![]() |
|
|
Department of Medical Oncology, * Department of Pathology, City of Hope National Medical Center, Duarte, CA 91010
2To whom correspondence should be addressed.
| ABSTRACT |
|---|
|
|
|---|
KEY WORDS: glutathione peroxidase GPX-GI all-trans retinoic acid human breast cancer cells intestine epithelial cells
| INTRODUCTION |
|---|
|
|
|---|
Because GPX-GI has substrate specificities similar to those of
GPX-1, one may suspect that they have similar cellular functions.
Elevation of GPX-1 activity has been shown to be antiapoptotic.
Lymphocytes expressing a high level of either GPX-1 activity or Bcl-2
protein are resistant to apoptosis induced by interleukin-3 withdrawal
(Hockenbery et al. 1993
). Apoptosis induced by tumor
necrosis factor-
and transforming growth factor-ß1 has been shown
to involve an oxidant, which is most likely
H2O2 (Cossarizza et al. 1995
, Islam et al. 1997
, Kretz-Remy et al. 1996
, Lafon et al. 1996
, Mirault et al. 1991
). Elevation of intracellular
H2O2 level has recently
been shown to be a prerequisite for apoptosis induced by anticancer
drugs such as camptothecin, vinblastin, inostamycin and adriamycin
(Simizu et al. 1998a
and 1998b
). Thus, elevation of
GPX-1 activity can modulate intracellular hydroperoxide concentration,
which plays a role in signal transduction. Whether alteration of
GPX-GI activity could also modulate cellular signal transduction
pathway has not been demonstrated.
To learn the cellular function of intracellular glutathione
peroxidases, we studied the regulation of Gpx1 and
Gpx2 gene expression. The possibility that Gpx1
gene expression was negatively regulated by an estrogen receptor was
excluded by our survey of 18 human breast cell lines (Esworthy et al. 1995
, Townsend et al. 1991
). Several
studies have shown that Gpx1 gene expression is
up-regulated by oxidative stress. Gpx1 gene expression
is inducible by hyperoxia in human umbilical cord endothelial cells
(Jornot and Junod 1995
and 1997
) and human ventricular
myocytes (Cowan et al. 1992
and 1993
), by phorbol ester
in umbilical endothelial cells and by lipopolysaccharide in a mouse
macrophage cell line (Capdevila et al. 1995
). Two oxygen
responsive elements have been identified in the 5'-flanking region of
the human Gpx1 gene (Cowan et al. 1993
).
Down-regulation of Gpx1 gene expression by transforming
growth factor-ß1 has been shown in hamster pancreatic ß cells and
rat vascular smooth muscle cells (Islam et al. 1997
,
Nishio and Watanabe 1997
). Thus, modulation of
Gpx1 and Gpx2 gene expression may be used to
regulate the intracellular hydroperoxide level in different types of
cells.
It is not clear whether normal breast epithelial cells also express the
Gpx2 gene. We previously detected Gpx2 mRNA in
one out of seven human breast tissue samples (Chu et al. 1993
). In our survey of human breast cancer cell lines,
Gpx2 mRNA was detected in only 4 out of 18 lines analyzed
(Esworthy et al. 1995
). We reported a decreased level of
Gpx2 mRNA in MDA-MB-175 cells grown rapidly in the presence
of cholera toxin compared with that in the same cells grown slowly in
the absence of cholera toxin. Thus, the expression of the
Gpx2 gene in breast epithelial cells may be highly
regulated. However, little is known about regulation of Gpx2
gene expression.
In an attempt to identify the potential inducer(s), we isolated a human
Gpx2 gene and obtained 2 kb of the 5' untranslated sequence.
The potential regulatory elements identified include the caudal
homeobox protein binding sequence (Frumkin et al. 1994
,
Jin and Drucker 1996
) and retinoic acid response
elements (RARE). In this paper, we report the presence of
Gpx2 mRNA in freshly isolated human breast epithelial cells
and cultured human mammary epithelial cells (HMEC). The expression of
Gpx2 gene is inducible by all-trans retinoic acid
(RA) in MCF-7 cells but not in HT29 cells. MCF-7 cells are sensitive to
RA treatment, whereas HT29 cells are resistant in terms of growth
inhibition (Kane et al. 1996
, Louvet et al. 1994
, Plateroti et al. 1993
, van der Leede et al. 1997
). The RA induction is specific for the
Gpx2, but not the Gpx1 gene expression in the
MCF-7 cells. This study provides the first evidence to show
differential regulation of Gpx1 and Gpx2 genes by
a vitamin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Human breast epithelial cells were isolated from three human patients
after reduction mammaplasty (with Institutional Review Board approval)
as described by Stampfer (1985)
. Briefly, breast tissue
was retrieved within 24 h postsurgery. After mincing with scissors
and removing blood clots, tissue was placed in 50-mL plastic culture
tubes containing 7.5 x 104 U/L
collagenase and 1 x 105 U/L hyaluronidase
(GIBCO BRL Life Technologies, Grand Island, NY) in minimal essential
medium (MEM) containing 10% fetal bovine serum (FBS). Tissue was
digested at 37°C with gentle shaking over 12 nights. After
centrifugation at 600 x g for 5 min, the
supernatant and floating fat were decanted. The pellet was resuspended
in MEM and passed through a 150-µm filter (Tetko,
Montery Park, CA). The organoids retained on the filter were recovered
by gently pipetting. Aliquots were taken for enzyme activity assays,
RNA isolation and histology. The epithelial cells were determined by
keratin-positive immunohistostaining.
