Journal of Nutrition EB Program 2010 Abstracts

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, Z.
Right arrow Articles by Nishida, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, Z.
Right arrow Articles by Nishida, T.
(Journal of Nutrition. 1999;129:1984-1991.)
© 1999 The American Society for Nutritional Sciences


Article

Secretion of Phospholipid Transfer Protein by Human Hepatoma Cell Line, Hep G2, Is Enhanced by Sodium Butyrate1 ,2

Ziwen Guo3, Chaoshen Yuan, Tzuping Wei-Lavery, Yulin Fang, Roy A. Garvin*,4, Hiro I. Nishida and Toshiro Nishida5

The Burnsides Research Laboratory, Department of Food Science & Human Nutrition and Division of Nutritional Sciences, University of Illinois, Urbana, IL 61801 and * Department of Chemical Pathology, Charing Cross and Westminster Medical School, University of London, England

5To whom correspondence should be addressed.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hep G2 cells were used to study the synthesis and secretion of phospholipid transfer protein (PLTP). Upon incubation of the cells at confluence with serum-free Dulbecco's modified Eagle's medium (DMEM), phosphatidylcholine (PC) transfer activity was found to accumulate in the culture media. The PC transfer activity in the media was effectively inhibited by rabbit anti-human PLTP immunoglobulin (Ig)G, thus indicating that the PC transfer activity was due to secreted PLTP. The molecular weight of Hep G2 PLTP was ~78 kDa by Western blot analysis, in agreement with the molecular weight obtained for purified human plasma PLTP. The PLTP secreted by Hep G2 also possessed an HDL conversion activity similar to that of human plasma PLTP. The addition of butyrate to the cell culture media resulted in a marked increase in the secretion of PLTP. After 24 h incubation with 4 mmol/L sodium butyrate, a more than twofold increase (P < 0.01) of PC transfer activity in the cell-conditioned media was obtained. The dose-dependent increase in the PC transfer activity in the media upon butyrate treatment was well correlated (r = 0.80, P < 0.01) with that of PLTP mass as determined by immuno-slot blot analysis of cell-conditioned media. The increased secretion of PLTP by Hep G2 treated with sodium butyrate was accompanied by a greater increase in the level of PLTP mRNA in the cells as determined by ribonuclease protection assay. In the presence of 4 mmol/L sodium butyrate, a fourfold increase (P < 0.01) in mRNA level was obtained at 24 h. No stabilizing effect of butyrate on PLTP mRNA was apparent upon treatment of the cultured cells with the RNA synthesis inhibitor, actinomycin D. Thus, the up-regulatory effect of butyrate on PLTP gene expression seemed to have occurred at the transcriptional level.


KEY WORDS: • Hep G2 • phospholipid transfer protein • sodium butyrate • messenger RNA


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Butyrate is produced in the colon of mammals upon microbial fermentation of dietary fiber, undigested starch and proteins (Morita et al. 1998Citation , Velázquez et al. 1997Citation , Wolin 1981Citation ). It was found that butyrate was not only metabolized by colonocytes but also represented the primary colonocyte nutrient (Roediger 1982Citation , Scheppach et al. 1992Citation ). Butyrate inhibits cell proliferation and stimulates cell differentiation in several cell lines, including rat and human hepatoma cells (Hague et al. 1993Citation , Saito et al. 1991Citation ). Furthermore, in an in vivo murine model of colon cancer, intravenous infusion of butyrate as well as intraluminal butyrate treatments had significant antitumor effects (Velázquez and Rombeau 1997Citation ). Thus, butyrate may have a potential role in colon cancer prevention and treatment. Expression of a number of genes in cultured mammalian cells is influenced by butyrate by either promotion or inhibition of the transcription (McKnight et al. 1980Citation ). Butyrate treatment was shown to alter nuclear protein phosphorylation and methylation as well as DNA methylation and histone acetylation (Cosgrove and Cox 1990Citation , Parker et al. 1986Citation , Riggs et al. 1977Citation ). However, the exact mechanisms causing the changes in gene expression by butyrate are not known.

Phospholipid transfer protein (PLTP)6 is a multifunctional protein. PLTP was shown to facilitate the transfer of not only phospholipids (Tall et al. 1983Citation and 1985Citation ), but also cholesterol (Nishida and Nishida 1997Citation ) among plasma lipoproteins and lipid particles, and potentially between cells and lipoproteins. PLTP promotes an enlargement of HDL3- to HDL2-sized particles in vitro. This enlargement was accompanied by the release of apolipoprotein A-I (apo A-I) and the formation of smaller HDL particles (Jauhiainen et al. 1993Citation , Tu et al. 1993Citation ). The release of apo A-I in vivo may generate nascent HDL particles, which could participate in reverse cholesterol transport. Dietary cholesterol increased plasma PLTP levels in mice (Jiang and Bruce 1995Citation , Meijer et al. 1993Citation ). No detailed study has yet been conducted on the effects of dietary and other factors on plasma PLTP levels or phospholipid transfer activty. The regulatory mechanisms of PLTP synthesis and secretion have also not yet been clarified.

PLTP mRNA was shown to be widely distributed in many tissues (Day et al. 1994Citation , Jiang and Bruce 1995Citation ). Although the PLTP mRNA level in liver is relatively low, liver may contribute to a major portion of plasma PLTP because of its large mass (Jiang and Bruce 1995Citation ). Hep G2, a human hepatoma–derived cell line, has been widely used to study the secretion of lipoproteins and apolipoproteins such as apo A-I and apo B-100 (Kaptein et al. 1991Citation and 1994Citation ). Recent study of transient expression of the luciferase gene fused with the PLTP 5' flanking region in Hep G2, COS and CHO cells showed that Hep G2 has the highest luciferase activity. Therefore, it was speculated that Hep G2 cells may contain all transcription factors necessary for the full function of the PLTP (Tu et al. 1995Citation and 1997Citation ). In this study, Hep G2 was used as a model of human hepatocyte to study PLTP secretion and gene expression. Butyrate was found to greatly increase the secretion of PLTP and PLTP mRNA levels by increasing primarily the gene transcription.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture.

