![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Faculty of Engineering and
*
Faculty of Education, Okayama University, Okayama 700-8530, Japan and
Faculty of Applied Bioscience, Tokyo University of Agriculture, Setagaya-ku, Tokyo 156-8502, Japan
1To whom correspondence should be addressed.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: • vitamin B-12 • cobalamin • methionine synthase • vitamin B-12 deficiency • rats
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, Mellman et al. 1977
). One is adenosylcobalamin (AdoCbl)-dependent
methylmalonyl-CoA mutase, which catalyzes the interconversion
between methylmalonyl-CoA and succinyl-CoA. This enzyme is
needed for the pathways involving propionyl-CoA, such as the
metabolism of odd-chain fatty acids and branched-chain amino
acids. Methylmalonic aciduria is the disease resulting from dysfunction
of methylmalonyl-CoA mutase. The urinary level of methylmalonic
acid (MMA) is thus used as a specific marker for B-12 deficiency except
for the cases of inborn errors of methylmalonyl-CoA mutase and Cbl
metabolism (Fenton and Rosenberg 1978
). The other enzyme
is methylcobalamin (MeCbl)-dependent methionine synthase, which
catalyzes the methyl transfer from 5-methyltetrahydrofolate
(MeH4F) to homocysteine, forming tetrahydrofolate
(H4F) and methionine (Banerjee and Matthews 1990
). Methionine synthase plays an indispensable role
in both folate and methionine metabolism. A defect of methionine
synthase causes hyperhomocyst(e)inemia. Elevated homocyst(e)ine in
blood is believed to be a risk factor for cardiovascular diseases
(McCully 1969
) and neural tube defects
(Steegers-Theunissen et al. 1991
).
During catalysis by methionine synthase, Cbl acts as an intermediate
methyl carrier. The intermediate cob(I)alamin is highly nucleophilic
and easily oxidized to cob(II)alamin under aerobic conditions
(Banerjee and Matthews 1990
). Because the enzyme
containing cob(II)alamin is catalytically inactive, methionine synthase
requires strictly anaerobic conditions for full activity (Chen et al. 1995
). The oxidatively inactivated enzyme requires
S-adenosylmethionine (AdoMet) and a reducing system for
reactivation. The physiologic partners for this reactivation are two
proteins, F and R, and NADPH in Escherichia coli
(Fujii and Huennekens 1974
). Recently, human cDNA for
methionine synthase reductase was cloned (Leclerc 1998
).
Gulati et al. (1997)
reported, however, that the
physiologic partners required for this reductive activation of the
mammalian enzymes are at least two proteins, as in E. coli.
Chemical reducing agents, such as aquacobalamin (aqCbl)/dithiothreitol
(DTT), the fully reduced form of riboflavin 5'-phosphate
(FMNH2) and titanium(III) citrate, are used for
an in vitro assay of methionine synthase.
Although B-12–deficient animals are useful for elucidating physiologic
functions of B-12, it is difficult to keep them in severe dietary B-12
deficiency. Because nitrous oxide is a specific inhibitor for
methionine synthase both in vitro (Drummond and Matthews 1994
) and in vivo (Deacon et al. 1978
), nitrous
oxide-exposed animals are often used as models of B-12-deficiency
due to methionine synthase dysfunction. We bred B-12–deficient rats
under strictly controlled feeding conditions (Doi et al. 1989a
). The liver B-12 concentrations of these rats are <5%
those of control rats. Other B-12–deficient models with markedly
decreased B-12 levels include rats (Watanabe et al. 1991
), fruit bats (Metz and Westhuyzen 1987
) and
sheep (Kennedy et al. 1990
). B-12 deficiency results
from cobalt deficiency in sheep. We reported previously the effects of
dietary B-12 deficiency on methionine metabolism (Doi et al. 1989a
and 1989b
), protein efficiency (Kawata et al. 1995
), testicular morphology (Kawata et al. 1992
) and plasma C3 concentrations (Wada et al. 1998
) in rats.
We found that methionine synthase activity in strictly B-12–deficient
rats is extremely low (Doi et al. 1989a
). In this paper,
we attempted to determine how the enzyme activity is lowered in B-12
deficiency by examining the relationship between B-12 status and
methionine synthase activity. We also examined levels of the enzyme
protein and the mRNA expressed in livers of B-12-deficient rats because
liver is one of the most important organs for both methionine
metabolism and Cbl storage. Recently, Chen et al. (1997)
reported relative levels of methionine synthase mRNA in human tissues.