Cell cultures.
Primary cultures of human breast epithelial cells were obtained from
M. R. Stampfer at the University of California at Berkeley
(specimen # 184 and 161), and Clonetics (San Diego, CA) (HMEC2194 and
HMEC2595). Each specimen was from a different patient. From specimen #
184 and 161, two isolates from different passages were evaluated.
Established cell lines, including MCF-10A and 10F human breast
epithelial cells, MCF-7 and MDA-MB-231 human breast cancer cells,
HUTU80 human duodenum cancer cells, HT29 and Caco-2 human colon cancer
cells, as well as IEC-6 and IEC-18 rat small intestine cell lines, were
obtained from American Type Culture Collection (Rockville, MD). The
generation of MCF-7 transfectant cells, MCF-7D1 expressing a
Gpx2 cDNA, was described previously (Chu et al. 1993
).
The culture conditions for HMEC followed supplier recommendations. For
HMEC-161 and 184 sublines of the early passages (23 passages), the
culture medium contained Dulbecco's modified Eagle's medium
(DMEM)/F12 supplemented with 0.4% FBS, 5 mg/L each insulin and
transferrin, 0.5 mg/L dexamethasone, 5 µg/L epidermal
growth factor and 60100 µg/L cholera enterotoxin.
For HMEC-161 and 184 sublines of the late passages (713 passages),
the medium contained MCDB170 (Hammond et al. 1984
),
supplemented with 5 mg/L each insulin and transferrin, 0.5 mg/L
dexamethasone, 5 µg/L epidermal growth factor and 10
µmol/L isoproterenol. For the HMEC2194 and 2595
lines obtained from Clonetics, the culture medium contained MEGM
SingleQuots (Clonetics). The growth medium for MCF-10 cells consisted
of DMEM/F12 supplemented with 5% FBS, insulin at 5 mg/L, transferrin
at 5 mg/L, 20 µg/L epidermal growth factor, 60100
µg/L cholera enterotoxin (Irvine Scientific, Irvine,
CA), 0.5 nmol/L hydrocortisone and 100 nmol/L
Na2SeO3. The culture media for all other
established cell lines were DMEM/F12 supplemented with 5% FBS and 100
nmol/L Na2SeO3. Geneticin (G418) at 0.4 g/L was
included to maintain the transfected MCF-7D1 cells. RA (Sigma Chemical,
St. Louis, MO) was dissolved in absolute ethanol. Subconfluent cells
were cultured in the same medium with either vehicle (0.6% ethanol)
only or 1 µmol/L RA.
RNA isolation and Northern analysis.
Total RNA was isolated using either the acid guanidinium
thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi 1987
) or RNeasy kit (Qiagen, Valencia, CA). A 0.7-kb of
human Gpx1 cDNA (encoding GPX-1), a 1-kb human
Gpx2 cDNA (encoding GPX-GI), a 1.6-kb human
Gpx3 cDNA (encoding GPX-P), a 0.9-kb human
Gpx4 cDNA [encoding phospholipid
hydroperoxide-reducing isozyme (PHGPX)] and a 1-kb chicken
ß-actin cDNA were used as probes (Chu et al. 1992
,
Chu and Esworthy 1995
, Esworthy et al. 1994
). The hybridization and washing conditions were as
previously described.
In situ hybridization.
A 688-bp human Gpx2 cDNA fragment (from nucleotide 182
in Fig. 4
to the CTGCAG PstI site at 128 nucleotide 3'
to the translation termination codon) was cloned into pBluescript. A
32P-UTP-labeled riboprobe in the sense direction was
transcribed from the T3 promoter after the template was
linearized with BamHI. The antisense riboprobe
was transcribed from the T7 promoter after the template was linearized
with HindIII. 32P-Labeled riboprobes were
generated from a transcription kit (Stratagene, La Jolla, CA).
Preparation of slides containing human small intestine and
hybridization and washing conditions were according to the described
procedure (Oft et al. 1993
).
|
Sample homogenization and processing for enzyme assays were as
previously described (Chu and Esworthy 1995
). GPX
activity was assayed using H2O2 as the
substrate. PHGPX activity was determined with phosphatidylcholine
hydroperoxide as the substrate. The unit of GPX and PHGPX activity is
defined as nmol NADPH consumed/(min · mg). Glutathione
S-transferase (GST) activity was determined with
1-chloro-2,4-dinitrobenzene (CDNB) as the electrophilic substrate. The
unit of GST is defined as nanomoles CDNB conjugated with GSH
per minute per milligram protein. Protein concentration was determined
with the bicinchonic acid assay (Pierce, Rockford, IL) with bovine
serum albumin as standard. All enzyme assays from any sample were done
in duplicate.
Isolation of human Gpx2 gene.
