Journal of Nutrition EB Program 2010 Early Registration

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chu, F.-F.
Right arrow Articles by Wilczynski, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chu, F.-F.
Right arrow Articles by Wilczynski, S.
(Journal of Nutrition. 1999;129:1846-1854.)
© 1999 The American Society for Nutritional Sciences


Article

Retinoic Acid Induces Gpx2 Gene Expression in MCF-7 Human Breast Cancer Cells1

Fong-Fong Chu2, R. Steven Esworthy, Leslie Lee and Sharon Wilczynski*

Department of Medical Oncology, * Department of Pathology, City of Hope National Medical Center, Duarte, CA 91010

2To whom correspondence should be addressed.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We showed previously that the selenium-dependent glutathione peroxidase, GPX-GI, encoded by the Gpx2 gene, is highly expressed in the epithelium of the gastrointestinal (GI) tract and sporadically in breast tissue. To investigate whether Gpx2 gene expression is epithelium specific, we used in situ hybridization to show that Gpx2 mRNA is highly expressed in the crypt epithelium of human intestine. We also used Northern analysis to study human breast cells and found Gpx2 mRNA in human mammary epithelial cell lines as well as freshly isolated normal breast epithelial cells. Because we identified three putative retinoic acid response elements (RARE) in the Gpx2 gene, we examined the regulation of the Gpx2 gene expression by all-trans retinoic acid (RA) in RA-sensitive MCF-7 cells and RA-resistant HT29 cells. Without RA, MCF-7 cells had very low levels of Gpx2 mRNA and a low level of glutathione peroxidase (GPX) activity (17 mU/mg protein), whereas HT29 cells had a high level of Gpx2 mRNA and GPX activity (200 mU/mg protein). RA treatment increased Gpx2 mRNA level 3- to 11-fold and resulted in a fourfold increase of GPX activity (80 mU/mg protein) in MCF-7 cells. Neither Gpx2 mRNA level nor GPX activity was increased in HT29 cells. These results show that the Gpx2 gene is expressed in both breast and intestinal epithelium cells, and suggest that its expression can be highly regulated by retinoic acid, a known differentiation agent.


KEY WORDS: • glutathione peroxidase • GPX-GI • all-trans retinoic acid • human breast cancer cells • intestine epithelial cells


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have previously identified and characterized a gastrointestinal (GI)3 form of glutathione peroxidase, named GPX-GI, encoded by the Gpx2 gene (Chu et al. 1993Citation ). Similar to the classic GPX-1, GPX-GI is an intracellular enzyme that can reduce H2O2 and alkyl hydroperoxides. Unlike the ubiquitous Gpx1 gene expression in vivo, Gpx2 gene expression appears to be tissue specific. GPX-GI is highly produced in the epithelium of rodent GI tract. The Gpx2 mRNA is expressed in human, but not rodent liver (Chu et al. 1993Citation , Esworthy et al. 1998Citation ). The exact distribution of Gpx2 mRNA expressed in the intestinal epithelium and the types of intestinal cell lines expressing Gpx2 mRNA have not been determined.

Because GPX-GI has substrate specificities similar to those of GPX-1, one may suspect that they have similar cellular functions. Elevation of GPX-1 activity has been shown to be antiapoptotic. Lymphocytes expressing a high level of either GPX-1 activity or Bcl-2 protein are resistant to apoptosis induced by interleukin-3 withdrawal (Hockenbery et al. 1993Citation ). Apoptosis induced by tumor necrosis factor-{alpha} and transforming growth factor-ß1 has been shown to involve an oxidant, which is most likely H2O2 (Cossarizza et al. 1995Citation , Islam et al. 1997Citation , Kretz-Remy et al. 1996Citation , Lafon et al. 1996Citation , Mirault et al. 1991Citation ). Elevation of intracellular H2O2 level has recently been shown to be a prerequisite for apoptosis induced by anticancer drugs such as camptothecin, vinblastin, inostamycin and adriamycin (Simizu et al. 1998aCitation and 1998bCitation ). Thus, elevation of GPX-1 activity can modulate intracellular hydroperoxide concentration, which plays a role in signal transduction. Whether alteration of GPX-GI activity could also modulate cellular signal transduction pathway has not been demonstrated.