Hep G2 cells were obtained from American Type Culture Collection (ATCC, Rockville, MD). The cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL of penicillin, 0.1 g/L of streptomycin and 4 mmol/L glutamine, under 95% air and 5% CO2 at 37°C. For the experiments, the cells were seeded into T25 flasks or 12-well culture plates. After the cells reached confluence, the monolayer was washed with PBS and then incubated with serum-free DMEM with or without sodium butyrate at the indicated concentrations. The cell-conditioned media were harvested after incubation and centrifuged at 1000 x g for 15 min at 4°C to remove cell debris. EDTA (0.1 g/L) and sodium azide (2 mmol/L) were added to the media. The cells were lysed with 0.1 mol/L NaOH, and the concentration of cell protein was measured by Bio-Rad protein assay (Bio-Rad, Hercules, CA).

PLTP activity assay and immunoinhibition.

Phosphatidylcholine (PC) transfer activity in Hep G2 cell–conditioned media was determined with the [3H]PC vesicles/HDL3 assay system in a manner similar to that described previously (Tu et al. 1993Citation ). The PC transfer activity was computed by subtracting the blank value (PC transfer in blank DMEM) from the experimental value (PC transfer in Hep G2 cell–conditioned media).

The methods for the isolation of human plasma PLTP and the preparation of rabbit anti-human plasma PLTP immunoglobulin (Ig)G were as described previously (Tu et al. 1993Citation ). Immunoprecipitation of PLTP activity in Hep G2 cell–conditioned media was carried out by incubation of rabbit anti-PLTP IgG with the cell-conditioned media at 4°C overnight and then by centrifugation of the incubated mixtures at 8000 x g for 30 min. The PC transfer activity remaining in the supernatant was determined.

Sucrose density gradient centrifugation (SDGC).

The PC transfer from PC vesicles to HDL3 by Hep G2 cell–conditioned media was assessed from the labeled PC distribution profile obtained by SDGC. The cell-conditioned media (24 h), supernatant of anti-PLTP IgG treated cell–conditioned media and DMEM (510 µL) were incubated with PLTP assay mixtures containing [3H]PC vesicles (90 nmol PC) and HDL3 (180 µg as protein) at 37°C for 60 min. Immediately after incubation, the density of the samples was adjusted to 1.25 kg/L with sucrose. The samples were then layered at the bottom of a sucrose density gradient by using 5.5 mL quick-seal tubes (Beckman, Palo Alto, CA) as previously described (Muesing and Nishida 1971Citation ). The samples were subjected to ultracentrifugation at 354,000 x g for 4.5 h at 4°C in a vertical Beckman VTi80 rotor. After centrifugation, a sucrose solution (d = 1.328 kg/L) was pumped into the bottom of the tube using a peristaltic pump, and samples were collected through tubing connected to an ISCO (Lincoln, NE) fraction collector at the top of the tube. The density of each fraction was determined by measuring the refractive index with a refractometer (Brinkmann, Chicago, IL). The amount of labeled PC in each fraction was determined by measuring the radioactivity with a liquid scintillation counter.

Purification of Hep G2 PLTP and Western blot analysis.

The Hep G2 PLTP was partially purified from cell-conditioned media by dextran sulfate/Ca2+ treatment and by chromatography using phenyl-Sepharose, heparin-Sepharose and hydroxyapatite columns in a manner similar to that described previously (Tu et al. 1993Citation ). Western blot analysis was carried out according to the method of Towbin et al. (1979)Citation . After SDS polyacrylamide gel electrophoresis, the proteins were transferred to a nitrocellulose membrane. The membrane was blocked by TBS (100 mmol/L Tris-HCl, 9 g/L NaCl, pH 7.5) containing 50 g/L nonfat dry milk. Monoclonal anti-human PLTP IgG (P2E5) and goat anti-mouse IgG conjugated with alkaline phosphatase (Bio-Rad, Hercules, CA) were used for immunodetection.

PLTP mass determination.

The changes in PLTP mass in the cell-conditioned media upon treatment with sodium butyrate were determined by immuno slot blot analysis. The cell-conditioned media were applied to a nitrocellulose membrane. PLTP on the membrane was probed by monoclonal anti-PLTP IgG (P2E5). The immunocomplex was subsequently detected by using sheep anti-mouse IgG horseradish peroxidase conjugate (Amersham, Arlington Heights, IL). The PLTP mass was determined by analyzing the image with the Photodyne Image Analysis System (Hartland, WI).

Effect of Hep G2 PLTP on HDL conversion.

The HDL conversion assay was carried out in a manner similar to that described previously (Tu et al. 1993Citation ). Isolated human HDL3 samples (18 µg as protein) were incubated for 12 h with aliquots of partially purified Hep G2 PLTP at 37°C (4°C for controls). For immunoinhibition of the HDL conversion, the same amount of the PLTP was preincubated with rabbit anti-PLTP IgG (100 µg) or nonimmunized IgG (100 µg) at 4°C overnight. The supernatant solutions of the IgG-treated samples were incubated with isolated HDL3 (18 µg) at 37°C for 12 h. After incubation, gradient gel electrophoresis (GGE) of the incubated mixtures was carried out on 4–20% nondenaturing gradient gels (Bio-Rad) in 0.09 mol/L Tris-HCl/0.08 mol/L borate buffer (pH 8.35) for 2000 Vh · 4°C. The GGE patterns were obtained by lipid staining of the gels with Sudan Black B (0.48%, Bio-Rad) in acetone/acetate/water (20:15:54, v/v/v) and subsequent destaining in the same solvent mixture. The gels were scanned using a gel scanner (ISCO). Particle sizes of HDL were determined by using high-molecular-weight standards (Pharmacia, Piscataway, NJ).