The human Gpx2 gene was isolated from a P1 phage library
screened by polymerase chain reaction using two intron primers Px2in01
(TGAGGGGTCCCTCCTTGTAATGCACCAA) and Px2in06 (GGCACTGAGGACACAGTGGAGAGAA)
(Genome Systems, St. Louis, MO). The two exons and single intron
sequences were published previously (Accession No. X91863) (Chu et al. 1996
). The DNA sequencing was performed with a
fluorescent sequencer (Model 370A, PE Biosystems, Foster City, CA) by
the City of Hope DNA Sequencing Core Facility. Sequencing data were
collected with Genescan 672 software, and analyzed with IGSuite
software (Intellegenics, Mountain View, CA).
Statistical analysis.
The data obtained from multiple samples are presented as means ± SD. ANOVA was done with a two-tailed Student's t test using Excel (Microsoft Office 97, Professional Edition, Cambridge, MA) software. A P-value of < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
Although the Gpx2 gene was highly expressed in the
epithelium along the GI tract, it was not clear whether the cell lines
derived from the small intestine and colon epithelium would continue to
express this gene. We analyzed the following five cell lines of
intestinal origin including three human cell lines: duodenum
adenocarcinoma HUTU80 cells, colon adenocarcinoma HT29 and Caco-2
cells, as well as two rat intestinal epithelial cell lines, IEC-6 and
IEC-18 cells. Among the three human cell lines studied, HT29 and Caco-2
expressed a high level of Gpx2 mRNA (Fig. 1
). The third human cell line, HUTU80 cells, and the rat IEC-6 and IEC-18
cells did not have detectable Gpx2 mRNA (Fig. 1
and data not
shown). HT29 and Caco-2 cells could be used as a positive control for
Gpx gene expression because they expressed three and four
genes of the selenium-dependent Gpx family,
respectively (Chu 1994
). The other two members
of Se-dependent Gpx genes were: the Gpx3 gene, which
encoded the plasma isozyme, GPX-P, and the Gpx4
gene, which encoded PHGPX.
|
|
Because Gpx2 mRNA was detected in several human breast
cancer cell lines and in one breast tissue sample out of seven, we
questioned whether the Gpx2 gene was expressed in normal
breast epithelium (Chu et al. 1990
and 1993
). To
determine this, we isolated breast epithelial cells from three normal
human breast tissues obtained from reduction mammaplasty. These
isolates were analyzed immediately without culturing in the tissue
culture medium. Two isolates of breast cells consisting of 90%
epithelial cells had detectable Gpx2 mRNA as analyzed by
Northern blot (Lane 6 of Fig. 3
shows one of the isolates). The third isolate, which contained 15%
epithelial cells, had a very weak signal (data not shown).
|
Enzyme activities.
We then determined the levels of GPX, PHGPX and GST activities in the
breast and intestinal cells, which are shown in Table 1
. With the exception of HUTU80 cells, all breast and intestinal
epithelial cells had high levels of GPX activity. The GPX activity
could be contributed by either GPX-1 or GPX-GI. HUTU80 did not
express either Gpx1 or Gpx2 mRNA and had almost
no GPX activity, suggesting that most of cellular glutathione
peroxidase activity was contributed by either Gpx1 or
Gpx2 gene expression. High levels of PHGPX and GST
activities were detected in breast epithelial cells, suggesting that
these cells were well protected against most forms of peroxides.
|
To identify the regulatory factor for Gpx2 gene expression,
we isolated a human Gpx2 gene from a P1 phage library. As
shown in Figure 4
, the predicted transcription start site was at nucleotide position
denoted as 1 as analyzed on a Baylor College of Medicine web site
(http://dot.imgen.bcm.tmc.edu) (Smith et al. 1996
). A
TATA box was predicted at the -29 nucleotide position. With the use of
the TFSEARCH program written by Yutaka Akiyama
(http://www.rwcp.or.jp/papia/) (Heinemeyer et al. 1998
),
we identified multiple binding sites of CdxA protein as shown in the
shaded boxes in Figure 4
. CdxA is a caudal-type chicken
homeobox gene, which regulates intestinal morphogenesis during early
vertebrate embryonic development (Frumkin et al. 1994
).
CdxA protein has a high homology with the Drosophila caudal
(cad) gene, which is also expressed in the developing gut in the
fly and is restricted to endodermal derivatives (Mlodzik and Gehring 1987
). The mammalian CdxA homologous proteins
identified include Cdx-1, Cdx-2, Cdx-3 and Cdx-4. These genes are all
expressed in an intestine-specific manner (Bonner et al. 1995
, Drummond et al. 1996
, Garner and Wright 1993
, James et al. 1994
, Jin and Drucker 1996
). The presence of multiple CdxA-binding sites
in the Gpx2 gene could explain its high level of expression
in intestinal epithelium.
We also identified three regions containing putative RARE; two of
these are shown in Figure 4
as underlined sequences. The RARE
half-site contained a A(G)GG(T)TC(G)A consensus sequence in which
the nucleotides in parentheses were not conserved (Lo and Ali-Osman 1997
). One was at the 5' untranslated region
between nucleotides -1020 and -1031; another one was at the 5' end of
the single intron at nucleotides 460473; and the third was in exon 2
with a TGACCC(n)11TGACCG sequence (data not
shown). We are in the process of making reporter constructs to test the
function of these sequences.
Induction of Gpx2 mRNA by retinoic acid.