To learn the cellular function of intracellular glutathione peroxidases, we studied the regulation of Gpx1 and Gpx2 gene expression. The possibility that Gpx1 gene expression was negatively regulated by an estrogen receptor was excluded by our survey of 18 human breast cell lines (Esworthy et al. 1995Citation , Townsend et al. 1991Citation ). Several studies have shown that Gpx1 gene expression is up-regulated by oxidative stress. Gpx1 gene expression is inducible by hyperoxia in human umbilical cord endothelial cells (Jornot and Junod 1995Citation and 1997Citation ) and human ventricular myocytes (Cowan et al. 1992Citation and 1993Citation ), by phorbol ester in umbilical endothelial cells and by lipopolysaccharide in a mouse macrophage cell line (Capdevila et al. 1995Citation ). Two oxygen responsive elements have been identified in the 5'-flanking region of the human Gpx1 gene (Cowan et al. 1993Citation ). Down-regulation of Gpx1 gene expression by transforming growth factor-ß1 has been shown in hamster pancreatic ß cells and rat vascular smooth muscle cells (Islam et al. 1997Citation , Nishio and Watanabe 1997Citation ). Thus, modulation of Gpx1 and Gpx2 gene expression may be used to regulate the intracellular hydroperoxide level in different types of cells.

It is not clear whether normal breast epithelial cells also express the Gpx2 gene. We previously detected Gpx2 mRNA in one out of seven human breast tissue samples (Chu et al. 1993Citation ). In our survey of human breast cancer cell lines, Gpx2 mRNA was detected in only 4 out of 18 lines analyzed (Esworthy et al. 1995Citation ). We reported a decreased level of Gpx2 mRNA in MDA-MB-175 cells grown rapidly in the presence of cholera toxin compared with that in the same cells grown slowly in the absence of cholera toxin. Thus, the expression of the Gpx2 gene in breast epithelial cells may be highly regulated. However, little is known about regulation of Gpx2 gene expression.

In an attempt to identify the potential inducer(s), we isolated a human Gpx2 gene and obtained 2 kb of the 5' untranslated sequence. The potential regulatory elements identified include the caudal homeobox protein binding sequence (Frumkin et al. 1994Citation , Jin and Drucker 1996Citation ) and retinoic acid response elements (RARE). In this paper, we report the presence of Gpx2 mRNA in freshly isolated human breast epithelial cells and cultured human mammary epithelial cells (HMEC). The expression of Gpx2 gene is inducible by all-trans retinoic acid (RA) in MCF-7 cells but not in HT29 cells. MCF-7 cells are sensitive to RA treatment, whereas HT29 cells are resistant in terms of growth inhibition (Kane et al. 1996Citation , Louvet et al. 1994Citation , Plateroti et al. 1993Citation , van der Leede et al. 1997Citation ). The RA induction is specific for the Gpx2, but not the Gpx1 gene expression in the MCF-7 cells. This study provides the first evidence to show differential regulation of Gpx1 and Gpx2 genes by a vitamin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of human breast epithelial cells.

Human breast epithelial cells were isolated from three human patients after reduction mammaplasty (with Institutional Review Board approval) as described by Stampfer (1985)Citation . Briefly, breast tissue was retrieved within 24 h postsurgery. After mincing with scissors and removing blood clots, tissue was placed in 50-mL plastic culture tubes containing 7.5 x 104 U/L collagenase and 1 x 105 U/L hyaluronidase (GIBCO BRL Life Technologies, Grand Island, NY) in minimal essential medium (MEM) containing 10% fetal bovine serum (FBS). Tissue was digested at 37°C with gentle shaking over 1–2 nights. After centrifugation at 600 x g for 5 min, the supernatant and floating fat were decanted. The pellet was resuspended in MEM and passed through a 150-µm filter (Tetko, Montery Park, CA). The organoids retained on the filter were recovered by gently pipetting. Aliquots were taken for enzyme activity assays, RNA isolation and histology. The epithelial cells were determined by keratin-positive immunohistostaining.