Ribonuclease protection assay (RPA).

The total RNA extracted from Hep G2 cells was used for reverse transcription. The human plasma PLTP cDNA was amplified from total cDNA by the polymerase chain reaction (PCR) using primers based on the human plasma PLTP cDNA sequence (5'CTCGCCATGGCCCTCTTCGG3' and 5'TGAATGACAGCTGCCAGCTTG3') (Day et al. 1994Citation ). The PCR reaction was carried out on a Hybaid Combi (TR2) Thermal Reactor (Hybaid Ltd, Teddington, Middlesex, UK). The PLTP cDNA fragment (1521 bp) was cloned into a pGEM-3Z (Promega, Madison, WI) vector at the Sma I site and subsequently transformed into Escherichia coli (JM 109). A 32P-labeled antisense RNA probe (220 bases) was generated for the RPA by in vitro transcription of linear PLTP cDNA (1404–1602) linked to the T7 promoter of the pGEM-3Z plasmid. This linear PLTP template was generated by treatment of the PLTP cDNA plasmid with Bsu36 I. In vitro transcription was carried out by using the MAXIscript T7 kit (Ambion, Austin, TX). Briefly, the reaction mixture containing the linear PLTP cDNA template, NTP, 1.9 x 106 Bq of [{alpha}-32P]UTP (3.0 x 1013 Bq/mmol, Amersham, Arlington Heights, IL) and RNA T7 polymerase was incubated at 37°C for 1 h. The DNA template was removed by addition of DNase to the mixture followed by incubation for 30 min at 37°C. The transcripts were then purified with 8 mol/L urea/5% polyacrylamide gel electrophoresis. The ß-actin mRNA was used as an internal control. The ß-actin antisense RNA probe was synthesized from the pTRI-ß-actin-Human (Ambion) by T7 transcription. 32P-UTP was diluted with unlabeled UTP as described previously (Leroy et al. 1996Citation ). The specific activity of ß-actin RNA probe was ~20-fold lower than that of the PLTP RNA probe. The size of the probe was 188 bp and that of the protected fragment of ß-actin RNA probe was 125 bp.

Hep G2 total RNA was extracted with acid guanidinium thiocyanate/phenol/chloroform (Chomczynski and Sacchi 1987Citation ) by using TRIZOL Reagent (GibcoBRL, Grand Island, NY) following the manufacturer's instruction. The abundance of Hep G2 PLTP mRNA was determined by RPA (Melton et al. 1994Citation ). RPA was carried out by using the HybSpeed RPA (Ambion) following the manufacturer suggested procedure. The images of protected fragments were detected on the PhosphorImager. The PLTP mRNA levels were determined by comparison with the levels of ß-actin mRNA recovered simultaneously.

Statistical analysis.

All data are reported as the means ± SEM. Differences between the control and sodium butyrate treatments were determined by one-way ANOVA using SigmaStat (version 1.0, 1993, Jandel Scientific, San Rafael, CA). When analysis gave a significant F-value (P < 0.05), Dunnett's method was employed to compare the control and each treatment group. Differences were considered significant if P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of PLTP secreted by Hep G2 cells.

The time-course study suggested that PC transfer activity of Hep G2 cell–conditioned media increased linearly with incubation times up to 48 h (Fig. 1Citation ). The activity reached a maximum at ~60 h and started to decline with further incubation. Western blot analysis of partially purified Hep G2 PLTP preparations with anti-PLTP IgG exhibited a single immunoreactive band of PLTP (Fig. 1Citation , inset). The apparent molecular weight of PLTP, 78 kDa, was identical to that of purified human plasma PLTP. SDGC was used to show actual transfer of labeled PC from vesicles to HDL3 by the cell-conditioned media and inhibition of this transfer by anti-PLTP IgG. The changes in the labeled PC distribution in [3H]PC vesicles/HDL3 mixtures were obtained in the presence and absence of cell-conditioned media and upon addition of anti-PLTP IgG. When the mixtures were incubated with Hep G2 cell–conditioned media, the decrease in PC radioactivity in vesicle fractions, compared with the control, was accompanied by a corresponding increase in PC radioactivity in HDL3 density fraction (d = 1.14 kg/L) (Fig. 2ACitation ). These changes in the labeled PC distribution were nullified upon incubation with the cell-conditioned media pretreated with anti-PLTP IgG as a result of the immunoinhibition of PC transfer activity in the cell-conditioned media (Fig. 2Citation B). When various concentrations of rabbit anti-PLTP IgG (0–200 µg) were incubated with the Hep G2 cell–conditioned media, immunoinhibition of the PC transfer activity occurred in a dose-dependent manner (Fig. 3ACitation ). The addition of nonimmunized rabbit IgG did not inhibit the PC transfer activity. The PC transfer activity of the Hep G2 cell media was heat labile at 58°C as reported previously for human plasma PLTP (Albers et al. 1984Citation ). The activity decreased with an increase in the incubation time (Fig. 3Citation B). Less than 25% of the PC transfer activity was left in the cell media after 2 h of heat treatment.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Time course of phospholipid transfer protein (PLTP) secretion by Hep G2 cells. The cell-conditioned media were collected at indicated time periods for assay of phosphatidylcholine (PC) transfer activity. Values are means ± SEM (n = 9). The inset shows Western blot analysis of Hep G2 PLTP and human plasma PLTP. The PLTP samples were subjected to SDS-PAGE (12% gel) and subsequently blotted onto a nitrocellulose membrane. Monoclonal anti-PLTP immunoglobulin (Ig)G (P2E5) was used for immunodetection. Lane 1 represents purified human plasma PLTP (500 ng); lane 2 shows PLTP isolated from the Hep G2 cell–conditioned media.