Gulati et al. (1999)
demonstrated with cultured cells
that supplementation of B-12 to the culture enhances methionine
synthase activity by post-transcriptional regulation. However, it
is difficult to study effects of strict B-12 deficiency on the enzyme
protein and mRNA levels with cultured cells because B-12 bound to
transcobalamin II (TCII) in serum is inevitably taken up by the cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Male and female Wistar rats (10 wk old) were purchased as parent rats
from Clea, Tokyo, Japan and fed a B-12–deficient diet containing
soybean oil during pregnancy and lactation (Doi et al. 1989a
). The composition of this diet was the same as that
described in Table 1
, except that soybean protein isolate was increased to 250 g/kg of diet,
glucose (anhydrous) decreased to 603.5 g/kg of diet and 100 g of
soybean oil/kg of diet (Wako Pure Chemicals, Osaka, Japan) used instead
of lard. Male rats born to these dams were used in the following
experiments. Newborn rats, weaned on d 23 after birth, were divided
into experimental groups. Each rat had free access to the food and
water. Fresh diet was provided daily. The room was maintained at a
constant temperature (22 ± 3°C) with a 12-h light:dark cycle.
Rats were housed individually in stainless steel screen-bottomed
cages or metabolic cages when necessary.
|
The B-12–deficient diet was prepared according to our previous paper
(Doi et al. 1989a
), except that concentrations of
minerals and vitamins were as in the AIN-76 diet (AIN 1977
). The composition of diet is shown in Table 1
; the diet
was in powdered form and stored at 4°C. B-12–supplemented (control)
rats were fed 1 µg of cyanocobalamin/d (Wako Pure
Chemicals) by oral administration of a 50-µL solution.
During pregnancy and lactation, the dams were fed the B-12–deficient
diet containing soybean oil; the composition of the diet is described
above.
Experimental design.
Two independent experiments were conducted as follows. Both experiments were performed with control, B-12–deficient and MeCbl-administered B-12–deficient rats. In recovery tests with MeCbl-administered groups, the rats were fed 0.1 µg/g body MeCbl (Eizai, Tokyo, Japan) by intraperitoneal injection. In Experiment 1, MeCbl was injected three times (160, 108 and 60 h before killing) to B-12–deficient rats. These three groups of rats were fed for 90 d after weaning. In Experiment 2, B-12–deficient rats were given a single, intraperitoneal injection of MeCbl 20 or 40 h before killing. These rats were fed for 120 d.
After collection of blood from hearts of rats under anesthesia
(Somnopentyl; pentobarbital sodium, 64.8 g/L; Pitman-Moore,
Mundelein, IL), liver was removed. The liver samples were frozen in
liquid nitrogen immediately after killing and stored until use at
-80°C for enzyme and mRNA assays and at -20°C for determination
of B-12 concentrations. The protocols complied with the Guideline for
Animal Experimentation (Japanese Association for Laboratory Animal Science 1987
).
Determination of urinary MMA and liver B-12 concentrations.
Urine was collected from rats in metabolic cages for 24 h,
filtered and stored at -20°C until use. Urinary levels of MMA and
creatinine were determined by the colorimetric methods of
Giorgio and Plaut (1965)
and Cook (1971)
,
respectively. MMA excretion data were expressed as mol MMA/mol
creatinine.
B-12 concentrations were determined by a microbiological assay using
Lactobacillus delbrueckii lactis (formerly
Lactobacillus leichmannii) ATCC 7830 (AOAC 1990
). The medium for L. delbrueckii lactis was
purchased from Nissui Pharmaceutical, Tokyo, Japan. B-12 was extracted
from rat liver by boiling in the presence of KCN (Hayashi et al. 1960
), essentially as described by Frenkel et al. (1980)
.
Methionine synthase activity.
Methionine synthase activity was determined with Ti(III) citrate as a
reducing agent, as described by Chen et al. (1995)
.
Ti(III) citrate was prepared from TiCl3 (Nacalai tesque,
Kyoto, Japan) by the method of Zehnder and Wuhrmann (1976)
. MeH4F barium salt was obtained from
Sigma-Aldrich, St-Louis, MO.
A portion of rat liver (~0.5 g) was homogenized in 5 volumes of 0.15 mol/L potassium phosphate buffer (pH 7.2) by a glass-Teflon homogenizer with an ice-cold jacket. After centrifugation (100,000 x g) of liver homogenate at 4°C for 1 h, the supernatant was used as crude extract.