Because little is known about regulation of Gpx2 gene
expression, we tested several compounds including RA for their effect
on Gpx2 gene expression. The effect of RA on Gpx2
gene expression was analyzed in RA-responsive MCF-7 and MCF-7D1
cells, and RA-resistant MDA-MB-231 and HT29 cells (Kane et al. 1996
, Louvet et al. 1994
, van der Leede et al. 1997
). We ran duplicate samples from each
treatment and quantified mRNA levels on the basis of the phosphor
images. One set of results is shown in Figure 5
. The effect of RA on Gpx1 and Gpx2 mRNA is shown
in Table 2
. RA (1 µmol/L) induced endogenous Gpx2 mRNA
level 12-fold in MCF-7 cells, which had a low basal level
Gpx2 mRNA expression. The less than onefold induction of
Gpx2 mRNA level in MCF-7D1 cells (which expressed a
transfected Gpx2 cDNA as well as the endogenous
Gpx2 gene), MDA-MB-231 and HT29 cells was not significant.
Also, RA did not appear to have any effect on Gpx1 mRNA
levels. No induction of Gpx2 gene expression was observed in
three intestinal cell lines, which did not have basal Gpx2
gene expression, i.e., HUTU80, IEC-6 and IEC-18 (Fig. 1
and unpublished
data).
|
|
Kinetics of induction of Gpx2 mRNA and GPX activity in MCF-7 cells.
We analyzed the kinetics of Gpx2 induction by RA in MCF-7
cells by studying both mRNA level and GPX activity. The maximal
induction of Gpx2 mRNA was reached 1 d after treatment
with 1 µmol/L RA (Fig. 6
). However, the increase of GPX activity appeared to lag behind the
Gpx2 mRNA increase, i.e., a onefold increase of GPX activity
was reached 4 d after treatment, and a threefold increase of
activity was reached 8 d after treatment. No increase of mRNA
level or activity could be detected in HT29 cells (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
We used an RNA probe transcribed from a partial Gpx2 cDNA
lacking most of its 3' untranslated sequence. This was necessary
because the full-length probes transcribed in either direction
produced equally strong signals in both HT29 cells and human intestinal
epithelium performed in situ (data not shown). By removing most of the
3' untranslated sequence from nucleotide 128 beyond the translation
termination codon, the sense probe no longer produced as strong a
signal as the antisense probe. Additionally, the smaller
Gpx2 template generated a larger number of transcripts than
did the full-length template. This was probably due to the removal
of the stem loop structure easily formed from the putative
selenocysteine-insertion sequence element present at nucleotide
221298 at 3' of the translation termination codon (Berry et al. 1991
and 1993
). The stem loop structure might have hindered
the RNA polymerase reaction.
In addition to intestinal epithelium expression, the Gpx2 gene was also detected in a small fraction of breast tissue and breast cancer cell lines. To determine whether the Gpx2 gene was expressed in normal breast epithelial cells, we studied Gpx2 mRNA in freshly isolated human breast epithelial cells and four human mammary epithelial cell lines by Northern analysis. Because Gpx2 mRNA was detected in both freshly isolated breast epithelial cells without culturing, this suggested that Gpx2 was most likely expressed in normal breast epithelial cells. The Gpx2 mRNA was detectable in most, but not all of the RNA isolates from the cultured mammary epithelial cells. Perhaps the variation of Gpx2 gene expression was due to the fact that the expression of this gene was regulated. We plan to use in situ hybridization or immunohistochemical staining to study the regulation of Gpx2 gene expression in normal breast epithelial cells in the future.
We previously reported a high level of GPX activity (304 ± 91
mU/mg protein) in human breast tissue, similar to the
levels found in human liver (352 ± 89 mU/mg protein)
and kidney (191 ± 74 mU/mg protein) (Esworthy et al. 1995
). Because the breast samples contained much adipose
tissue, we did not know the GPX activity in breast epithelial cells
specifically. In this study on isolated human breast epithelial cells
and mammary epithelial cell lines, we found higher GPX activity in most
of the epithelial samples than in total breast tissue. Additionally,
human breast epithelial cells also expressed high levels of PHGPX and
GST activities, suggesting that breast epithelial cells were as well
protected against peroxides as human liver. Furthermore, we found that
most of cellular GPX activity in breast epithelial cells appeared to be
contributed by either Gpx1 or Gpx2. Only those
cells that express low levels of both genes, such as MCF-7 and HUTU80
cells, had a low GPX activity. The apparent redundancy of these two
isozymes may be understood by the differential regulation of these two
genes.
To identify the potential regulatory agent for Gpx2 gene
expression, we isolated and analyzed the human Gpx2 gene.
Analysis of the Gpx2 gene revealed the most prominent
regulatory element to be putative binding sites for CdxA, a chicken
caudal-type homeobox protein. The fact that mammalian CdxA analogs,
such as Cdx-1, Cdx-2, Cdx-3 and Cdx-4, also were expressed in the
intestine-specific manner might explain the high level of
Gpx2 gene expression in the intestine (Bonner et al. 1995
, Drummond et al. 1996
, Garner and Wright 1993
, James et al. 1994
, Jin and Drucker 1996
). It is likely that the CdxA binding sites can
promote Gpx2 gene expression constitutively. This may
explain the high level of Gpx2 gene expression in HT29 and
Caco-2 cells.
