker of B-12-deficiency, and retarded in growth. Extremely low hepatic B-12 concentrations and MeCbl-dependent methionine synthase activity were also indicative of severe B-12 deficiency. However, the B-12–deficient rats did not show either megaloblasts or neurological abnormalities. In our experiments, body weight gains of B-12–deficient rats were lowered to approximately half those of control rats. The growth retardation in B-12–deficient rats is caused not only by lowered food intake but also by lowered utilization of dietary protein due to the defect in methionine synthase (Kawata et al. 1995Citation ) and lowered efficiency of energy metabolism (Toyoshima et al. 1995Citation ). The reversal of growth retardation by administration of MeCbl was attributable to recoveries of food intake as well as the utilization of nutrients resulting from the recovery of B-12–dependent enzyme activities. It was also shown that repetitive injections of MeCbl can reverse the growth retardation in a short period. One of the reasons why we used MeCbl in the recovery experiments is that MeCbl is the coenzyme form for methionine synthase and thus most effectively reconstitutes the holoenzyme from the apoenzyme (Yamada et al. 1999Citation ). Another reason is that MeCbl is the predominant form of B-12 in human serum (Linnel et al. 1974Citation ) and is apparently stable when injected (Ogawa et al. 1989Citation ).

Urinary MMA levels in B-12–deficient rats decreased to the control level within 160 h in rats administered MeCbl. A single injection of MeCbl also quickly decreased MMA excretion (T. Kawata, K. Mori and H. Tamai, unpublished results), suggesting that the administration of MeCbl quickly increases functional holomethylmalonyl-CoA mutase by its conversion to AdoCbl.

Cbl is transported from liver to target organs as a complex with TCII. The TCII-Cbl complex binds to the TCII receptor, with which Cbl is internalized by the cells of target organs (Seetharam, 1999Citation ). When a large amount of Cbl is dosed orally, Cbl can be absorbed by passive diffusion as well (Ungley 1955Citation ). In our study, B-12 concentrations in livers of B-12–deficient rats were lowered to 3% those of control rats. Because the amount of MeCbl injected was a pharmacologic dose (0.1 µg/g of body weight), it is likely that Cbl was internalized by cells at least in part through diffusion. The liver B-12 concentrations of MeCbl-administered rats did not recover completely compared with control rats, although the MeCbl-administered rats were fed a larger amount of B-12 in total than control rats in the experiments. Too high a dose of Cbl may not be trapped efficiently and may overflow into urine. The effects of B-12 deficiency on Cbl transport and storage systems remain to be elucidated.

The holoenzyme activity of liver methionine synthase in B-12-deficient rats was lowered to <5% that of control rats, consistent with previous data (Doi et al. 1989aCitation ), which were obtained using NADPH as a reducing agent. A marked decrease in the total activity was also observed in B-12–deficient rats, indicating that the functional apoenzyme does not exist in their liver extracts. Similar results were reported with the tissue of cobalt (B-12)–deficient sheep (Kennedy et al. 1990Citation ). To make an accurate estimate of the ratio of holoenzyme activity to total activity, in vitro assays of the holoenzyme and total activities of methionine synthase were performed under strictly anaerobic conditions (Chen et al. 1995Citation ). These authors reported that the apoenzyme activity of methionine synthase tended to be overestimated by the assay under conditions that were not strictly anaerobic because exogenously added Cbl was reduced and served as an electron donor in the in vitro assay. The estimated ratio of holomethionine synthase to total activity reported ranges from 0.10 (Kolhouse et al. 1991Citation ) to 1.00 (Chen et al. 1995Citation , Taylor et al. 1974Citation ). Ti(III) citrate, FMNH2 (or FADH2) or aqCbl/DTT is often used as a reducing system for the in vitro assay of methionine synthase. We chose Ti(III) citrate as a reducing agent in this study because it is the most powerful reductant among the three (Chen et al. 1995Citation ). Our results indicated that most of methionine synthase in rat liver exists as the holoenzyme. This may be due to the extreme instability of apomethionine synthase (Yamada et al. 1999Citation ).

By Western blot analysis, we demonstrated that the levels of methionine synthase protein in livers of B-12–deficient rats were less than those in controls, demonstrating that neither functional apoenzyme nor inactive enzyme proteins are present in the livers of B-12–deficient rats. Upon Northern blot analysis, the band of methionine synthase mRNA was too faint for quantitation even when separated poly(A)+ RNA was used. RT-PCR is the most sensitive method for quantitative analysis of such a small amount of mRNA. By using the ß-actin cDNA as an internal standard, we concluded that relative levels of methionine synthase mRNA in the livers of B-12–deficient rats were almost the same as those of control rats. Its levels of expression in MeCbl-administered rats also did not differ. Thus, it is evident that B-12 levels do not affect the level of transcription of the methionine synthase gene. The 5'-upstream region of the human methionine synthase gene was reported to contain a number of potential promoter sites for house-keeping enzymes (Chen et al. 1997Citation ).