Cell cultures.

Primary cultures of human breast epithelial cells were obtained from M. R. Stampfer at the University of California at Berkeley (specimen # 184 and 161), and Clonetics (San Diego, CA) (HMEC219–4 and HMEC2595). Each specimen was from a different patient. From specimen # 184 and 161, two isolates from different passages were evaluated. Established cell lines, including MCF-10A and 10F human breast epithelial cells, MCF-7 and MDA-MB-231 human breast cancer cells, HUTU80 human duodenum cancer cells, HT29 and Caco-2 human colon cancer cells, as well as IEC-6 and IEC-18 rat small intestine cell lines, were obtained from American Type Culture Collection (Rockville, MD). The generation of MCF-7 transfectant cells, MCF-7D1 expressing a Gpx2 cDNA, was described previously (Chu et al. 1993Citation ).

The culture conditions for HMEC followed supplier recommendations. For HMEC-161 and 184 sublines of the early passages (2–3 passages), the culture medium contained Dulbecco's modified Eagle's medium (DMEM)/F12 supplemented with 0.4% FBS, 5 mg/L each insulin and transferrin, 0.5 mg/L dexamethasone, 5 µg/L epidermal growth factor and 60–100 µg/L cholera enterotoxin. For HMEC-161 and 184 sublines of the late passages (7–13 passages), the medium contained MCDB170 (Hammond et al. 1984Citation ), supplemented with 5 mg/L each insulin and transferrin, 0.5 mg/L dexamethasone, 5 µg/L epidermal growth factor and 10 µmol/L isoproterenol. For the HMEC219–4 and 2595 lines obtained from Clonetics, the culture medium contained MEGM SingleQuots (Clonetics). The growth medium for MCF-10 cells consisted of DMEM/F12 supplemented with 5% FBS, insulin at 5 mg/L, transferrin at 5 mg/L, 20 µg/L epidermal growth factor, 60–100 µg/L cholera enterotoxin (Irvine Scientific, Irvine, CA), 0.5 nmol/L hydrocortisone and 100 nmol/L Na2SeO3. The culture media for all other established cell lines were DMEM/F12 supplemented with 5% FBS and 100 nmol/L Na2SeO3. Geneticin (G418) at 0.4 g/L was included to maintain the transfected MCF-7D1 cells. RA (Sigma Chemical, St. Louis, MO) was dissolved in absolute ethanol. Subconfluent cells were cultured in the same medium with either vehicle (0.6% ethanol) only or 1 µmol/L RA.

RNA isolation and Northern analysis.

Total RNA was isolated using either the acid guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi 1987Citation ) or RNeasy kit (Qiagen, Valencia, CA). A 0.7-kb of human Gpx1 cDNA (encoding GPX-1), a 1-kb human Gpx2 cDNA (encoding GPX-GI), a 1.6-kb human Gpx3 cDNA (encoding GPX-P), a 0.9-kb human Gpx4 cDNA [encoding phospholipid hydroperoxide-reducing isozyme (PHGPX)] and a 1-kb chicken ß-actin cDNA were used as probes (Chu et al. 1992Citation , Chu and Esworthy 1995Citation , Esworthy et al. 1994Citation ). The hybridization and washing conditions were as previously described.

In situ hybridization.

A 688-bp human Gpx2 cDNA fragment (from nucleotide 182 in Fig. 4Citation to the CTGCAG PstI site at 128 nucleotide 3' to the translation termination codon) was cloned into pBluescript. A 32P-UTP-labeled riboprobe in the sense direction was transcribed from the T3 promoter after the template was linearized with BamHI. The antisense riboprobe was transcribed from the T7 promoter after the template was linearized with HindIII. 32P-Labeled riboprobes were generated from a transcription kit (Stratagene, La Jolla, CA). Preparation of slides containing human small intestine and hybridization and washing conditions were according to the described procedure (Oft et al. 1993Citation ).