The holoenzyme activity was determined in duplicate for each rat. Reaction mixtures contained 0.56 mmol/L homocysteine (Sigma-Aldrich), 40 µmol/L AdoMet (Sigma-Aldrich), 2 mmol/L Ti(III) citrate, 160 µmol/L [methyl-14C]MeH4F (Amersham Pharmacia Biotech, Uppsala, Sweden) (33.3 Bq/nmol), crude extract and 0.15 mol/L potassium phosphate buffer (pH 7.2) in a total volume of 250 µL. The enzyme reaction was carried out under a H2 atmosphere at 37°C for 10 min and then stopped by quick chilling and the addition of 2 volumes of ice-cold water. The mixture was passed through the Dowex 1 (Cl-) (Dow Chemical, Midland, MI) column, and 14C radioactivity in the methionine-containing fraction was measured. The total activity was determined by the same procedure as the holoenzyme activity, except that 50 µmol/L MeCbl was added to the reaction mixture.
Protein was assayed by the colorimetric method of Bradford (1976)
using bovine serum albumin as a standard.
Western blot analysis.
Liver extracts of control, B-12–deficient and MeCbl-administered
rats were examined for levels of methionine synthase protein by Western
blot analysis with rabbit anti-rat methionine synthase antiserum.
The extracts were applied (50 µg proteins/lane) and
subjected to SDS-PAGE on a 50 g/L acrylamide gel (Laemmli 1970
) and then electroblotted to a polyvinylidene difluoride
membrane (Perkin-Elmer, Wellesley, MA) using 50 mmol/L Tris-200 mmol/L
glycine containing 50 mL/L methanol and 2 g/L SDS. Antiserum raised
against rat methionine synthase was used as primary antibody, and
alkaline phosphatase-conjugated anti-rabbit immunoglobulin G was
used as secondary antibody. The bands were visualized by reaction of
alkaline phosphatase with 5-bromo-4-chloro-3-indolyl phosphate in the
presence of nitroblue tetrazolium. The anti-rat methionine synthase
antibody used for the Western blot analysis was obtained by immunizing
rabbit with catalytically inactive enzyme polypeptide as an
antigen (Yamada et al. 1999
), which was overexpressed in
E. coli from rat methionine synthase cDNA (Yamada et al. 1998
).
Levels of methionine synthase mRNA.
Total RNA was extracted from rat livers by the acid guanidinium
thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi 1987
). Purification of the poly(A)+ RNA was
performed by using OligoTex dT30 "Super" (Daiichi Pure
Chemicals, Tokyo, Japan). Levels of methionine synthase mRNA expressed
in rat livers were normalized to the ß-actin mRNA.
Northern blot analysis was performed as follows. Poly(A)+
RNA was separated by 10 g/L agarose gel containing formaldehyde and
blotted to hybond-N+ membrane (Amersham Pharmacia Biotech).
Oligonucleotide probes used for detection of methionine synthase mRNA
and ß-actin mRNA were the coding region (3.8 kb) of methionine
synthase cDNA (Yamada et al. 1998
) and the ß-actin
cDNA (2 kb) containing the coding and 3'-untranslated regions.
32P-Labeled probes were prepared using a rediprime DNA
labeling system (Amersham Pharmacia Biotech). The probes were
hybridized overnight at 42°C and washed essentially as described by
Sambrook et al. (1989)
. The radioactivity of the
hydridized mRNA bands was analyzed by a BAS1000 system (Fujifilm,
Tokyo, Japan).
Because Northern blot analysis seemed inadequate for quantitation of methionine synthase mRNA due to its extremely low level, an analysis of the mRNA levels by reverse transcription-polymerase chain reaction (RT-PCR) was also performed. First-strand cDNAs were synthesized from the total RNA and an oligo(dT)18 primer (Amersham Pharmacia Biotech) by Supertranscriptase II RT (Gibco BRL, Rockville, MD) or Ready-To-Go RT-PCR beads (Amersham Pharmacia Biotech). The PCR primers used for methionine synthase cDNA were TTGTTGAAGACACTGAAGAAGCCAGG and GAACACACCACCACACTCTTGGATGC for forward and reverse directions, respectively. PCR conditions were as follows: AmpliTaq Gold (Perkin-Elmer) DNA polymerase; cycles started after denaturation at 95°C for 6 min; 40 or 45 cycles (25 or 30 cycles for ß-actin cDNA) at 95°C for 60 s and at 64°C for 120 s. PCR products were separated by electrophoresis on 40 g/L agarose gel in Tris-borate buffer (pH 7.5–7.8) containing ethidium bromide and EDTA. Internal control ß-actin cDNA was amplified using CTGGTGGCACCACCATGTACCCAGG and GTCCGCCTAGAAGCATTTGCGGTGC as forward and reverse primers, respectively. The cDNA amplified with this primer pair spans intron-5 of ß-actin genomic DNA.
