![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Departamento de Fisiología de la Nutrición, Instituto Nacional de Nutrición, México D.F., 14000, Mexico
2To whom correspondence should be addressed.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: • amino acid imbalance • gene expression • histidase • histidine • rats
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and by glucagon and
hydrocortisone (Alemán 1998
). This response to the
protein content occurs in well nourished, and during nutritional
rehabilitation of previously undernourished rats (Tovar et al. 1998
). However, the induction of the Hal gene is not dependent
on histidine concentration of the diet (Torres et al. 1998
).
There is evidence that the intake of imbalanced diets for several days
stimulates the activity of some amino acid degrading enzymes. Serine
dehydratase activity increases in rats fed a histidine-imbalanced
diet (Anderson et al. 1969
). Also, threonine imbalance
increases the activity of threonine dehydrogenase (Davis and Austic 1994
). The stimulation of enzyme activity observed in
these studies is one of several adaptive mechanisms responding to
consuming an imbalanced diet (Gietzen 1993
).
On the other hand, the consumption of a diet containing one amino
acid below its requirement increases the rate of oxidation for other
amino acids (Benevenga et al. 1993
). Thus, feeding
growing pigs a diet limited in histidine produces an increase in
phenylalanine oxidation, and when histidine is added at its required
level, phenylalanine oxidation reduces to basal levels (Kim et al. 1983
). Studies with rats also showed that consumption of a
diet containing levels of threonine below that required increases the
catabolism of valine and methionine (Stipanuk and Benevenga 1977
). Feeding rats with a diet containing zein as protein
source, which essentially lacks lysine and tryptophan, produces an
increase in the rate of threonine and leucine oxidation (Kim et al. 1996
).
Thus, if the concentration of one indispensable amino acid is below that required, it seems to increase the activity of the amino acid degrading enzymes, however there are no studies at the present time that indicate that this condition results in an induction of the gene expression of the amino acid degrading enzymes. The purpose of the present study was to assess whether feeding highly histidine-imbalanced diets affects the activity and mRNA concentration of hepatic histidase, extend the understanding of the effect of excess dietary protein on the stimulation of Hal gene induction, and to gain knowledge about whether disproportion in the amino acid profile of the diet, which is present in low-quality proteins, can modify the expression of the amino acid degrading enzymes, such as Hal.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
L-Leucine, L-arginine, L-valine,
L-phenylalanine, L-isoleucine and
L-histidine were a gift from Kyowa Hakko Kogyoo, Japan, and
L-tryptophan, L-threonine, L-lysine
and L-methionine were from Fermentaciones Mexicanas S.A de
C.V, México. Nylon membrane filters (Hybond-N+),
rediprime DNA labeling system and deoxycytidine
5'[
-32P] triphosphate (110 TBq/mmol) were purchased
from Amersham (Buckinghamshire, UK), and the Gene Clean II kit was
purchased from Bio 101 (La Jolla, CA).
Animals.
Male Wistar rats, obtained from the Experimental Research Department and Animal Care Facilities at the National Institute of Nutrition, México D. F., were housed individually in wire, stainless steel cages at 22°C with a 12-h light-dark cycle and with free access to water.
Dietary treatments.
Forty-two rats, weighing 75–90 g, had free access to the appropriate diet for 10 d and were randomly divided into seven groups of six rats each: 1) fed 6% casein (basal diet), 2) fed a 20% casein (control-20), 3) fed a 35% casein (control-35), 4) fed a histidine-imbalanced diet containing 6% casein plus a mixture of indispensable amino acids (IAA) equivalent to a 20% casein diet devoid of histidine (I-20), 5) fed a corrected diet containing 6% casein plus a mixture of IAA including histidine equivalent to a 20% casein diet (Cr-20), 6) fed a histidine-imbalance diet containing 6% casein plus a mixture of IAA equivalent to a 35% casein diet devoid of histidine (I-35), 7) fed 6% casein plus a mixture of IAA including histidine equivalent to a 35% casein diet (Cr-35). At the end of the 10-d period, the rats were anesthetized with carbon dioxide and killed by decapitation between 0900 and 1000 h. Blood was collected and plasma was obtained by centrifugation at 2,000 x g and kept at -20°C until amino acid analysis. The liver was dissected immediately, and a tissue sample was frozen in liquid nitrogen for RNA extraction and the rest was used to measure enzyme histidase activity. The protocol of this study was approved by the Ethical Committee in Animal Experimentation of the National Institute of Nutrition.
Diets.
Diets were administered in dry form. The composition of basal and
imbalanced diets is described in Table 1
. The basal diet contained 60 g of vitamin-free casein/kg diet
supplemented with 0.2% L-methionine and 0.4%
L-threonine to improve the nutritional quality of casein.