View larger version (98K):
[in this window]
[in a new window]
 
Figure 4. DNA sequence of 5' regulatory region, exon 1 and partial intron of human Gpx2 gene. The predicted TATA box at nucleotide -29 is in bold. The bold ATG, at nucleotide 170, denotes the start of the translation codon, and the bold TGA, at nucleotide 287, denotes the selenocysteine codon. The underlined italic print GCT, at nucleotide 278, and T, at nucleotide 450, are the putative polymorphic sites. The putative CdxA homeobox binding motifs with the (A/C)TTTAT(A/G) sequence are shaded. The putative retinoic acid response sequence motifs with the A(G)GG(T)TC(G)A sequence are underlined at nucleotides -1021 and 460.

 
Enzyme assays.

Sample homogenization and processing for enzyme assays were as previously described (Chu and Esworthy 1995Citation ). GPX activity was assayed using H2O2 as the substrate. PHGPX activity was determined with phosphatidylcholine hydroperoxide as the substrate. The unit of GPX and PHGPX activity is defined as nmol NADPH consumed/(min · mg). Glutathione S-transferase (GST) activity was determined with 1-chloro-2,4-dinitrobenzene (CDNB) as the electrophilic substrate. The unit of GST is defined as nanomoles CDNB conjugated with GSH per minute per milligram protein. Protein concentration was determined with the bicinchonic acid assay (Pierce, Rockford, IL) with bovine serum albumin as standard. All enzyme assays from any sample were done in duplicate.

Isolation of human Gpx2 gene.

The human Gpx2 gene was isolated from a P1 phage library screened by polymerase chain reaction using two intron primers Px2in01 (TGAGGGGTCCCTCCTTGTAATGCACCAA) and Px2in06 (GGCACTGAGGACACAGTGGAGAGAA) (Genome Systems, St. Louis, MO). The two exons and single intron sequences were published previously (Accession No. X91863) (Chu et al. 1996Citation ). The DNA sequencing was performed with a fluorescent sequencer (Model 370A, PE Biosystems, Foster City, CA) by the City of Hope DNA Sequencing Core Facility. Sequencing data were collected with Genescan 672 software, and analyzed with IGSuite software (Intellegenics, Mountain View, CA).

Statistical analysis.

The data obtained from multiple samples are presented as means ± SD. ANOVA was done with a two-tailed Student's t test using Excel (Microsoft Office 97, Professional Edition, Cambridge, MA) software. A P-value of < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of human Gpx2 mRNA in human cell lines of intestinal origin and in the crypt of human small intestine.

Although the Gpx2 gene was highly expressed in the epithelium along the GI tract, it was not clear whether the cell lines derived from the small intestine and colon epithelium would continue to express this gene. We analyzed the following five cell lines of intestinal origin including three human cell lines: duodenum adenocarcinoma HUTU80 cells, colon adenocarcinoma HT29 and Caco-2 cells, as well as two rat intestinal epithelial cell lines, IEC-6 and IEC-18 cells. Among the three human cell lines studied, HT29 and Caco-2 expressed a high level of Gpx2 mRNA (Fig. 1Citation ). The third human cell line, HUTU80 cells, and the rat IEC-6 and IEC-18 cells did not have detectable Gpx2 mRNA (Fig. 1Citation and data not shown). HT29 and Caco-2 cells could be used as a positive control for Gpx gene expression because they expressed three and four genes of the selenium-dependent Gpx family, respectively (Chu 1994Citation ). The other two members of Se-dependent Gpx genes were: the Gpx3 gene, which encoded the plasma isozyme, GPX-P, and the Gpx4 gene, which encoded PHGPX.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 1. Northern analysis of Gpx gene expression in human duodenum and colon cancer cell lines. Lanes 1, 2 and 3 contained 10 µg of total RNA isolated from HUTU80, Caco-2 and HT29. The blot was hybridized sequentially with individual Gpx2, ß-actin, Gpx1, Gpx3, Gpx4, and 28S rRNA probes. The specific signal is marked with an arrow.