Additionally, we identified three putative RARE in the Gpx2
gene, one at the 5' untranslated region, one at the junction of exon 1
and intron, and one at the exon 2. Each site has two RARE
half-sites. RA has little effect on the level of Gpx2
cDNA expression driven by the Rous sarcoma virus promoter, suggesting
that the RARE in Gpx2 exon 2 might not be functional. A
functional RARE present in the intron was reported in a human Pi class
glutathione S-transferase, GSTP1C (Lo and Ali-Osman 1997
), as well as in a human CD38 gene
(Kishimoto et al. 1998
). Thus, either of these two RARE
in the 5' promoter or intron could be functional. We are in the process
of making reporter constructs to test the function of these RARE
sequences.
RA action is likely mediated by a retinoic acid receptor (RAR); the
responsiveness of these cells to RA as measured by growth inhibition
may depend on the levels of three isotypes of RAR, i.e.,
, ß and
(Fitzgerald et al. 1997
). The RA-sensitive MCF-7
cells expressed a higher level of RAR
than the RA-resistant
MBA-MD-231 cells (Fitzgerald et al. 1997
, van der Leede et al. 1997
). Although Gpx2 gene expression
was clearly induced by RA in MCF-7 cells, it was not induced
significantly in MCF-7D1 cells, which were sensitive to RA-induced
growth inhibition (data not shown). The lack of induction was
apparently due to the high level of constitutive Gpx2 cDNA
expression. More samples must be analyzed to determine whether the less
than onefold increase of Gpx2 mRNA level is significant.
Also, increased Gpx2 gene expression did not result in
resistance to RA-induced growth inhibition.
Although HT29 cells were responsive to 9-cis retinoic acid
(9-cis RA)-induced gene activation, these cells were
resistant to RA-induced gene activation as well as morphologic
changes (Kane et al. 1996
, Louvet et al. 1994
, Plateroti et al. 1993
). HT29 cells had low
levels of RAR proteins, and this could explain their resistance to RA.
The effect of 9-cis RA can be mediated by RXR, RAR analogs
(Chambon 1996
). Thus, activation of RXR
, RXR
and
vitamin D receptor genes appeared to be regulated by RXR, whereas
activation of Gpx2 might be mediated by RAR only. We did not
detect Gpx2 mRNA in HUTU80, IEC-6 and IEC-18 cells with and
without RA treatment. One of these cell lines, IEC-6 cells, was shown
to have functional RAR proteins, and RA induces RAR
, RARß and a
bone-type alkaline phosphatase (Nikawa et al. 1998
).
Thus, it was not clear why the Gpx2 gene could not be
induced in these cells.
The increased Gpx2 mRNA level resulted in an increase of GPX
activity, which was slower than the kinetics of mRNA induction. It took
68 d to reach maximal GPX-GI activity, whereas maximal
Gpx2 mRNA was reached in 1 d. This slow induction of
GPX-GI might be due to the slow degradation rate of this protein
(Schimke and Doyle 1970
). A slow induction of GPX-1
activity by selenium supplementation was observed in liver- and
MCF-7-derived cell lines (Chu et al. 1990
, Knight and Sunde 1988
). The GPX-1 appeared to have a half-life of
2.85.2 d. The similar kinetics of activity increase suggested that
GPX-GI might have a rate of degradation similar to that of GPX-1.
In spite of many similarities between GPX-1 and GPX-GI, GPX-GI was
different from GPX-1 in several aspects other than tissue distribution.
First, GPX-GI had threefold lower specific activity than GPX-1 with
H2O2 as the substrate,
suggesting that it was less efficient in reducing
H2O2 and possibly alkyl
hydroperoxides (unpublished observations). Second, GPX-GI was much
more labile than GPX-1. GPX-GI was readily inactivated in the
absence of reducing reagents (Chu and Esworthy 1995
,
Esworthy et al. 1998
). This suggested that GPX-GI
tended to be inactivated when oxidized and was more easily modulated.
Third, unlike GPX-1, which had a dual mitochondrial and cytosolic
localization, GPX-GI appeared to be a solely cytosolic enzyme on
the basis of our analysis of its peptide sequence. In this study, we
found that the Gpx2 gene, but not the Gpx1 gene,
was inducible by retinoic acid. This provided the first evidence
showing a distinct pattern of gene regulation in these two isozymes.
Because the Gpx2 gene was expressed in an
epithelium-specific manner and was regulated by a differentiation
agent, this gene might have the important function of protecting
epithelial cells from oxidative stress. In future studies, we plan to
investigate the physiologic role of GPX-GI in epithelial cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
3 Abbreviations used: CDNB,
1-chloro-2,4-dinitrobenzene; DMEM, Dulbecco's modified Eagle's
medium; FBS, fetal bovine serum; GI, gastrointestinal; GPX,
Se-dependent glutathione peroxidase; GPX-1, the classic cellular
GPX; Gpx2, the gene name for GPX-GI; GPX-GI, the
gastrointestinal form of GPX; GST, glutathione
S-transferase; MEM, minimum essential medium; PHGPX,
phospholipid hydroperoxide-reducing GPX; RA,
all-trans retinoic acid; 9-cis RA,
9-cis retinoic acid; RAR, retinoic acid receptor; RARE,
retinoic acid responsive element; RXR, retinoic X receptor. ![]()
Manuscript received May 10, 1999. Initial review completed June 10, 1999. Revision accepted July 5, 1999.