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Labeled phosphatidylcholine (PC) transfer from vesicles to HDL3 facilitated by Hep G2 phospholipid transfer protein (PLTP) as determined by sucrose density gradient centrifugation (SDGC). The mixtures of [3H]PC vesicles and HDL3 were incubated with cell-conditioned media or conditioned media pretreated with rabbit anti-human PLTP IgG (300 µg). Dulbecco's modified Eagle's medium (DMEM) was used as a control. The [3H]PC distribution profiles were obtained after SDGC of the mixtures as described in Materials and Methods. Panel A represents the profiles obtained for the mixtures containing cell-conditioned media and control DMEM. Panel B is for the mixtures containing cell-conditioned media pretreated with rabbit anti-human PLTP IgG and control DMEM.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Immunoinhibition of the phosphatidylcholine (PC) transfer activity (panel A) and heat inactivation (panel B) of Hep G2 phospholipid transfer protein (PLTP). For the immunoinhibition, the cell-conditioned media (24 h) were pretreated with various amounts of rabbit anti-human PLTP immunoglobulin (Ig)G or rabbit nonimmunized IgG before the determination of PC transfer activities. The PC transfer activities of the heat-treated samples were assayed after preincubation of aliquots (175 µL) of Hep G2 cell–conditioned media (24 h) at 58°C for varying periods of time. All values are given as the percentage of the PC transfer activity remaining in the media relative to the control values, which were 30 and 36 nmol of PC transferred/(mL · 30 min) for panels A and B, respectively.

 
Nondenaturing GGE was performed to test the HDL conversion activity of the Hep G2 PLTP. When the incubation of mixtures containing isolated HDL3 and PLTP partially purified from Hep G2 cell–conditioned media was carried out at 37°C for 12 h, isolated human HDL3 (8.3 nm) was enlarged to particles with a Stokes' diameter of 9.0 nm (Fig. 4Citation , pattern 3). This enlarging effect of Hep G2 PLTP was prevented by pretreatment of the partially purified Hep G2 PLTP with rabbit anti-PLTP IgG (pattern 4). The incubation mixtures kept at 4°C also showed no enlargement (pattern 5). The Stokes' diameters of particles obtained by treatment with rabbit anti-PLTP IgG and the control sample kept at 4°C were 8.4 and 8.5 nm, respectively. In contrast, nonimmunized IgG showed no inhibitory effect on HDL3 conversion (pattern 6).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. HDL enlargement mediated by Hep G2 phospholipid transfer protein (PLTP) as determined by gradient gel electrophoresis. Patterns 1 and 2 show densitometric scanning patterns of isolated human HDL3 and HDL2, respectively, kept at 37°C; pattern 3 is for HDL3 incubated with the partially purified Hep G2 PLTP at 37°C; pattern 4 is for HDL3 incubated with the partially purified PLTP kept at 4°C; patterns 5 and 6 are for HDL3 incubated at 37°C with the partially purified Hep G2 PLTP pretreated with rabbit anti-PLTP immunoglobulin (Ig)G and with nonimmunized IgG, respectively. All incubations were carried out for 12 h. The amount of partially purified Hep G2 PLTP in 50 µL that was applied to the gel was 220 µg, as protein; it contained 60 ng of PLTP, the quantity computed on the basis of the PC transfer activity present and the specific activity of PLTP purified to apparent homogeneity.

 
Effect of butyrate on PLTP secretion.

The treatment of Hep G2 cells with sodium butyrate profoundly enhanced the secretion of PLTP in the cell-conditioned media. The PC transfer activity increased with increasing concentrations of sodium butyrate (0–4 mmol/L). A twofold (300% of control, P < 0.01) increase of PC transfer activity was observed at the concentration of 4 mmol/L (Fig. 5Citation , panel A). The Hep G2 PLTP mass in the cell-conditioned media was determined with immuno-slot blot analysis. Figure 5Citation (panel B) shows that PLTP mass also increased upon treatment of butyrate in a dose-dependent manner (p < 0.01) and was well correlated with the increase in PLTP activity (r = 0.80, P < 0.01).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Effect of butyrate on phospholipid transfer protein (PLTP) secretion by Hep G2 cells. Panel A represents Hep G2 PLTP activity changes upon treatment with sodium butyrate. The cells were incubated with indicated amounts of sodium butyrate for 24 h. The PLTP activity of the cell-conditioned media was determined with phosphatidylcholine (PC) transfer assay as described in Materials and Methods. The results are expressed as a percentage of the control activity [47 ± 4.7 nmol of PC transferred/(mg cell protein · 30 min)]. The values are means ± SEM (n = 9). Panel B represents the changes of Hep G2 PLTP mass upon treatment with sodium butyrate. PLTP mass in the cell-conditioned media was determined with immuno-slot blot by using monoclonal anti-PLTP immunoglobulin (Ig)G (P2E5) as described in Materials and Methods. The amounts of PLTP in the cell-conditioned media are expressed as a percentage of the control value (15 ± 1.3 ng of secreted PLTP/mg cell protein). Values are means ± SEM (n = 9). *Indicates the significance of difference between the treated cells and controls (P < 0.05).

 
Effect of butyrate on PLTP gene expression.