The 20 and 35% casein diets contained 200 and 350 g
vitamin-free casein/kg diet, respectively. The concentration of the
rest of the ingredients was described previously (Torres et al. 1998
). The vitamin-free casein and the rest of the
ingredients were obtained from Teklad, Madison, WI.
|
Pooled samples of serum were prepared by mixing equal amounts of serum
from all animals of each dietary treatment group. Protein-free
sulfosalicylic acid extracts were prepared as described previously
(Tovar et al. 1996
) and were analyzed for free amino
acid content in a Beckman System 6300 high performance amino acid
analyzer (Beckman Instruments, Palo Alto, CA).
Histidase activity.
One g of liver was washed with ice-cold saline, blotted and
homogenized with a polytron (PT2000 Kinematica, Lucerne, Switzerland)
at the lowest setting in 4 mL of an ice-cold solution containing 5
mmol NaOH/L in 14 mmol KCl/L. The homogenates were centrifuged for 60
min at 105,000 x g, and the clear supernatant was
stored at -80°C before measuring histidase activity. The activity
was assayed as described previously (Spolter and Baldridge 1963
). The method is based on the spectrophotometric
measurement of the appearance of urocanic acid at 277 nm. The reaction
was linear for 10 min at 25°C in 0.1 mol pyrophosphate buffer/L, pH
9.2. An enzyme unit was defined as the formation of 1 nmol of urocanic
acid/min. The protein concentration was measured by Biuret assay with
bovine serum albumin standards.
Northern blot analysis.
Total RNA was isolated from the liver according to the method of
Chomczynski and Sacchi (1987
). For Northern analysis, 20
µg RNA was electrophoresed in a 0.8% agarose gel containing 37%
formaldehyde, transferred to a nylon membrane filter
(Hybond-N+) and cross-linked with a UV crosslinker
(Amersham). The cDNA probe was a 1.95 kb polymerase chain reaction
(PCR) product amplified from rat liver histidase cDNA that was kindly
provided by Dr. R. R. McInnes (The Hospital for Sick Children,
Toronto, Canada; Taylor et al. 1990
). The forward and
reverse primers used for the PCR reaction were 5'ATGCCTAGGTACACGGTGC3'
and 5' TTAAAGATCGTCAGACTCTG 3', respectively. The PCR product was
purified with Gene Clean and labeled with Redivue
[-32P] deoxycytidine 5'[-32P]
triphoshate (110 TBq/mmol) by using the Rediprime DNA labeling kit.
Membranes were prehybridized with rapid-hyb buffer (Amersham) at
65°C for 30 min and then hybridized with the cDNA probe (53.3 MBq/L)
for 2.5 h at 65°C. Membranes were washed once with 2X citrate
saline solution (SSC) (1X SSC = 0.15 mol sodium
chloride/L · 15 mol sodium citrate/L) · 0.1% SDS at room
temperature for 20 min and then twice for 15 min with 0.1X SSC/0.1%
SDS at 65°C. Digitized images and quantification of radioactivity
(dpm) of the bands were done by using the Instant Imager (Packard
Instrument, Meriden, CT). Membranes were also exposed to Extascan film
(Kodak) at -70°C with an intensifying screen.
Statistical analysis.
Results are presented as mean ± SEM. Statistical analysis was done by one-way ANOVA. Significant differences among groups were determined by Fisher's protected least square difference test. When the error variance in the groups was heterogeneous, a logarithmic transformation of data was carried out before ANOVA analysis. Differences were considered significant at P < 0.05. The association between serum histidine concentration and protein content of the diet was analyzed by linear regression (Statview statistical analysis program, V.4.5, Abacus Concepts, Berkeley, CA).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Liver weight, food intake and histidine consumed were a function of the
dietary protein content of the diet (Table 2
). These variables were higher in rats fed the 35% than the 6% casein
diet. The groups of rats fed imbalanced diets showed lower weight gain
and liver weight than the groups fed 6, 20 or 35% casein. Higher amino
acid imbalance resulted in lower weight gain in the rats. The
histidine-corrected groups showed higher histidine intake, food
intake and body weight gain than the groups fed imbalanced diets, but
they did not reach the values seen in rats fed the 20 or 35% casein
diets. This effect was probably produced by the lack of addition of
indispensable amino acids to the corrected diets.
|
Serum histidine concentration was inversely proportional to the protein
content of the diet [r = 0.98, P < 0.05 (Fig. 1
)]. Serum histidine concentration in the group fed the I-20 diet was
similar to that in rats fed the basal diet, however in rats fed a
highly histidine-imbalanced diet (I-35), histidine concentration
was lower than in rats fed the basal diet. Histidine concentration in
rats fed the corrected diets was higher than their respective
imbalanced groups.
|
Hal activity increased as the protein content in the diet increased.