| REFERENCES |
|---|
|
|
|---|
1. Berry M. J., Banu L., Chen Y. Y., Mandel S. J., Kieffer J. D., Harney J. W., Larsen P. R. Recognition of UGA as a selenocysteine codon in type I deiodinase requires sequences in the 3' untranslated region. Nature (Lond.) 1991;353:273-276[Medline]
2. Berry M. J., Banu L., Harney J. W., Larsen P. R. Functional characterization of the eukaryotic SECIS elements which direct selenocysteine insertion at UGA codons. EMBO J 1993;12:3315-3322[Medline]
3. Bonner C. A., Loftus S. K., Wasmuth J. J. Isolation, characterization, and precise physical localization of human CDX1, a caudal-type homeobox gene. Genomics 1995;28:206-211[Medline]
4. Capdevila J. H., Morrow J. D., Belosludtsev Y. Y., Beauchamp D. R., DuBois R. N., Falck J. R. The catalytic outcomes of the constitutive and the mitogen inducible isoforms of prostaglandin H2 synthase are markedly affected by glutathione and glutathione peroxidase(s). Biochemistry 1995;34:3325-3337[Medline]
5. Chambon P. A decade of molecular biology of retinoic acid receptors. FASEB J 1996;10:940-954[Abstract]
6. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-159[Medline]
7. Chu F.-F. The human glutathione peroxidase genes GPX2, GPX3, and GPX4 map to chromosomes 14, 5, and 19, respectively. Cytogenet. Cell Genet. 1994;66:96-98[Medline]
8.
Chu F.-F., Doroshow J. H., Esworthy R. S. Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI. J. Biol. Chem. 1993;268:2571-2576
9. Chu F.-F., Esworthy R. S. The expression of an intestinal form of glutathione peroxidase (GSHPx-GI) in rat intestinal epithelium. Arch. Biochem. Biophys. 1995;323:288-294[Medline]
10.
Chu F.-F., Esworthy R. S., Akman S., Doroshow J. H. Modulation of glutathione peroxidase expression by selenium: effect on human MCF-7 breast cancer cell transfectants expressing a cellular glutathione peroxidase cDNA and doxorubicin-resistant MCF-7 cells. Nucleic Acids Res 1990;18:1531-1539
11.
Chu F.-F., Esworthy R. S., Doroshow J. H., Doan K., Liu X. F. Expression of plasma glutathione peroxidase in human liver in addition to kidney, heart, lung, and breast in humans and rodents. Blood 1992;79:3233-3238
12. Chu F.-F., Rohan de Silva H. A., Esworthy R. S., Boteva K. K., Walters C. E., Roses A., Rao P. N., Pettenati M. J. Polymorphism and chromosomal localization of the GI-form of human glutathione peroxidase (GPX2) on 14q24.1 by in situ hybridization. Genomics 1996;32:272-276[Medline]
13. Cossarizza A., Franceschi C., Monti D., Salvioli S., Bellesia E., Rivabene R., Biondo L., Rainaldi G., Tinari A., Malorni W. Protective effect of N-acetylcysteine in tumor necrosis factor-alpha-induced apoptosis in U937 cells: the role of mitochondria [published erratum appears in Exp. Cell Res. (1996) 222: 251253]. Exp. Cell Res. 1995;220:232-240[Medline]
14. Cowan D. B., Weisel R. D., Williams W. G., Mickle D. A. The regulation of glutathione peroxidase gene expression by oxygen tension in cultured human cardiomyocytes. J. Mol. Cell. Cardiol. 1992;24:423-433[Medline]
15.
Cowan D. B., Weisel R. D., Williams W. G., Mickle D. A. Identification of oxygen responsive elements in the 5'-flanking region of the human glutathione peroxidase gene. J. Biol. Chem. 1993;268:26904-26910
16. Drummond F., Sowden J., Morrison K., Edwards Y. H. The caudal-type homeobox protein Cdx-2 binds to the colon promoter of the carbonic anhydrase 1 gene. Eur. J. Biochem. 1996;236:670-681[Medline]
17.
Esworthy R. S., Baker M. A., Chu F.-F. Expression of selenium-dependent glutathione peroxidase in human breast tumor cell lines. Cancer Res 1995;55:957-962
18. Esworthy R. S., Doan K., Doroshow J. H., Chu F.-F. Cloning and sequencing of the cDNA encoding a human testis phospholipid hydroperoxide glutathione peroxidase. Gene 1994;144:317-318[Medline]
19. Esworthy R. S., Swiderek K. M., Ho Y. S., Chu F.-F. Selenium-dependent glutathione peroxidase-GI is a major glutathione peroxidase activity in the mucosal epithelium of rodent intestine. Biochim. Biophys. Acta 1998;1381:213-226[Medline]
20.
Fitzgerald P., Teng M., Chandraratna R. A., Heyman R. A., Allegretto E. A. Retinoic acid receptor alpha expression correlates with retinoid-induced growth inhibition of human breast cancer cells regardless of estrogen receptor status. Cancer Res 1997;57:2642-2650
21. Frumkin A., Pillemer G., Haffner R., Tarcic N., Gruenbaum Y., Fainsod A. A role for CdxA in gut closure and intestinal epithelia differentiation. Development 1994;120:253-263[Abstract]
22. Garner L. W., Wright C. V. Murine Cdx-4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern. Mech. Dev. 1993;43:71-81[Medline]
23.