The effect of butyrate on Hep G2 PLTP gene expression was determined by RPA. It was shown that the increase in sodium butyrate concentration from 0 to 4 mmol/L progressively increased the PLTP mRNA level (Fig. 6Citation ); a fourfold increase in mRNA level was observed at 4 mmol/L sodium butyrate compared with control (P < 0.01). The time course of butyrate effect on the level of PLTP mRNA in confluent Hep G2 cells showed a notable increase of PLTP mRNA level as early as 6 h of incubation with 4 mmol/L sodium butyrate. Further incubation caused a nearly linear increase in the mRNA level, giving a fourfold increase above the level in control cells (Fig. 7Citation ). When butyrate was removed from the culture media after 12 h of exposure to 4 mmol/L sodium butyrate, PLTP mRNA levels decreased to the control levels in 24 h (data not shown). These results indicated that sodium butyrate increased PLTP mRNA levels in both a dose- and time-dependent manner.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Ribonuclease protection assay (RPA) for phospholipid transfer protein (PLTP) mRNA abundance in Hep G2 cells upon treatment with sodium butyrate. Hep G2 cells were cultured in T25 flasks until reaching the confluence. The cells were then incubated with indicated amounts of sodium butyrate for 24 h. The Hep G2 RNA was extracted and equal amounts of total RNA (50 µg) were applied for ribonuclease protection assay (RPA) using a 32P-labeled PLTP antisense RNA probe as described in Materials and Methods. Panel A shows the representative images of protected fragments for PLTP (200 bases) and ß-actin (125 bases) detected by PhosphorImager. Panel B represents quantified results of the dose-dependent effect of butyrate on Hep G2 PLTP mRNA levels. Relative PLTP mRNA levels were determined by comparison with those of ß-actin mRNA. The PLTP mRNA levels in butyrate-treated cells are expressed as percentages of the control. Values are means ± SEM (n = 6). *Indicates the significance of difference between the treated cells and the control (P < 0.05).

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Time course of Hep G2 phospholipid transfer protein (PLTP) mRNA levels upon treatment with sodium butyrate. Hep G2 cells were incubated with 4 mmol/L sodium butyrate for indicated time periods and the cellular RNA were extracted as described in Materials and Methods. Total RNA (50 µg) was subjected to ribonuclease protection assay (RPA) as given for Figure 6Citation . The control represents the cells incubated with serum-free Dulbecco's modified Eagle's medium (DMEM) without sodium butyrate. The results are expressed as the percentage of the time-matched control value. Values are means ± SEM (n = 6).

 
Effect of butyrate on PLTP mRNA stability.

To ascertain whether the enhancing effect of butyrate on PLTP gene expression was due to promotion of transcription or also involved an increase in mRNA stability, the rate of decay of Hep G2 PLTP mRNA abundance was determined. Hep G2 cells were incubated with serum-free DMEM in the presence and absence of 4 mmol/L sodium butyrate for 12 h. RNA synthesis inhibitor, actinomycine D (5 mg/L), was then added into the cell culture media followed by further incubation. Hep G2 PLTP mRNA concentrations were measured by RPA after incubation of the cells with actinomycine D for 4, 8 and 12 h. The rates of decrease of PLTP mRNA level upon addition of actinomycine D were not different in the presence and absence of butyrate (Fig. 8Citation ). After 12 h of incubation, ~50% decreases were observed in both cases. It appeared that sodium butyrate did not have a significant stabilizing effect on Hep G2 PLTP mRNA.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 8. Effect of butyrate on the stability of Hep G2 phospholipid transfer protein (PLTP) mRNA. Hep G2 cells grown on T25 flasks were incubated with serum-free Dulbecco's modified Eagle's medium (DMEM) in the presence and absence of 4 mmol/L sodium butyrate for 12 h (defined as time zero). Actinomycin D (5 mg/L) was added into the cell culture media and the cells were further incubated for the indicated time periods. Cellular RNA was harvested and equal amounts of total RNA (50 µg) were applied for ribonuclease protection assay (RPA) as described in Materials and Methods to determine the abundance of PLTP mRNA. PLTP mRNA levels were determined by comparison with those of ß-actin mRNA. The differences of PLTP mRNA levels were expressed as the percentage of the value obtained at time zero. Values are means ± SEM (n = 6).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, phospholipid transfer activity secreted from Hep G2 was found to accumulate in the cell-conditioned media. The secreted PC transfer activity was inhibited by anti-human plasma PLTP IgG in a manner similar to that observed for purified human plasma PLTP or PLTP present in plasma (Tu et al. 1993Citation ). The secreted PLTP possessed an apparent molecular weight of 78 kDa and a thermosensitive property similar to that of human plasma PLTP (Albers et al. 1984Citation , Tu et al. 1993Citation ). We demonstrated that the PLTP secreted by Hep G2 cells possessed not only PC transfer activity but also HDL conversion activity as previously observed with human plasma PLTP (Jauhiainen et al. 1993Citation , Tu et al. 1993Citation ). Furthermore, the HDL conversion was inhibited by pretreating Hep G2 PLTP with rabbit anti-PLTP IgG. Although, the HDL3 enlargement mediated by Hep G2 PLTP was limited, this was also true with human PLTP at plasma concentrations (Tu et al. 1993Citation ). These observations suggest that the Hep G2 cells synthesize and secrete PLTP that has properties identical to those of human plasma PLTP.

Our results showed that the secretion of PLTP from Hep G2 cells as well as PLTP gene expression in the cells was greatly enhanced by inclusion of sodium butyrate in the cell media. The butyrate effect on the PLTP mRNA level was more pronounced than its effect on the PLTP secretion, as shown by both PC transfer activity and mass determinations. Although modest increases in PLTP secretion were observed at butyrate concentrations <2 mmol/L, a more than twofold increase in the secretion occurred at 4 mmol/L. In contrast, the increase in mRNA levels upon increase in butyrate concentrations from 1 to 4 mmol/L gave a more linear response. It is yet to be determined whether PLTP synthesis reaches a threshold before secretion. Further study of the butyrate effects is necessary to clarify the interrelationship of PLTP gene transcription, translation and secretion.