Hal activity in the I-20 and I-35 groups was 2- and 3.2-fold higher
than in the basal group [6% (P < 0.01)], and it was
67 and 40% higher than the Cr-20 and Cr-35 groups, respectively
(P < 0.01). Greater histidine imbalance increased Hal
activity (P < 0.01). Therefore, consumption of a
highly histidine-imbalanced diet was associated with a reduction in
food intake, leading to an increase in Hal activity (Fig. 2
). It would be expected that Hal activity in rats fed the Cr-20 or Cr-35
diets were similar to the groups fed the 20 or 35% casein diets,
however Hal activity in the Cr-35 group was lower than in the rats fed
the 35% casein diet, which can be explained in part by the lack of
addition of dispensable amino acids in the Cr-35 diet.
|
Differences in Hal-mRNA concentration followed a pattern similar to
that of Hal activity (Fig. 3
). Hal-mRNA increased as the concentration of dietary protein
increased. Concentrations of Hal-mRNA for the groups fed 20 and
35% casein were 1.1- and 1.9-fold higher than the group fed the 6%
casein diet. Rats fed imbalanced diets had lower food consumption than
did rats fed the 6% casein diet (Table 2)
. This condition probably
increased protein catabolism, which in turn increased Hal-mRNA
concentration and Hal activity. In rats fed the Cr-20 diet, there was a
46% lower abundance of Hal-mRNA compared to the I-20 group,
presumably because the increase in food intake reduced protein
catabolism. However, in rats fed a Cr-35 diet, there was not a
significantly lower concentration of Hal-mRNA with respect to the
I-35 group. Rats fed the Cr-35 diet showed a higher Hal-mRNA
concentration and Hal activity than did the Cr-20 group.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Weight gain and food intake are responses that are sensitive to both
quality and quantity of the dietary protein. Rats fed graded levels of
dietary protein increase food intake and weight rapidly until the
protein requirement is met. The weight gain curve plateaus at ~19%
casein (Gustafson et al. 1986
). For this reason, rats
fed a high protein diet (35%) showed similar weight gain and food
intake to rats fed a 20% casein diet.
The effect of imbalanced diets on food intake and growth is well known.
Most of the amino acid imbalance studies have used a 6% casein diet as
the basal diet, supplementing it with amino acids to reach an
equivalent of a 13% casein diet, which provides the theoretical
requirement of most amino acids. In the current study we used a more
pronounced imbalance, adding to the 6% casein diet a mixture of
indispensable amino acids similar to that found in a 20 or 35% casein
diet. We observed that the greater the imbalance, the lower final body
weight, weight gain, liver weight and food intake (Table 2)
. Leung and
Rogers (1969
) demonstrated that the ingestion of
imbalanced diets produces a competition among amino acids for entry
into the brain that may contribute to the signal for food intake
depression.
The depression in growth and food intake in a histidine-imbalanced
diet is associated with substantially elevated concentrations of amino
acids other than histidine (Harper et al. 1970
), and a
decrease in the concentration of histidine in serum (Tackman et al. 1990
) (Fig. 1)
and the brain (Harper 1984
).
In the blood the high concentration of certain amino acids that share
the same amino acid carrier at the blood-brain barrier compete with
each other reducing the uptake of the amino acids, present in low
concentrations in the plasma, into the brain (Tovar et al. 1988
). The altered brain amino acid pattern might initiate,
either directly or indirectly, a signal for food intake depression. A
decline in the concentration of an indispensable amino acid is sensed
in the anterior prepyriform cortex of the brain. Subsequent to
recognition of the deficiency, a conditioned anorectic response to
ingestion of an amino acid-imbalanced diet develops mediated in
part by serotonin at the level of the vagus (Gietzen 1993
).
The correction of the 20 or 35% histidine-imbalanced diets by
adding histidine partially restored growth and food intake without
reaching the weight gain and food intake of the rats with free access
to a 20 or 35% casein diets. This probably happened because of the
lack of supplementary dispensable amino acids. Under this condition,
some proportion of indispensable amino acids is shuttled to the
synthesis of dispensable amino acids. Also, because the rate of
synthesis of dispensable amino acids from indispensable is relatively
slow, this will reduce the efficiency of using all amino acids for
protein synthesis, altering the protein accretion rate of the rats
(Harper 1983
).