Hammond S. L., Ham R. G., Stampfer M. R. Serum-free growth of human mammary epithelial cells: rapid clonal growth in defined medium and extended serial passage with pituitary extract. Proc. Natl. Acad. Sci. U.S.A. 1984;81:5435-5439
24.
Heinemeyer T., Wingender E., Reuter I., Hermjakob H., Kel A. E., Kel O. V., Ignatieva E. V., Ananko E. A., Podkolodnaya O. A., Kolpakov F. A., Podkolodny N. L., Kolchanov N. A. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 1998;26:362-367
25. Hockenbery D. M., Oltvai Z. N., Yin X. M., Milliman C. L., Korsmeyer S. J. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 1993;75:241-251[Medline]
26. Islam K. N., Kayanoki Y., Kaneto H., Suzuki K., Asahi M., Fujii J., Taniguchi N. TGF-beta 1 triggers oxidative modifications and enhances apoptosis in HIT cells through accumulation of reactive oxygen species by suppression of catalase and glutathione peroxidase. Free Radic. Biol. Med. 1997;22:1007-1017[Medline]
27. James R., Erler T., Kazenwadel J. Structure of the murine homeobox gene cdx-2. Expression in embryonic and adult intestinal epithelium. J. Biol. Chem. 1994;269:15229-15237
28. Jin T., Drucker D. J. Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3. Mol. Cell. Biol. 1996;16:19-28[Abstract]
29. Jornot L., Junod A. F. Differential regulation of glutathione peroxidase by selenomethionine and hyperoxia in endothelial cells. Biochem. J. 1995;306:581-587
30. Jornot L., Junod A. F. Hyperoxia, unlike phorbol ester, induces glutathione peroxidase through a protein kinase C-independent mechanism. Biochem. J. 1997;326:117-123
31.
Kane K. F., Langman M. J., Williams G. R. Antiproliferative responses to two human colon cancer cell lines to vitamin D3 are differently modified by 9-cis-retinoic acid. Cancer Res 1996;56:623-632
32.
Kishimoto H., Hoshino S., Ohori M., Kontani K., Nishina H., Suzawa M., Kato S., Katada T. Molecular mechanism of human CD38 gene expression by retinoic acid. Identification of retinoic acid response element in the first intron. J. Biol. Chem. 1998;273:15429-15434
33. Knight S.A.B., Sunde R. A. Effect of selenium repletion on glutathione peroxidase protein level in rat liver. J. Nutr. 1988;118:853-858
34.
Kretz-Remy C., Mehlen P., Mirault M. E., Arrigo A. P. Inhibition of I kappa B-alpha phosphorylation and
degradation and subsequent NF-kappa B activation by glutathione
peroxidase overexpression. J. Cell Biol. 1996;133:1083-1093
35. Lafon C., Mathieu C., Guerrin M., Pierre O., Vidal S., Valette A. Transforming growth factor beta 1-induced apoptosis in human ovarian carcinoma cells: protection by the antioxidant N-acetylcysteine and bcl-2. Cell Growth Differ 1996;7:1095-1104[Abstract]
36.
Lo H. W., Ali-Osman F. Genomic cloning of hGSTP1*C, an allelic human Pi class glutathione S-transferase gene variant and functional characterization of its retinoic acid response elements. J. Biol. Chem. 1997;272:32743-32749
37. Louvet C., Empereur S., Fagot D., Forgue-Lafitte E., Chastre E., Zimber A., Mester J., Gespach C. The arotinoid Ro 408757 has antiproliferative effects in drug-resistant human colon and breast cancer cell lines in vitro. Cancer Lett 1994;85:83-86[Medline]
38.
Mirault M. E., Tremblay A., Beaudoin N., Tremblay M. Overexpression of seleno-glutathione peroxidase by gene transfer enhances the resistance of T47D human breast cells to clastogenic oxidants. J. Biol. Chem. 1991;266:20752-20760
39. Mlodzik M., Gehring W. J. Expression of the caudal gene in the germ line of Drosophila: formation of an RNA and protein gradient during early embryogenesis. Cell 1987;48:465-478[Medline]
40.
Nikawa T., Rokutan K., Nanba K., Tokuoka K., Teshima S., Engle M. J., Alpers D. H., Kishi K. Vitamin A up-regulates expression of bone-type alkaline phosphatase in a rat small intestinal crypt cell line and fetal rat small intestine. J Nutr 1998;128:1869-1877
41. Nishio E., Watanabe Y. Transforming growth factor beta is a modulator of platelet-derived growth factor action in vascular smooth muscle cells: a possible role for catalase activity and glutathione peroxidase activity. Biochem. Biophys. Res. Commun. 1997;232:1-4[Medline]
42. Oft M., Bohm S., Wilczynski S. P., Iftner T. Expression of the different viral mRNAs of human papilloma virus 6 in a squamous-cell carcinoma of the bladder and the cervix. Int. J. Cancer 1993;53:924-931[Medline]
43. Plateroti M., Sambuy Y., Nobili F., Bises G., Perozzi G. Expression of epithelial markers and retinoid-binding proteins in retinol- or retinoic acid-treated intestinal cells in vitro. Exp. Cell Res. 1993;208:137-147[Medline]
44. Schimke R. T., Doyle D. Control of enzyme levels in animal tissues. Annu. Rev. Biochem. 1970;39:929-976[Medline]
45.