Butyrate, a naturally occurring 4-carbon fatty acid, is produced by the microbial fermentation of undigested material reaching the colon. Both dietary fiber and undigested starch and protein constitute the principal substrates for the fermentation of short-chain fatty acids in humans (Velázquez et al. 1997Citation ). It has been demonstrated that total short-chain fatty acid concentrations are high in the colon, ranging from 80 to 131 mmol/kg intestinal contents, with butyrate comprising ~20% of the total concentrations (Cummings 1994Citation ). A major proportion (72%) of butyrate is very rapidly metabolized in the colonic epithelial cells. The concentration of butyrate (4 mmol/L) that gave very pronounced effects on PLTP secretion and mRNA expression could be within physiologic concentration ranges for colon cells. However, it is a pharmacologic concentration for other cells such as hepatocytes and peripheral cells. Butyrate concentrations in plasma and portal vein remain low in general (Cummings 1994Citation , Roediger 1994Citation ). Other short-chain fatty acids such as acetate and propionate also gave significant increases in the PLTP secretion (data not shown), although the extent of the enhancements was considerably less than that observed for butyrate.

Sodium butyrate is likely to regulate PLTP gene expression by promoting transcriptional activation. Our results showed that the reduction in PLTP mRNA concentrations by addition of actinomycin D was of the same magnitude in the presence and absence of sodium butyrate. Apparently, butyrate did not stabilize PLTP mRNA. Previous studies revealed that the effects of butyrate on the expression of various genes could take place either transcriptionally or post-transcriptionally (Pan et al. 1991Citation , Saini et al. 1990Citation ). In most cases, butyrate seemed to act via a transcriptional mechanism (Kruh et al. 1994Citation ). It is interesting to note that low levels of cholesteryl ester transfer protein (CETP) gene transcription in Hep G2 cells was due to low levels of C/enhancer binding protein (EBP) (Agellon et al. 1992Citation ). The enhancing effect of butyrate on CETP mRNA levels in Hep G2 cells was attributed to up-regulation of the expression of C/EBP (Sperker et al. 1993Citation ), which activates the CETP gene promoter (Agellon et al. 1992Citation ). Although consensus sequences for potential binding of C/EBP are present in the 5'-flanking region of the PLTP gene, these sequences are not located in the functional promoter region, -230 to -72 (Tu et al. 1995Citation ). Whether C/EBP is involved either directly or indirectly in enhanced transcription of PLTP gene by sodium butyrate treatment requires clarification. Although butyrate treatment of Hep G2 cells gave degrees of increase in CETP mRNA levels comparable to those observed with PLTP mRNA levels, its enhancing effect on CETP secretion was less pronounced than on PLTP secretion (Sperker et al. 1993Citation ). Furthermore, in contrast to PLTP secretion, very low or undetectable levels of CETP are secreted in the Hep G2 media in the absence of butyrate (Agellon et al. 1992Citation , Clark et al. 1995Citation , Richardson et al. 1996Citation ). Transcriptional as well as post-transcriptional factors that cause these differnces in the expression of CETP and PLTP are yet to be investigated. Both CETP and PLTP belong to the lipid transfer/lipopolysaccharide-binding protein family (Lagrost et al. 1998Citation ).

The importance of PLTP in lipid and lipoprotein metabolism has recently been well recognized. PLTP was shown to promote the transfer and exchange of not only phospholipids (Tall et al. 1983Citation and 1985Citation ) but also cholesterol (Nishida and Nishida 1997Citation ). PLTP may enhance reverse cholesterol transport. In transgenic mice, PLTP expression appears to be positively related to HDL cholesterol level (Albers et al. 1996Citation , Jiang et al. 1996Citation ). PLTP could release apoA-I during the conversion of HDL3- to HDL2-sized particles (Pussinen et al. 1995Citation , Tu et al. 1993Citation ) and transform discoidal HDL into vesicular structures (Nishida et al. 1997Citation ). The apoA-I released could promote cholesterol efflux from plasma membranes of various cells (Fielding and Fielding 1995Citation , Oram and Yokoyama 1996Citation ). The very pronounced effects of butyrate on both PLTP gene expression and PLTP secretion observed in this study suggest that sodium butyrate may have a role as a useful agent with which to investigate the mechanisms of transcriptional regulation of PLTP gene expression.


    ACKNOWLEDGMENTS
 
The authors gratefully acknowledge the excellent technical assistance of Daniel Klock and Lana Powers.


    FOOTNOTES
 
1 Presented in part at Experimental Biology 95, April 1995, Atlanta, GA [Guo, Z., Nishida, H. & Nishida, T. (1995) Phospholipid transfer protein (PLTP) secreted by human hepatoma cell line, Hep G2. FASEB J. 9: A769 (abs.)] and Experimental Biology 96, April 1996, Washington, DC [Guo, Z., Nishida, H. & Nishida, T. (1996) Phospholipid transfer protein (PLTP) secretion, gene expression and HDL formation by Hep G2 cell line as influenced by butyrate. FASEB J. 10: A747 (abs.)]. Back

2 Supported in part by USPHS, National Institutes of Health Grant HL 17597 and by funds from the Illinois Agriculture Experiment Station, the University of Illinois Foundation and American Heart Association, Illinois Affiliate, Student Stipend SS-03 (to Z.G.). Back

3 Current Address: Department of Pathology and Laboratory Medicine, University of Wisconsin Hospital and Clinics, Madison, WI 53792. Back

4 Current Address: Department of Cardiovascular Biochemistry, St. Bartholomew's and the Royal London School of Medicine and Dentistry, Charterhouse Square, London EC1M 6BQ. Back

6 Abbreviations used: apo, apolipoprotein; CETP, cholesteryl ester transfer protein; DMEM, Dulbecco's modified Eagle's medium; EBP, enhancer binding protein; FBS, fetal bovine serum; GGE, gradient gel electrophoresis; Ig, immunoglobulin; PC, phosphatidylcholine; PCR, polymerase chain reaction; PLTP, phospholipid transfer protein; RPA, ribonuclease protection assay; SDGC, sucrose density gradient centrifugation. Back

Manuscript received March 25, 1999. Initial review completed May 12, 1999. Revision accepted July 19, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