The concentration of histidine in serum (Fig. 1)
and brain
(Gustafson et al. 1986
, Peters and Harper 1985
) was inversely proportional to the content of casein in
the diet. When rats are fed a low-protein diet, serum histidine
concentration is high, presumably because the degradation of proteins
that contain a high concentration of histidine, especially hemoglobin
(Mercer et al. 1989
), and to the low activity of
histidase (Fig. 2)
, reducing its catabolism. However, when rats were
fed with 35% casein diet, the concentration of histidine in serum
declined (Fig. 1)
, and it was associated with an increase in activity
and mRNA concentration of Hal (Fig. 3)
.
When rats were fed a histidine-imbalanced diet, the activity of
histidase increased. This increment in Hal activity was accompanied by
an increase in Hal-mRNA abundance. Previous studies showed that the
activity of some amino acid degrading enzymes, such as serine
dehydratase (Anderson et al. 1969
) and threonine
dehydrogenase (Davis and Austic 1994
), increases in
animals fed amino acid-imbalanced diets. These results indicate
that under amino acid imbalance condition there is an excess of amino
acids that is oxidized. The excess of amino acids is probably provided
by two pathways: 1) limiting amino acid reduces the
efficiency of protein synthesis because all amino acids are required
together at the same time; 2) amino acid imbalance reduces
food intake, which possibly accelerates the protein turnover,
increasing protein catabolism. In support to these mechanisms, it was
demonstrated that the oxidation of an indispensable amino acid
increases when another amino acid limits protein synthesis
(Benevenga et al. 1993
, Kim et al. 1983
,
Stipanuk and Benevenga 1977
). Also, the consumption of
an amino acid-imbalanced diet diminishes polysome aggregation and
incorporation of radiolabeled amino acids into protein especially when
the pool of the imbalance amino acid is depleted by the consumption of
a diet deficient in this amino acid (Ip and Harper 1974
).
The histidine amino acid-imbalanced condition possibly induces Hal
by providing the excess of amino acids not used for protein synthesis
and by stimulating the secretion of glucagon and glucocorticoids
because of the anorexic state. Previous studies (Alemán et al. 1998
, Torres et al. 1998
, Tovar et al. 1998
) support this evidence, although some other still
unknown mechanisms may influence the induction of the Hal gene.
The increase in the capacity of the degradation of amino acids by the
amino acid degrading enzymes, such as Hal, is perhaps related to the
increase in the excretion of urinary nitrogen of rats fed a diet devoid
of a single amino acid (Kimura and Tahara 1971
). The
results of the present study showed that to reach an adequate nitrogen
balance, it is important to feed an amino acid-balanced diet, but
on the other hand, indicated the need to understand the molecular
mechanisms of the regulation of the expression of the amino acid
degrading enzymes to conserve the body's nitrogen.
|
FOOTNOTES |
|---|
3 Abbreviations used: Cr-20, histidine-corrected diet 20; Cr-35, histidine-corrected
diet-35; Hal, histidase; I-20, histidine imbalanced diet-20; I-35, histidine imbalanced diet-35; IAA, indispensable amino acids; PCR,
polymerase chain reaction.
Manuscript received December 18, 1998. Initial review completed March 16, 1999. Revision accepted July 13, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
1. Alemán G., Torres N., Bourges H., Tovar A. Regulation of histidase gene expression by glucagon, hydrocortisone and protein-free/high carbohydrate diet in the rat. Life Sci 1998;63:1663-1673[Medline]
2. Anderson H. L., Benevenga N. J., Harper A. E. Effect of prior high protein intake on food intake, serine dehydratase activity and plasma amino acids of rats fed amino acid-imbalanced diets. J. Nutr. 1969;97:463-474
3. Benevenga N. J., Gahl M. J., Blemings K. P. Role of protein synthesis in amino acid catabolism. J. Nutr. 1993;123:332-336
4. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-159[Medline]
5. Davis A. J., Austic R. E. Dietary threonine imbalance alters threonine dehydrogenase activity in isolated hepatic mitochondria of chicks and rats. J. Nutr. 1994;124:1667-1677
6. Gietzen D. W. Neural mechanisms in the responses to amino acid deficiency. J. Nutr. 1993;123:610-625
7. Gustafson J. M., Doods S. T., Burgus R. C., Mercer L. P. Prediction of brain and serum free amino acid profiles in rats fed graded levels of protein. J. Nutr. 1986;116:1667-1681
8. Harper A. E. Dispensable and indispensable amino acid interrelationship. Blackburn G. L. Grant T. P. Young V. R. eds. Amino Acids: Metabolism and Medical Applications 1983:105-121 Indin Wright PSG Boston, MA.