Statistical analysis.
Data are means ± SD. The data were analyzed by a one-way ANOVA using StatView (version 5.0; SAS Institute, Cary, NC). When variances were heterogeneous, a Kruskal-Wallis nonparametric test was used. Differences among groups were evaluated by Duncan’s new multiple range test or the Scheffé test. Differences with P < 0.05 were considered significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In both experiments, body weight gains of B-12–deficient rats were
51–57% those of control rats (Fig. 1
and Table 2
), in agreement with our previous studies. The growth retardation due to
B-12 deficiency was slightly ameliorated within 160 h by
administration of MeCbl three times by intraperitoneal injections
[Expt. 1; Fig. 1
(upper panel) and Table 2
]. However, no
significant recovery in body weight gain of B-12–deficient rats was
observed 20 or 40 h after a single injection of MeCbl [Expt. 2;
Fig. 1
(lower panel) and Table 2
].
|
|
Although urinary MMA excretion in control rats was low (<0.2 mol of
MMA/mol creatinine), excretion of extremely high levels of MMA was
observed in B-12–deficient rats (Table 2)
. This indicated that the
rats were seriously deficient in B-12. Three injections of MeCbl (Expt.
1) decreased the urinary MMA excretion to the levels of control rats
within 160 h.
The hepatic B-12 concentrations in B-12–deficient rats were 3–3.5%
that of control rats (Table 2)
. The administration of MeCbl to the
B-12–deficient rats by three intraperitoneal injections increased the
liver B-12 concentrations to 77% that of control rats within 160 h. Significant recovery in the liver B-12 concentrations was also
observed in 20 or 40 h even after a single injection of MeCbl. The
increase in the B-12 concentration was time dependent as indicated by
the significant difference between rats injected 20 h and those
injected 40 h before killing.
Methionine synthase activity in liver.
Holomethionine synthase activity in livers of B-12–deficient rats was
<5% that of control rats (Table 3
). Total enzyme activity was also <16% that of control rats. These
data indicate that the extremely low activity of methionine synthase in
B-12–deficient rats does not simply reflect the deficiency of the
coenzyme but is attributable to the low level of apoenzyme that is
reconstitutable into catalytically active holoenzyme with added MeCbl.
The administration of MeCbl three times by injection increased both
holoenzyme and total activities in rat livers to 180% those of control
rats within 160 h. The ratio of holoenzyme activity to total
activity was >0.88–0.90 in both control and MeCbl-administered
rats. A single injection of MeCbl also increased both holoenzyme and
total activities to 33–38 and 48–52% those of control rats,
respectively, in 20 or 40 h with a ratio of holoenzyme activity to
total activity of 0.58–0.72.
|
Methionine synthase protein levels in liver extracts of control rats
were very low, but its band was still detectable by this analysis
(Fig. 2
). Extremely faint bands of methionine synthase protein were detected in
liver extracts of B-12–deficient rats. The intensity of the methionine
synthase band of rats administered MeCbl three times by injection was
even stronger than that of control rats (Fig. 2B
). In
contrast, the intensity of the band of rats injected once with MeCbl
was weaker than that of control rats (data not shown). All of these
results are consistent with methionine synthase activities in liver
extracts of the three groups of rats. It is thus likely that inactive
forms of methionine synthase protein are not present in the liver
extracts, suggesting that they are highly susceptible to proteolysis.
|
Northern blot analysis was performed to compare levels of methionine
synthase mRNA in livers of control, B-12–deficient and
MeCbl-administered rats. A 5.2-kb transcript was detected
(Fig. 3
). This size was in reasonable agreement with the calculated size of 4.5
kb for rat methionine synthase mRNA (Yamada et al. 1998
). The relative intensity of the band was not significantly
different among the three groups of rats.