1. Agellon L. B., Zhang P., Jiang X. C., Mendelsohn L., Tall A. R. The CCAAT/enhancer-binding protein trans-activates the human cholesteryl ester transfer protein gene promoter. J. Biol. Chem. 1992;267:22336-22339[Abstract/Free Full Text]

2. Albers J. J., Tollefson J. H., Chen C. H., Steinmetz A. Isolation and characterization of human plasma lipid transfer protein. Arteriosclerosis 1984;4:49-58[Abstract/Free Full Text]

3. Albers J. J., Tu A. Y., Paigen B., Chen H., Cheung M. C., Marcovina S. M. Transgenic mice expressing human phospholipid transfer protein have increased HDL non-HDL cholesterol ratio. Int. J. Clin. Lab. Res. 1996;26:262-267[Medline]

4. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-159[Medline]

5. Clark R. W., Moberly J. B., Bamberger M. J. Low level quantification of cholesteryl ester transfer protein in plasma subfractions and cell culture media by monoclonal antibody-based immunoassay. J. Lipid Res. 1995;36:876-889[Abstract]

6. Cosgrove D., Cox G. S. Effect of sodium butyrate and 5-azacytidine on DNA methylation in human tumor cell lines: variable response to drug treatment and withdrawal. Biochim. Biophys. Acta 1990;1087:80-86[Medline]

7. Cummings J. Quantitating short chain fatty acid production in humans. Binder H. S. Cummings J. Soergel K. eds. Short Chain Fatty Acids 1994:11-19 Kluwer Academic Publishers Boston, MA.

8. Day J. R., Albers J. J., Lofton-Day C. E., Gilbert T. L., Ching A.F.T., Grant F. J., O'Hara P. J., Marcovina S. M., Adolphson J. L. Complete cDNA encoding human phospholipid transfer protein from human endothelial cells. J. Biol. Chem. 1994;269:9388-9391[Abstract/Free Full Text]

9. Fielding C. J., Fielding P. E. Molecular physiology of reverse cholesterol transport. J. Lipid Res. 1995;36:211-228[Abstract]

10. Hague A., Manning A. M., Hanlon K. A., Huschtscha L. I., Hart D., Paraskeva C. Sodium butyrate induces apoptosis in human colonic tumor cell lines in a p53-independent pathway: implications for the possible role of dietary fibre in the prevention of large-bowel cancer. Int. J. Cancer 1993;55:498-505[Medline]

11. Jauhiainen M., Metso J., Pahlman R., Blomqvist S., van Tol A., Ehnholm C. Human plasma phospholipid transfer protein causes high density lipoprotein conversion. J. Biol. Chem. 1993;268:4032-4036[Abstract/Free Full Text]

12. Jiang X. C., Bruce C. Regulation of murine plasma phospholipid transfer protein activity and mRNA levels by lipopolysaccharide and high cholesterol diet. J. Biol. Chem. 1995;270:17133-17138[Abstract/Free Full Text]

13. Jiang X. C., Francone O. L., Bruce C., Milne R., Mar J., Walsh A., Breslow J. L., Tall A. R. Increased pre-beta high density lipoprotein, apolipoprotein AI, and phospholipid in mice expressing the human phospholipid transfer protein and human apolipoprotein AI transgenes. J. Clin. Investig. 1996;96:2373-2380

14. Kaptein A., de Wit E. C., Princen H.M.G. Butyrate stimulates the secretion of apolipoprotein B-100-containing lipoproteins from Hep G2 cells by inhibiting the intracellular degradation. Biochim. Biophys. Acta 1994;1213:349-356[Medline]

15. Kaptein A., Roodenburg L., Princen H.M.G. Butyrate stimulates the secretion of apolipoprotein (apo) A-I and apo B 100 by the human hepatoma cell line Hep G2. Induction of apo A-I mRNA with no change of apo B100 mRNA. Biochem. J. 1991;278:557-564

16. Kruh J., Tichonicky L., Defer N. Effect of butyrate on gene expression. Binder H. Cummings J. Soergel K. eds. Short Chain Fatty Acids 1994:135-147 Kluwer Academic Publishers Boston, MA.

17. Lagrost L., Desrumaux C., Masson D., Deckert V., Gambert P. Structure and function of the plasma phospholipid transfer protein. Curr. Opin. Lipidol. 1998;9:203-209[Medline]

18. Leroy P., Dessolin S., Villageois P., Moon B. C., Friedman J. M., Ailhaud G., Dani C. Expression of ob gene in adipose cells—regulation by insulin. J. Biol. Chem. 1996;271:2365-2368[Abstract/Free Full Text]

19. McKnight G. S., Hager L., Palmitter R. D. Butyrate and related inhibitors of histone deacetylation block the induction of egg white genes by steroid hormones. Cell 1980;22:469-477[Medline]

20. Meijer G. W., Demacker P.N.M., van Tol A., Groener J.E.L.M. Plasma activities of lecithin:cholesterol acyltransferase, lipid transfer proteins and post-heparin lipases in inbred strains of rabbits hypo- or hyper-responsive to dietary cholesterol. Biochem. J. 1993;293:729-734

21. Melton D. A., Kreig P. A., Rebagliati M. R., Maniatis T., Zinn K., Green M. R. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 1994;1:7035-7057

22. Morita T, Kasaoka S., Oh-hashi A., Ikai M., Numasaki Y., Kiriyama S. Resistant proteins alter cecal short-chain fatty acid profiles in rats fed high amylase cornstarch. J. Nutr. 1998;128:1156-1164[Abstract/Free Full Text]

23. Muesing R. A., Nishida T. Disruption of low- and high-density human plasma lipoproteins and phospholipid dispersions by 1-anilinonaphthalene-8sulfonate. Biochemistry 1971;10:2952-2962[Medline]