 
Previously, we had used anti-GPX-GI antibodies to detect GPX-GI along the villus-to-crypt axis and found a higher level of GPX-GI activity in the crypt of rat small intestine (Esworthy et al. 1998Citation ). We did not observe a similar distribution pattern of Gpx2 mRNA by Northern analysis, but this was probably due to RNA degradation during cell fractionation. In this study, we used in situ hybridization to compare the level of Gpx2 mRNA in intestinal epithelium along the villus-to-crypt axis as shown in Figure 2Citation . HT29 cells (panels AD of Fig. 2Citation ) sectioned on the same slide were used as a positive control for Gpx2 gene expression in human small intestine (panels EH of Fig. 2Citation ). Panels A, B and H are shown in light phase microscopy, and panels CG are shown in dark phase microscopy. Panels A, C, E, G and H were hybridized with antisense Gpx2 RNA and panels B, D and F were hybridized with sense Gpx2 RNA. Stronger signals were obtained with the antisense probe than with the sense probe, which had nonspecific binding. Panels E and H show high levels of Gpx2 mRNA in the crypt epithelium as indicated by the arrows, but not in the lamina propria (LP) or muscularis mucosae (MM). The Gpx2 mRNA was also present in the villous epithelium (E) as shown in panel G. These results confirmed that the Gpx2 gene was expressed in an epithelium-specific manner, and the crypt epithelium had a higher level of Gpx2 gene expression in small intestine.



View larger version (124K):
[in this window]
[in a new window]
 
Figure 2. Autoradiography of Gpx2 mRNA expression in HT29 cells and in human small intestine determined by in situ hybridization. Panels A, C, E, G and H show the signal from an antisense Gpx2 riboprobe; panels B, D and F show the signal from a sense Gpx2 riboprobe. Panels AD contain HT29 cells, which were used as controls for human small intestine as shown in panels EH. Panels A, B and H are light phase microscopy, whereas the 32P signal is shown in dark grains. These dark grains turned to a white grain when viewed in dark phase microscopy as shown in panels CG. The crypt is marked with unlabeled arrows in panels E, F and H. The villus, muscularis mucosa and lamina propria are labeled as V, MM and LP, respectively. The cross sections shown in panels E and F contain several crypts, whereas the section shown in panel G contains villi only (X200). The signal in villus epithelium (E) is pointed out with arrows in panel G. A magnified (X4.5) cross section of crypts is shown in panel H (X900), which shows that grains are associated with the crypt epithelium but not lamina propria.

 
Gpx2 gene expression in human mammary cells.

Because Gpx2 mRNA was detected in several human breast cancer cell lines and in one breast tissue sample out of seven, we questioned whether the Gpx2 gene was expressed in normal breast epithelium (Chu et al. 1990Citation and 1993Citation ). To determine this, we isolated breast epithelial cells from three normal human breast tissues obtained from reduction mammaplasty. These isolates were analyzed immediately without culturing in the tissue culture medium. Two isolates of breast cells consisting of 90% epithelial cells had detectable Gpx2 mRNA as analyzed by Northern blot (Lane 6 of Fig. 3Citation shows one of the isolates). The third isolate, which contained 15% epithelial cells, had a very weak signal (data not shown).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 3. Detection of Gpx1 and Gpx2 mRNA in freshly isolated human breast epithelial cells and human mammary epithelial cell (HMEC) lines. Lanes 1–6 contain RNA isolated from HMEC2595, HMEC184 (early passage), HMEC184 (late passage), HMEC161 (early passage), HMEC161 (late passage) and freshly isolated normal breast epithelial cells. The sequence of probing was Gpx2 cDNA, Gpx1 cDNA and then 28S rDNA. The arrow denotes the signal for Gpx1 mRNA, Gpx2 mRNA, and 28S rRNA.

 
We also analyzed four recent lines of human mammary epithelial cells, HMEC161, 184, 219–4 and 2595, established from four patients, as well as the long-established MCF-10A and MCF-10F human breast cell lines. Figure 3Citation shows three of the recent lines, in which two lines, 161 and 184, were analyzed at two different passages. Although Gpx2 mRNA was not detected in both passages, nevertheless it was detected in all four lines. No Gpx2 mRNA was detected in either MCF-10A or MCF-10F cells (data not shown). In contrast, Gpx1 mRNA was detectable in all RNA samples isolated from human mammary epithelial cells with and without culturing. The 28S rRNA levels are shown for RNA loading.