|
. The sequence analysis indicated that the 640-bp PCR product is a part
of rat methionine synthase cDNA. The relative amount of the 638-bp PCR
product from the first-strand methionine synthase cDNA to the
235-bp PCR product from the ß-actin cDNA (internal standard) did not
differ among the control, B-12–deficient and MeCbl-administered
rats, irrespective of the number of injections of MeCbl or duration
after injections (data not shown). Because the mRNA assay by RT-PCR
is more sensitive but sometimes less precise than other assays, an
analysis using other primer-pairs in the PCR amplification was also
conducted. The results were quite similar to those shown in Figure 4
(data not shown). Thus, we concluded that the level of methionine
synthase mRNA essentially was not affected by cellular B-12 levels in
rat livers.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and 1989b
, Kawata et al. 1992
and 1995
, Wada et al. 1998
) were confirmed to be
seriously B-12 deficient, as judged by high levels of urinary MMA
excretion, a clinical marker of B-12-deficiency, and retarded in
growth. Extremely low hepatic B-12 concentrations and
MeCbl-dependent methionine synthase activity were also indicative
of severe B-12 deficiency. However, the B-12–deficient rats did not
show either megaloblasts or neurological abnormalities. In our
experiments, body weight gains of B-12–deficient rats were lowered to
approximately half those of control rats. The growth retardation in
B-12–deficient rats is caused not only by lowered food intake but also
by lowered utilization of dietary protein due to the defect in
methionine synthase (Kawata et al. 1995
) and lowered
efficiency of energy metabolism (Toyoshima et al. 1995
).
The reversal of growth retardation by administration of MeCbl was
attributable to recoveries of food intake as well as the utilization of
nutrients resulting from the recovery of B-12–dependent enzyme
activities. It was also shown that repetitive injections of MeCbl can
reverse the growth retardation in a short period. One of the reasons
why we used MeCbl in the recovery experiments is that MeCbl is the
coenzyme form for methionine synthase and thus most effectively
reconstitutes the holoenzyme from the apoenzyme (Yamada et al. 1999
). Another reason is that MeCbl is the predominant form of
B-12 in human serum (Linnel et al. 1974
) and is
apparently stable when injected (Ogawa et al. 1989
). Urinary MMA levels in B-12–deficient rats decreased to the control level within 160 h in rats administered MeCbl. A single injection of MeCbl also quickly decreased MMA excretion (T. Kawata, K. Mori and H. Tamai, unpublished results), suggesting that the administration of MeCbl quickly increases functional holomethylmalonyl-CoA mutase by its conversion to AdoCbl.
Cbl is transported from liver to target organs as a complex with TCII.
The TCII-Cbl complex binds to the TCII receptor, with which Cbl is
internalized by the cells of target organs (Seetharam, 1999
). When a large amount of Cbl is dosed orally, Cbl can be
absorbed by passive diffusion as well (Ungley 1955
). In
our study, B-12 concentrations in livers of B-12–deficient rats were
lowered to 3% those of control rats. Because the amount of MeCbl
injected was a pharmacologic dose (0.1 µg/g of body
weight), it is likely that Cbl was internalized by cells at least in
part through diffusion. The liver B-12 concentrations of
MeCbl-administered rats did not recover completely compared with
control rats, although the MeCbl-administered rats were fed a
larger amount of B-12 in total than control rats in the experiments.
Too high a dose of Cbl may not be trapped efficiently and may overflow
into urine. The effects of B-12 deficiency on Cbl transport and storage
systems remain to be elucidated.
The holoenzyme activity of liver methionine synthase in
B-12-deficient rats was lowered to <5% that of control rats,
consistent with previous data (Doi et al. 1989a
), which
were obtained using NADPH as a reducing agent. A marked decrease in the
total activity was also observed in B-12–deficient rats, indicating
that the functional apoenzyme does not exist in their liver extracts.
Similar results were reported with the tissue of cobalt
(B-12)–deficient sheep (Kennedy et al. 1990
). To make
an accurate estimate of the ratio of holoenzyme activity to total
activity, in vitro assays of the holoenzyme and total activities of
methionine synthase were performed under strictly anaerobic conditions
(Chen et al. 1995
). These authors reported that the
apoenzyme activity of methionine synthase tended to be overestimated by
the assay under conditions that were not strictly anaerobic because
exogenously added Cbl was reduced and served as an electron donor in
the in vitro assay. The estimated ratio of holomethionine synthase to
total activity reported ranges from 0.10 (Kolhouse et al. 1991
) to 1.00 (Chen et al. 1995
, Taylor et al. 1974
). Ti(III) citrate, FMNH2 (or
FADH2) or aqCbl/DTT is often used as a reducing
system for the in vitro assay of methionine synthase. We chose Ti(III)
citrate as a reducing agent in this study because it is the most
powerful reductant among the three (Chen et al. 1995
).
Our results indicated that most of methionine synthase in rat liver
exists as the holoenzyme. This may be due to the extreme instability of
apomethionine synthase (Yamada et al. 1999
).