9. Harper A. E. Biological factors influencing the utilization of amino acids. Velázquez A. Bourges H. eds. Genetic Factors in Nutrition 1984:243-267 Academic Press Orlando, FL.
10.
Harper A. E., Benevenga N. J., Wohlhueter R. M. Effect of ingestion of disproportionate amounts of amino acids. Physiol. Rev. 1970;50:428-558
11. Ip C.C.Y., Harper A. E. Liver polysome profiles and protein synthesis in rats fed a threonine-imbalance diet. J. Nutr. 1974;104:252-263
12. Kim C., Tanaka H., Ogura M. Metabolism of lysine, threonine, and leucine in growing rats on gluten or zein diets at various dietary protein levels. Biosci. Biotech. Biochem. 1996;60:1580-1585[Medline]
13. Kim K. -I., McMillan I., Bayley H. S. Determination of amino acid requirements of young pigs using an indicator amino acid. British J. Nutr. 1983;50:369-382[Medline]
14. Kimura T., Tahara M. Effect of force-feeding diets lacking leucine, valine, isoleucine, threonine or methionine on amino acid catabolism. J. Nutr. 1971;101:1647-1656
15. Leung P. M., Rogers Q. R. Food intake: regulation by plasma amino acid pattern. Life Sci 1969;8:1-9[Medline]
16. Mercer L. P., Dodds S. J., Schweisthal M. R., Dunn J. D. Brain histidine and food intake in rats fed diets deficient in single amino acids. J. Nutr. 1989;119:66-74
17. Peters J. C., Harper A. E. Adaptation of rats to diet containing different levels of protein: effects on food intake, plasma and brain amino acid concentrations and brain neurotransmitter metabolism. J. Nutr. 1985;115:382-398
18.
Spolter P. D., Baldridge R. C. The Metabolism of histidine. V. On the assay of enzymes in rat liver. J. Biol. Chem. 1963;238:2071-2074
19. Stipanuk M. H., Benevenga N. J. Effect of cystine on the metabolism of methionine in rats. J. Nutr. 1977;107:1455-1467
20. Tackman J. M., Tews J. K., Harper A. E. Dietary disproportions of amino acids in the rat: effects of food intake, plasma and brain amino acids and brain serotonin. J. Nutr. 1990;120:521-533
21.
Taylor R. G., Lambert M. A., Sexsmith E., Sadler S. J., Ray P. N., Mahuran D. J., McInnes R. R. Cloning and expression of rat histidase. J. Biol. Chem. 1990;265:18192-18118
22.
Torres N., Martínez L., Alemán G., Bourges H., Tovar A. R. Histidase expression is regulated by dietary protein at the pretranslational level in rat liver. J. Nutr. 1998;128:818-824
23. Tovar A., Tews J. K., Torres N., Harper A. E. Some characteristics of threonine transport across the blood- brain barrier of the rat. J. Neurochem. 1988;51:1285-1293[Medline]
24.
Tovar A. R., Ascencio C., Torres N., Gómez E., Bourges H. Neutral and basic amino acid concentrations in plasma during the day in subjects fed with two model rural and two model urban Mexican diets. Am. J. Clin. Nutr. 1996;63:335-341
25.
Tovar A. R., Santos A., Halhali A., Bourges H., Torres N. Hepatic histidase gene expression responds to protein rehabilitation in undernourished growing rats. J. Nutr. 1998;128:1631-1635
This article has been cited by other articles:
|
|
 |
|
  F. M. Lartey and R. E. Austic Phenylalanine Requirement, Imbalance, and Dietary Excess in One-Week-Old Chicks: Growth and Phenylalanine Hydroxylase Activity Poult. Sci., February 1, 2008; 87(2): 291 - 297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Aleman, V. Ortiz, E. Langley, A. R. Tovar, and N. Torres Regulation by glucagon of the rat histidase gene promoter in cultured rat hepatocytes and human hepatoblastoma cells Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E172 - E179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. C. McCuistion, E. C. Titgemeyer, M. S. Awawdeh, and D. P. Gnad Histidine utilization by growing steers is not negatively affected by increased supply of either ammonia or amino acids J Anim Sci, March 1, 2004; 82(3): 759 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Kriengsinyos, M. Rafii, L. J. Wykes, R. O. Ball, and P. B. Pencharz Long-Term Effects of Histidine Depletion on Whole-Body Protein Metabolism in Healthy Adults J. Nutr., November 1, 2002; 132(11): 3340 - 3348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Tovar, C. Ascencio, and N. Torres Soy protein, casein, and zein regulate histidase gene expression by modulating serum glucagon Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E1016 - E1022. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