We succeeded recently in producing high level expression of recombinant rat methionine synthase as a functional apoenzyme in insect cells using a baculovirus expression system (Yamada et al. 1998Citation and 1999Citation ). The apoenzyme was very unstable and stabilized greatly by forming a complex with MeCbl. Together with this finding, the data presented in this paper indicate that the extremely low activity of methionine synthase in B-12–deficient animals can be explained in terms of "coenzyme stabilization" (stabilization of the enzyme by coenzyme binding) rather than "coenzyme induction."

Methionine synthase is a cytosolic enzyme. Based on cytosolic water of 0.4 mL/g of fresh liver (Siess et al. 1982Citation ) and B-12 concentration of 84.5 pmol/g of liver of control rats, the cytoplasmic B-12 concentration in liver was calculated to be 0.211 µmol/L. The percentages of adenosyl, methyl and aqua forms of B-12 in human liver were reported to be 72.8, 3.9 and 23.4%, respectively (Linnel et al. 1974Citation ). If these percentages are assumed to be the same in rat liver, the cytoplasmic concentration of methyl and aqua forms of B-12 in rat liver would be 0.0082 and 0.049 µmol/L, respectively. The apparent Km values of recombinant rat apomethionine synthase for MeCbl and Ti(III)-reduced aqCbl are 0.34 and 0.17 µmol/L, respectively (Yamada et al. 1999Citation ). Therefore, the concentrations of the methyl and reduced form(s) of B-12 in cytoplasm are likely to be far less than the optimal levels for holoenzyme formation. Only a small part of the methionine synthase synthesized would escape degradation by coenzyme stabilization, depending upon the cytoplasmic B-12 concentration. On this basis, administration of MeCbl even to control rats could effectively stabilize methionine synthase and therefore increase its levels in vivo. This explains why the intensity of the methionine synthase band of the MeCbl-administered rats was apparently stronger than that of control rats in the Western blot analysis (Fig. 2BCitation ). The rate of enzyme synthesis would determine whether the methionine synthase protein would be degraded more rapidly in vivo in B-12–deficient rats than in controls. Further experimentation is required to determine the metabolic turnover rate of this enzyme in vivo.


    ACKNOWLEDGMENTS
 
We thank Yukiko Kurimoto for assistance in manuscript preparation.


    FOOTNOTES
 
2 Abbreviations used: AdoCbl, adenosylcobalamin; AdoMet, S-adenosylmethionine; aqCbl, aquacobalamin; B-12, vitamin B-12; Cbl, cobalamin; DTT, dithiothreitol; FMNH2, riboflavin 5'-phosphate, fully reduced form; H4F, tetrahydrofolate; MeCbl, methylcobalamin; MeH4F, 5-methyltetrahydrofolate; MMA, methylmalonic acid; RT-PCR, reverse transcription-polymerase chain reaction; TCII, transcobalamin II. Back

Manuscript received December 8, 1999. Initial review completed January 11, 2000. Revision accepted March 28, 2000.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

1. American Institute of Nutrition Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J. Nutr. 1977;107:1340-1348

2. Association of Official Analytical Chemists Vitamin assays and microbiological method. Helrich K. eds. Official Methods of Analysis 15th ed. 1990:1080-1083 AOAC Arlington, VA.

3. Banerjee R. V., Matthews R. G. Cobalamin-dependent methionine synthase. FASEB J 1990;4:1450-1459[Abstract]

4. Bradford M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248-254[Medline]

5. Chen L. H., Liu M. L., Hwang H. Y., Chen L. S., Korenberg J., Shane B. Human methionine synthase. cDNA cloning, gene localization, and expression. J. Biol. Chem. 1997;272:3628-3634[Abstract/Free Full Text]

6. Chen Z., Chakraborty S., Banerjee R. Demonstration that mammalian methionine synthases are predominantly cobalamin-loaded. J. Biol. Chem. 1995;270:19246-19249[Abstract/Free Full Text]

7. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem 1987;162:156-159[Medline]

8. Cook J.G.H. Creatinine assay in the presence of protein. Clin. Chem. Acta 1971;32:485-486[Medline]

9. Deacon R., Perry J., Lumb M., Chanarin I., Minty B., Halsey M. J., Nunn J. F. Selective inactivation of vitamin B-12 in rats by nitrous oxide. Lancet 1978;2:1023-1024[Medline]