By Western blot analysis, we demonstrated that the levels of methionine
synthase protein in livers of B-12–deficient rats were less than those
in controls, demonstrating that neither functional apoenzyme nor
inactive enzyme proteins are present in the livers of B-12–deficient
rats. Upon Northern blot analysis, the band of methionine synthase mRNA
was too faint for quantitation even when separated
poly(A)+ RNA was used. RT-PCR is the most
sensitive method for quantitative analysis of such a small amount of
mRNA. By using the ß-actin cDNA as an internal standard, we concluded
that relative levels of methionine synthase mRNA in the livers of
B-12–deficient rats were almost the same as those of control rats. Its
levels of expression in MeCbl-administered rats also did not
differ. Thus, it is evident that B-12 levels do not affect the level of
transcription of the methionine synthase gene. The 5'-upstream region
of the human methionine synthase gene was reported to contain a number
of potential promoter sites for house-keeping enzymes (Chen et al. 1997
).
We succeeded recently in producing high level expression of recombinant
rat methionine synthase as a functional apoenzyme in insect cells using
a baculovirus expression system (Yamada et al. 1998
and 1999
). The apoenzyme was very unstable and stabilized greatly
by forming a complex with MeCbl. Together with this finding, the data
presented in this paper indicate that the extremely low activity of
methionine synthase in B-12–deficient animals can be explained in
terms of "coenzyme stabilization" (stabilization of the enzyme by
coenzyme binding) rather than "coenzyme induction."
Methionine synthase is a cytosolic enzyme. Based on cytosolic water of
0.4 mL/g of fresh liver (Siess et al. 1982
) and B-12
concentration of 84.5 pmol/g of liver of control rats, the cytoplasmic
B-12 concentration in liver was calculated to be 0.211
µmol/L. The percentages of adenosyl, methyl and aqua forms
of B-12 in human liver were reported to be 72.8, 3.9 and 23.4%,
respectively (Linnel et al. 1974
). If these percentages
are assumed to be the same in rat liver, the cytoplasmic concentration
of methyl and aqua forms of B-12 in rat liver would be 0.0082 and 0.049
µmol/L, respectively. The apparent
Km values of recombinant rat
apomethionine synthase for MeCbl and Ti(III)-reduced aqCbl are 0.34 and
0.17 µmol/L, respectively (Yamada et al. 1999
). Therefore, the concentrations of the methyl and reduced
form(s) of B-12 in cytoplasm are likely to be far less than the optimal
levels for holoenzyme formation. Only a small part of the methionine
synthase synthesized would escape degradation by coenzyme
stabilization, depending upon the cytoplasmic B-12 concentration. On
this basis, administration of MeCbl even to control rats could
effectively stabilize methionine synthase and therefore increase its
levels in vivo. This explains why the intensity of the methionine
synthase band of the MeCbl-administered rats was apparently
stronger than that of control rats in the Western blot analysis (Fig. 2B
). The rate of enzyme synthesis would determine whether
the methionine synthase protein would be degraded more rapidly in vivo
in B-12–deficient rats than in controls. Further experimentation is
required to determine the metabolic turnover rate of this enzyme in
vivo.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Manuscript received December 8, 1999. Initial review completed January 11, 2000. Revision accepted March 28, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
1. American Institute of Nutrition Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J. Nutr. 1977;107:1340-1348
2. Association of Official Analytical Chemists Vitamin assays and microbiological method. Helrich K. eds. Official Methods of Analysis 15th ed. 1990:1080-1083 AOAC Arlington, VA.
3. Banerjee R. V., Matthews R. G. Cobalamin-dependent methionine synthase. FASEB J 1990;4:1450-1459[Abstract]
4. Bradford M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248-254[Medline]
5.
Chen L. H., Liu M. L., Hwang H. Y., Chen L. S., Korenberg J., Shane B. Human methionine synthase. cDNA cloning, gene localization, and expression. J. Biol. Chem. 1997;272:3628-3634
6.