24. Nishida H. I., Klock D. G., Guo Z., Jakstys B. P., Nishida T. Phospholipid transfer protein can transform reconstituted discoidal HDL into vesicular structures. Biochim. Biophys. Acta 1997;1349:222-232[Medline]

25. Nishida H. I., Nishida T. Phospholipid transfer protein mediates transfer of not only phosphatidylcholine but also cholesterol from phosphatidylcholine-cholesterol vesicles to high density lipoproteins. J. Biol. Chem. 1997;272:6959-6964[Abstract/Free Full Text]

26. Oram J. F., Yokoyama S. Apolipoprotein-mediated removal of cellular cholesterol and phospholipids (review). J. Lipid Res. 1996;37:2473-2491[Abstract]

27. Pan C. J., Sartwell A. D., Chou J. Y. Transcriptional regulation and the effects of sodium butyrate and glycosylation on catalytic activity of human germ cell alkaline phosphatase. Cancer Res 1991;15:2058-2062

28. Parker M. I., de Haan J. B., Gevers W. DNA hypermethylation I sodium butyrate-treated WI-38 fibroblasts. J. Biol. Chem. 1986;261:2786-2790[Abstract/Free Full Text]

29. Pussinen P., Jauhiainen M., Metso J., Tyynelä J., Ehnholm C. Pig plasma phospholipid transfer protein facilitates HDL interconversion. J. Lipid Res. 1995;36:975-985[Abstract]

30. Richardson M. A., Berg D. Y., Johnston P. A., McClure D., Grinnell B. W. Human liposarcoma cell line, SW872, secretes cholesteryl ester transfer protein in response to cholesterol. J. Lipid Res. 1996;37:1162-1166[Abstract]

31. Riggs M. G., Whittaker R. G., Neumann J. R., Ingram V. M. n-Butyrate causes histone modification in HeLa and Friend erythroleukaemia cells. Nature (Lond.) 1977;268:462-464[Medline]

32. Roediger W.E.W. Utilisation of nutrients by isolated epithelial cells of the rat colon. Gastroenterology 1982;83:424-429[Medline]

33. Roediger W.E.W. Imprint of disease on short-chain fatty acid metabolism by colonocytes. Binder H. Cummings J. Soergel K. eds. Short Chain Fatty Acids 1994:195-295 Kluwer Academic Publishers Boston, MA.

34. Saini K., Steele G., Thomas P. Induction of carcinoembryonic-antigen-gene expression in human colorectal carcinoma by sodium butyrate. Biochem. J. 1990;272:541-544[Medline]

35. Saito H., Morizane T., Watanabe T., Kagawa T., Miyaguchi S., Kumagai N., Tsuchiya M. Differentiating effect of sodium butyrate on human hepatoma cell lines PLC/PRF/5, HCC-M and HCC-T. Int. J. Cancer 1991;48:291-296[Medline]

36. Scheppach W., Sommer H., Kirchner T., Pagneli G. H., Bartram P. Effect of butyrate enemas on the colonic mucosa in distal ulcerative clotis. Gastroenterology 1992;103:51-56[Medline]

37. Sperker B., Mark M., Budzinski R. M. The expression of human plasma cholesteryl-ester-transfer protein in Hep G2 cells is induced by sodium butyrate quantification of low mRNA levels by polymerase chain reaction. Eur. J. Biochem. 1993;218:945-950[Medline]

38. Tall A. R., Abreu E., Shuman J. Separation of a plasma phospholipid transfer protein from cholesterol ester/phospholipid exchange protein. J. Biol. Chem. 1983;258:2174-2180[Free Full Text]

39. Tall A. R., Krumholz S., Olivecrona T., Deckelbaum R. J. Plasma phospholipid transfer protein enhances transfer and exchange of phospholipids between very low density lipoproteins and high density lipoproteins during lipolysis. J. Lipid Res. 1985;26:842-851[Abstract]

40. Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 1979;76:4350-4354[Abstract/Free Full Text]

41. Tu A. Y., Nishida H. I., Nishida T. High density lipoprotein conversion mediated by human plasma phospholipid transfer protein. J. Biol. Chem. 1993;268:23098-23105[Abstract/Free Full Text]

42. Tu A. Y., Wolfbauer G., Albers J. J. Functional characterization of the promoter region of the human phospholipid transfer protein gene. Biochem. Biophys. Res. Commun. 1995;217:705-711[Medline]

43. Tu A. Y., Wolfbauer G., Chen H., Albers J. J. DNA sequences essential for transcription of human phospholipid transfer protein gene in Hep G2 cells. Biochem. Biophys. Res. Commun. 1997;232:574-577[Medline]

44. Velázquez O. C., Ledere H. M., Rombeau J. L. Butyrate and the colonocyte-production, absorption, metabolism, and therapeutic implications. Kritchevsky D. Bonfield C. eds. Dietary Fiber in Health and Disease 1997:123-134 Plenum Press New York, NY.

45. Velázquez O. C., Rombeau J. L. Butyrate—potential role in colon cancer prevention and treatment. Kritchevsky D. Bonfield C. eds. Dietary Fiber in Health and Disease 1997:169-181 Plenum Press New York, NY.

46. Wolin M. J. Fermentation in the rumen and human large intestine. Science (Washington, DC) 1981;213:1463-1468[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Lipid Res.Home page
S. Siggins, M. Jauhiainen, V. M. Olkkonen, J. Tenhunen, and C. Ehnholm
PLTP secreted by HepG2 cells resembles the high-activity PLTP form in human plasma
J. Lipid Res., September 1, 2003; 44(9): 1698 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
V. Marcil, E. Delvin, E. Seidman, L. Poitras, M. Zoltowska, C. Garofalo, and E. Levy
Modulation of lipid synthesis, apolipoprotein biogenesis, and lipoprotein assembly by butyrate
Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G340 - G346.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, Z.
Right arrow Articles by Nishida, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, Z.
Right arrow Articles by Nishida, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 1999 by American Society for Nutrition