10. Doi T., Kawata T., Tadano N., Iijima T., Maekawa A. Effect of vitamin B-12 deficiency on S-adenosylmethionine metabolism in rats. J. Nutr. Sci. Vitaminol. 1989a;35:1-9

11. Doi T., Kawata T., Tadano N., Iijima T., Maekawa A. Effect of vitamin B-12-deficiency on the activity of hepatic cystathionine ß-synthase in rats. J. Nutr. Sci. Vitaminol. 1989b;35:101-110

12. Drummond J. T., Matthews R. G. Nitrous oxide degradation by cobalamin-dependent methionine synthase: characterization of the reactants and products in the inactivation reaction. Biochemistry 1994;33:3732-3741[Medline]

13. Fenton W. A., Rosenberg L. E. Genetic and biochemical analysis of human cobalamin mutants in cell culture. Annu. Rev. Genet. 1978;12:223-248[Medline]

14. Frenkel E. P., Prough R., Kitchens R.L. Measurement of tissue vitamin B-12 by radioisotopic competitive inhibition assay and a quantitation of tissue cobalamin fractions. Methods Enzymol 1980;67:31-40[Medline]

15. Fujii K., Huennekens F. M. Activation of methionine synthetase by a reduced triphosphopyridine nucleotide-dependent flavoprotein system. J. Biol. Chem. 1974;249:6745-6753[Abstract/Free Full Text]

16. Giorgio A. J., Plaut G.W.E. A method for the colorimetric determination of urinary methylmalonic acid in pernicious anemia. J. Lab. Clin. Med. 1965;66:667-676[Medline]

17. Gulati S., Brody L. C., Banerjee R. Posttranscriptional regulation of mammalian methionine synthase by B-12. Biochem. Biophys. Res. Commun. 1999;259:436-442[Medline]

18. Gulati S., Chen Z., Brody L. C., Rosenblatt D. S., Banerjee R. Defects in auxiliary redox proteins lead to functional methionine synthase deficiency. J. Biol. Chem. 1997;272:19171-19175[Abstract/Free Full Text]

19. Hayashi J., Maekawa A., Ito M., Suzuki T., Sahashi Y. Studies on the determination of vitamin B-12 by KCN-boiling method. Bitamin 1960;19:462-465

20. Japanese Association for Laboratory Animal Science Guideline for animal experimentation. Exp. Anim. 1987;36:285-288

21. Kawata T., Takada T., Morimoto F., Fujimoto N., Tanaka N., Yamada K., Wada M., Tadokoro T., Maekawa A. Effects of vitamin B-12-deficiency on testes tissue in rats. J. Nutr. Sci. Vitaminol. 1992;38:305-316

22. Kawata T., Tashiro A., Tamiki A., Suga K., Kamioka S., Yamada K., Wada M., Tadokoro T., Maekawa A. Utilization of dietary protein in the vitamin B-12-deficient rats. Int. J. Vitam. Nutr. Res. 1995;65:248-254[Medline]

23. Kennedy D. G., Cannavan A., Molloy A., O’Harte F., Taylor S. M., Kennedy S., Blanchflower W. J. Methylmalonyl-CoA mutase (EC 5.4.99.2) and methionine synthetase (EC 2.1.1.13) in the tissues of cobalt-vitamin B-12 deficient sheep. Br. J. Nutr. 1990;64:721-732[Medline]

24. Kolhouse J. F., Allen R. H. Recognition of two intracellular cobalamin binding proteins and their identification as methylmalonyl-CoA mutase and methionine synthetase. Proc. Natl. Acad. Sci. U.S.A. 1977;74:921-925[Abstract/Free Full Text]

25. Kolhouse J. F., Utley C., Stabler S. P., Allen R. H. Mechanism of conversion of human apo- to holomethionine synthase by various forms of cobalamin. J. Biol. Chem. 1991;266:23010-23015[Abstract/Free Full Text]

26. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.) 1970;227:680-685[Medline]

27. Leclerc D., Wilson A., Dumas R., Gafuik C., Song D., Watkins D, Heng H.H.Q., Rommens J. M., Scherer S. W., Rosenblatt D. S., Gravel R. A. Cloning and mapping of a cDNA for methionine synthase reductase, a flavoprotein defective in patients with homocystinuria. Proc. Natl. Acad. Sci. U.S.A. 1998;95:3059-3064[Abstract/Free Full Text]

28. Linnell J. C., Hoffbrand A. V., Hussein H.A.A., Wise I. J., Matthews D. M. Tissue distribution of coenzyme and other forms of vitamin B-12 in control subjects and patients with pernicious anaemia. Clin. Sci. Mol. Med. 1974;46:163-172[Medline]