Chen Z., Chakraborty S., Banerjee R. Demonstration that mammalian methionine synthases are predominantly cobalamin-loaded. J. Biol. Chem. 1995;270:19246-19249
7. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem 1987;162:156-159[Medline]
8. Cook J.G.H. Creatinine assay in the presence of protein. Clin. Chem. Acta 1971;32:485-486[Medline]
9. Deacon R., Perry J., Lumb M., Chanarin I., Minty B., Halsey M. J., Nunn J. F. Selective inactivation of vitamin B-12 in rats by nitrous oxide. Lancet 1978;2:1023-1024[Medline]
10. Doi T., Kawata T., Tadano N., Iijima T., Maekawa A. Effect of vitamin B-12 deficiency on S-adenosylmethionine metabolism in rats. J. Nutr. Sci. Vitaminol. 1989a;35:1-9
11. Doi T., Kawata T., Tadano N., Iijima T., Maekawa A. Effect of vitamin B-12-deficiency on the activity of hepatic cystathionine ß-synthase in rats. J. Nutr. Sci. Vitaminol. 1989b;35:101-110
12. Drummond J. T., Matthews R. G. Nitrous oxide degradation by cobalamin-dependent methionine synthase: characterization of the reactants and products in the inactivation reaction. Biochemistry 1994;33:3732-3741[Medline]
13. Fenton W. A., Rosenberg L. E. Genetic and biochemical analysis of human cobalamin mutants in cell culture. Annu. Rev. Genet. 1978;12:223-248[Medline]
14. Frenkel E. P., Prough R., Kitchens R.L. Measurement of tissue vitamin B-12 by radioisotopic competitive inhibition assay and a quantitation of tissue cobalamin fractions. Methods Enzymol 1980;67:31-40[Medline]
15.
Fujii K., Huennekens F. M. Activation of methionine synthetase by a reduced triphosphopyridine nucleotide-dependent flavoprotein system. J. Biol. Chem. 1974;249:6745-6753
16. Giorgio A. J., Plaut G.W.E. A method for the colorimetric determination of urinary methylmalonic acid in pernicious anemia. J. Lab. Clin. Med. 1965;66:667-676[Medline]
17. Gulati S., Brody L. C., Banerjee R. Posttranscriptional regulation of mammalian methionine synthase by B-12. Biochem. Biophys. Res. Commun. 1999;259:436-442[Medline]
18.
Gulati S., Chen Z., Brody L. C., Rosenblatt D. S., Banerjee R. Defects in auxiliary redox proteins lead to functional methionine synthase deficiency. J. Biol. Chem. 1997;272:19171-19175
19. Hayashi J., Maekawa A., Ito M., Suzuki T., Sahashi Y. Studies on the determination of vitamin B-12 by KCN-boiling method. Bitamin 1960;19:462-465
20. Japanese Association for Laboratory Animal Science Guideline for animal experimentation. Exp. Anim. 1987;36:285-288
21. Kawata T., Takada T., Morimoto F., Fujimoto N., Tanaka N., Yamada K., Wada M., Tadokoro T., Maekawa A. Effects of vitamin B-12-deficiency on testes tissue in rats. J. Nutr. Sci. Vitaminol. 1992;38:305-316
22. Kawata T., Tashiro A., Tamiki A., Suga K., Kamioka S., Yamada K., Wada M., Tadokoro T., Maekawa A. Utilization of dietary protein in the vitamin B-12-deficient rats. Int. J. Vitam. Nutr. Res. 1995;65:248-254[Medline]
23. Kennedy D. G., Cannavan A., Molloy A., O’Harte F., Taylor S. M., Kennedy S., Blanchflower W. J. Methylmalonyl-CoA mutase (EC 5.4.99.2) and methionine synthetase (EC 2.1.1.13) in the tissues of cobalt-vitamin B-12 deficient sheep. Br. J. Nutr. 1990;64:721-732[Medline]
24.
Kolhouse J. F., Allen R. H. Recognition of two intracellular cobalamin binding proteins and their identification as methylmalonyl-CoA mutase and methionine synthetase. Proc. Natl. Acad. Sci. U.S.A. 1977;74:921-925
25.
Kolhouse J. F., Utley C., Stabler S. P., Allen R. H. Mechanism of conversion of human apo- to holomethionine synthase by various forms of cobalamin. J. Biol. Chem. 1991;266:23010-23015
26. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.) 1970;227:680-685[Medline]
27.
Leclerc D., Wilson A., Dumas R., Gafuik C., Song D., Watkins D, Heng H.H.Q., Rommens J. M., Scherer S. W., Rosenblatt D. S., Gravel R. A. Cloning and mapping of a cDNA for methionine synthase reductase, a flavoprotein defective in patients with homocystinuria. Proc. Natl. Acad. Sci. U.S.A. 1998;95:3059-3064
28. Linnell J. C., Hoffbrand A. V., Hussein H.A.A., Wise I. J., Matthews D. M. Tissue distribution of coenzyme and other forms of vitamin B-12 in control subjects and patients with pernicious anaemia. Clin. Sci. Mol. Med. 1974;46:163-172[Medline]
29. McCully K. S. Vascular pathology of homocysteinemia: implications for the pathogenesis of arteriosclerosis. Am. J. Pathol. 1969;56:111-128[Medline]
30.