Simizu S., Takada M., Umezawa K., Imoto M. Requirement of caspase-3(-like) protease-mediated hydrogen peroxide production for apoptosis induced by various anticancer drugs. J. Biol. Chem. 1998;273:26900-26907
46. Simizu S., Umezawa K., Takada M., Arber N., Imoto M. Induction of hydrogen peroxide production and Bax expression by caspase-3(-like) proteases in tyrosine kinase inhibitor-induced apoptosis in human small cell lung carcinoma cells. Exp. Cell Res. 1998;238:197-203[Medline]
47.
Smith R. F., Wiese B. A., Wojzynski M. K., Davison D. B., Worley K. C. BCM Search Launcheran integrated interface to molecular biology data base search and analysis services available on the World Wide Web. Genome Res 1996;6:454-462
48. Stampfer M. R. Isolation and growth of human mammary epithelial cells. J. Tissue Cult. Methods 1985;9:107-115
49. Townsend A. J., Morrow C. S., Sinha B. K., Cowan K. H. Selenium-dependent glutathione peroxidase expression is inversely related to estrogen receptor content of human breast cancer cells. Cancer Commun 1991;3:265-270[Medline]
50.
van der Leede B. M., van den Brink C. E., Pijnappel W. W., Sonneveld E., van der Saag P. T., van der Burg B. Autoinduction of retinoic acid metabolism to polar derivatives with decreased biological activity in retinoic acid-sensitive, but not in retinoic acid-resistant human breast cancer cells. J. Biol. Chem. 1997;272:17921-17928
This article has been cited by other articles:
![]() |
A. Naiki-Ito, M. Asamoto, N. Hokaiwado, S. Takahashi, H. Yamashita, H. Tsuda, K. Ogawa, and T. Shirai Gpx2 Is an Overexpressed Gene in Rat Breast Cancers Induced by Three Different Chemical Carcinogens Cancer Res., December 1, 2007; 67(23): 11353 - 11358. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singh, T. Rangasamy, R. K. Thimmulappa, H. Lee, W. O. Osburn, R. Brigelius-Flohe, T. W. Kensler, M. Yamamoto, and S. Biswal Glutathione Peroxidase 2, the Major Cigarette Smoke-Inducible Isoform of GPX in Lungs, Is Regulated by Nrf2 Am. J. Respir. Cell Mol. Biol., December 1, 2006; 35(6): 639 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yan and X. Chen GPX2, a Direct Target of p63, Inhibits Oxidative Stress-induced Apoptosis in a p53-dependent Manner J. Biol. Chem., March 24, 2006; 281(12): 7856 - 7862. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Banning, S. Deubel, D. Kluth, Z. Zhou, and R. Brigelius-Flohe The GI-GPx Gene Is a Target for Nrf2 Mol. Cell. Biol., June 15, 2005; 25(12): 4914 - 4923. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Esworthy, L. Yang, P. H. Frankel, and F.-F. Chu Epithelium-Specific Glutathione Peroxidase, Gpx2, Is Involved in the Prevention of Intestinal Inflammation in Selenium-Deficient Mice J. Nutr., April 1, 2005; 135(4): 740 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Morbitzer and T. Herget Expression of Gastrointestinal Glutathione Peroxidase Is Inversely Correlated to the Presence of Hepatitis C Virus Subgenomic RNA in Human Liver Cells J. Biol. Chem., March 11, 2005; 280(10): 8831 - 8841. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-T. Chiu, F.-J. Hsieh, S.-W. Chen, C.-L. Chen, H.-F. Shu, and H. Li Clinicopathologic Correlation of Up-regulated Genes Identified Using cDNA Microarray and Real-time Reverse Transcription-PCR in Human Colorectal Cancer Cancer Epidemiol. Biomarkers Prev., February 1, 2005; 14(2): 437 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Esworthy, R. Aranda, M. G. Martin, J. H. Doroshow, S. W. Binder, and F.-F. Chu Mice with combined disruption of Gpx1 and Gpx2 genes have colitis Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G848 - G855. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rodriguez-Melendez, S. Cano, S. T. Mendez, and A. Velazquez Biotin Regulates the Genetic Expression of Holocarboxylase Synthetase and Mitochondrial Carboxylases in Rats J. Nutr., July 1, 2001; 131(7): 1909 - 1913. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lespine, Y. Fernandez, B. Periquet, A. Galinier, J. Garcia, F. Anglade, J. Ghisolfi, and J.-P. Thouvenot Total Parenteral Nutrition Decreases Liver Oxidative Metabolism and Antioxidant Defenses in Healthy Rats: Comparative Effect of Dietary Olive and Soybean Oil JPEN J Parenter Enteral Nutr, March 1, 2001; 25(2): 52 - 59. [Abstract] [PDF] |
||||
![]() |
R. S. Esworthy, J. R. Mann, M. Sam, and F.-F. Chu Low glutathione peroxidase activity in Gpx1 knockout mice protects jejunum crypts from gamma -irradiation damage Am J Physiol Gastrointest Liver Physiol, August 1, 2000; 279(2): G426 - G436. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||