29. McCully K. S. Vascular pathology of homocysteinemia: implications for the pathogenesis of arteriosclerosis. Am. J. Pathol. 1969;56:111-128[Medline]

30. Mellman I. S., Youngdahl-Turner P., Willard H. F., Rosenberg L. E. Intracellular binding of radioactive hydroxocobalamin to cobalamin-dependent apoenzymes in rat liver. Proc. Natl. Acad. Sci. U.S.A. 1977;74:916-920[Abstract/Free Full Text]

31. Metz J., van der Westhuyzen J. The fruit bat as an experimental model of the neuropathy of cobalamin deficiency. Comp. Biochem. Physiol. 1987;88A:171-177

32. Ogawa T., Tomono Y., Morishita N., Shishido R. Pharmacokinetics of injected mecobalamin (methylcobalamin) in healthy adults—intravenous and intramuscular routes. Bitamin 1989;63:123-131

33. Sambrook J., Fritsch E. F., Maniatis T. Molecular Cloning: A Laboratory Manual 1989 Cold Spring Harbor Laboratory Cold Spring Harbor, NY.

34. Seetharam B. Receptor-mediated endocytosis of cobalamin. Annu. Rev. Nutr. 1999;19:173-195[Medline]

35. Siess E. A., Brocks D. G., Wieland O. H. Subcellular distribution of adenine nucleotides and of metabolites of tricarboxylate cycle and gluconeogenesis in hepatocytes. Sies M. eds. Metabolic Compartmentation 1982:235-257 Academic Press New York, NY.

36. Steegers-Theunissen R.P.M., Boers G.H.J., Trijibels F.J.M., Eskes T.K.A.B. Neural-tube defects and derangement of homocysteine metabolism. N. Engl. J. Med. 1991;324:199-200[Medline]

37. Taylor R. T., Hanna M. L., Hutton J. J. 5-Methyltetrahydrofolate homocysteine cobalamin methyltransferase in human bone marrow and its relationship to pernicious anemia. Arch. Biochem. Biophys. 1974;165:787-795[Medline]

38. Toyoshima S., Watanabe F., Saido H., Miyatake K., Nakano Y. Methylmalonic acid inhibits respiration in rat liver mitochondria. J. Nutr. 1995;125:2846-2850

39. Ungley C. C. The chemotherapeutic action of vitamin B-12. Vitam. Horm. 1955;13:137-211[Medline]

40. Wada M., Kawata T., Yamada K., Funada U., Kuwamori M., Endo M., Tanaka N., Tadokoro T., Maekawa A. Serum C3 content in vitamin B-12-deficient rats. Int. J. Vitam. Nutr. Res. 1998;68:94-97[Medline]

41. Watanabe F., Nakano Y., Tachikake N., Saido H., Tamura Y., Yamanaka H. Vitamin B-12 deficiency increases the specific activities of rat liver NADH- and NADPH-linked aquacobalamin reductase isozymes involved in coenzyme synthesis. J. Nutr. 1991;121:1948-1954

42. Yamada K., Tobimatsu T., Toraya T. Cloning, sequencing, and heterologous expression of rat methionine synthase cDNA. Biosci. Biotechnol. Biochem. 1998;62:2155-2160[Medline]

43. Yamada K., Yamada S., Tobimatsu T., Toraya T. Heterologous high-level expression, purification, and enzymological properties of recombinant rat cobalamin-dependent methionine synthase. J. Biol. Chem. 1999;274:35571-35576[Abstract/Free Full Text]

44. Zehnder A.J.B., Wuhrmann K. Titanium (III) citrate as a nontoxic oxidation-reduction buffering system for the culture of obligate anaerobes. Science (Washington, DC) 1976;194:1165-1166[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
S. A. Blaise, E. Nedelec, H. Schroeder, J.-M. Alberto, C. Bossenmeyer-Pourie, J.-L. Gueant, and J.-L. Daval
Gestational Vitamin B Deficiency Leads to Homocysteine-Associated Brain Apoptosis and Alters Neurobehavioral Development in Rats
Am. J. Pathol., February 1, 2007; 170(2): 667 - 679.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Zhang, A. Braun, Z. Bauman, H. Olteanu, P. Madzelan, and R. Banerjee
Expression Profiling of Homocysteine Junction Enzymes in the NCI60 Panel of Human Cancer Cell Lines
Cancer Res., February 15, 2005; 65(4): 1554 - 1560.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Oltean and R. Banerjee
Nutritional Modulation of Gene Expression and Homocysteine Utilization by Vitamin B12
J. Biol. Chem., May 30, 2003; 278(23): 20778 - 20784.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, K.
Right arrow Articles by Toraya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, K.
Right arrow Articles by Toraya, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2000 by American Society for Nutrition