Mellman I. S., Youngdahl-Turner P., Willard H. F., Rosenberg L. E. Intracellular binding of radioactive hydroxocobalamin to cobalamin-dependent apoenzymes in rat liver. Proc. Natl. Acad. Sci. U.S.A. 1977;74:916-920
31. Metz J., van der Westhuyzen J. The fruit bat as an experimental model of the neuropathy of cobalamin deficiency. Comp. Biochem. Physiol. 1987;88A:171-177
32. Ogawa T., Tomono Y., Morishita N., Shishido R. Pharmacokinetics of injected mecobalamin (methylcobalamin) in healthy adults—intravenous and intramuscular routes. Bitamin 1989;63:123-131
33. Sambrook J., Fritsch E. F., Maniatis T. Molecular Cloning: A Laboratory Manual 1989 Cold Spring Harbor Laboratory Cold Spring Harbor, NY.
34. Seetharam B. Receptor-mediated endocytosis of cobalamin. Annu. Rev. Nutr. 1999;19:173-195[Medline]
35. Siess E. A., Brocks D. G., Wieland O. H. Subcellular distribution of adenine nucleotides and of metabolites of tricarboxylate cycle and gluconeogenesis in hepatocytes. Sies M. eds. Metabolic Compartmentation 1982:235-257 Academic Press New York, NY.
36. Steegers-Theunissen R.P.M., Boers G.H.J., Trijibels F.J.M., Eskes T.K.A.B. Neural-tube defects and derangement of homocysteine metabolism. N. Engl. J. Med. 1991;324:199-200[Medline]
37. Taylor R. T., Hanna M. L., Hutton J. J. 5-Methyltetrahydrofolate homocysteine cobalamin methyltransferase in human bone marrow and its relationship to pernicious anemia. Arch. Biochem. Biophys. 1974;165:787-795[Medline]
38. Toyoshima S., Watanabe F., Saido H., Miyatake K., Nakano Y. Methylmalonic acid inhibits respiration in rat liver mitochondria. J. Nutr. 1995;125:2846-2850
39. Ungley C. C. The chemotherapeutic action of vitamin B-12. Vitam. Horm. 1955;13:137-211[Medline]
40. Wada M., Kawata T., Yamada K., Funada U., Kuwamori M., Endo M., Tanaka N., Tadokoro T., Maekawa A. Serum C3 content in vitamin B-12-deficient rats. Int. J. Vitam. Nutr. Res. 1998;68:94-97[Medline]
41. Watanabe F., Nakano Y., Tachikake N., Saido H., Tamura Y., Yamanaka H. Vitamin B-12 deficiency increases the specific activities of rat liver NADH- and NADPH-linked aquacobalamin reductase isozymes involved in coenzyme synthesis. J. Nutr. 1991;121:1948-1954
42. Yamada K., Tobimatsu T., Toraya T. Cloning, sequencing, and heterologous expression of rat methionine synthase cDNA. Biosci. Biotechnol. Biochem. 1998;62:2155-2160[Medline]
43.
Yamada K., Yamada S., Tobimatsu T., Toraya T. Heterologous high-level expression, purification, and enzymological properties of recombinant rat cobalamin-dependent methionine synthase. J. Biol. Chem. 1999;274:35571-35576
44.
Zehnder A.J.B., Wuhrmann K. Titanium (III) citrate as a nontoxic oxidation-reduction buffering system for the culture of obligate anaerobes. Science (Washington, DC) 1976;194:1165-1166
This article has been cited by other articles:
|
|
 |
|
  S. A. Blaise, E. Nedelec, H. Schroeder, J.-M. Alberto, C. Bossenmeyer-Pourie, J.-L. Gueant, and J.-L. Daval Gestational Vitamin B Deficiency Leads to Homocysteine-Associated Brain Apoptosis and Alters Neurobehavioral Development in Rats Am. J. Pathol., February 1, 2007; 170(2): 667 - 679. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Zhang, A. Braun, Z. Bauman, H. Olteanu, P. Madzelan, and R. Banerjee Expression Profiling of Homocysteine Junction Enzymes in the NCI60 Panel of Human Cancer Cell Lines Cancer Res., February 15, 2005; 65(4): 1554 - 1560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Oltean and R. Banerjee Nutritional Modulation of Gene Expression and Homocysteine Utilization by Vitamin B12 J. Biol. Chem., May 30, 2003; 278(23): 20778 - 20784. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