Enzyme activities.

We then determined the levels of GPX, PHGPX and GST activities in the breast and intestinal cells, which are shown in Table 1Citation . With the exception of HUTU80 cells, all breast and intestinal epithelial cells had high levels of GPX activity. The GPX activity could be contributed by either GPX-1 or GPX-GI. HUTU80 did not express either Gpx1 or Gpx2 mRNA and had almost no GPX activity, suggesting that most of cellular glutathione peroxidase activity was contributed by either Gpx1 or Gpx2 gene expression. High levels of PHGPX and GST activities were detected in breast epithelial cells, suggesting that these cells were well protected against most forms of peroxides.


View this table:
[in this window]
[in a new window]
 
Table 1. Enzyme activities determined from human breast and intestine cells

 
Analysis of human Gpx2 gene.

To identify the regulatory factor for Gpx2 gene expression, we isolated a human Gpx2 gene from a P1 phage library. As shown in Figure 4Citation , the predicted transcription start site was at nucleotide position denoted as 1 as analyzed on a Baylor College of Medicine web site (http://dot.imgen.bcm.tmc.edu) (Smith et al. 1996Citation ). A TATA box was predicted at the -29 nucleotide position. With the use of the TFSEARCH program written by Yutaka Akiyama (http://www.rwcp.or.jp/papia/) (Heinemeyer et al. 1998Citation ), we identified multiple binding sites of CdxA protein as shown in the shaded boxes in Figure 4Citation . CdxA is a caudal-type chicken homeobox gene, which regulates intestinal morphogenesis during early vertebrate embryonic development (Frumkin et al. 1994Citation ). CdxA protein has a high homology with the Drosophila caudal (cad) gene, which is also expressed in the developing gut in the fly and is restricted to endodermal derivatives (Mlodzik and Gehring 1987Citation ). The mammalian CdxA homologous proteins identified include Cdx-1, Cdx-2, Cdx-3 and Cdx-4. These genes are all expressed in an intestine-specific manner (Bonner et al. 1995Citation , Drummond et al. 1996Citation , Garner and Wright 1993Citation , James et al. 1994Citation , Jin and Drucker 1996Citation ). The presence of multiple CdxA-binding sites in the Gpx2 gene could explain its high level of expression in intestinal epithelium.

We also identified three regions containing putative RARE; two of these are shown in Figure 4Citation as underlined sequences. The RARE half-site contained a A(G)GG(T)TC(G)A consensus sequence in which the nucleotides in parentheses were not conserved (Lo and Ali-Osman 1997Citation ). One was at the 5' untranslated region between nucleotides -1020 and -1031; another one was at the 5' end of the single intron at nucleotides 460–473; and the third was in exon 2 with a TGACCC(n)11TGACCG sequence (data not shown). We are in the process of making reporter constructs to test the function of these sequences.

Induction of Gpx2 mRNA by retinoic acid.

Because little is known about regulation of Gpx2 gene expression, we tested several compounds including RA for their effect on Gpx2 gene expression. The effect of RA on Gpx2 gene expression was analyzed in RA-responsive MCF-7 and MCF-7D1 cells, and RA-resistant MDA-MB-231 and HT29 cells (Kane et al. 1996Citation , Louvet et al. 1994Citation , van der Leede et al. 1997Citation ). We ran duplicate samples from each treatment and quantified mRNA levels on the basis of the phosphor images. One set of results is shown in Figure 5Citation . The effect of RA on Gpx1 and Gpx2 mRNA is shown in Table 2Citation . RA (1 µmol/L) induced endogenous Gpx2 mRNA level 12-fold in MCF-7 cells, which had a low basal level Gpx2 mRNA expression. The less than onefold induction of Gpx2 mRNA level in MCF-7D1 cells (which expressed a transfected Gpx2 cDNA as well as the endogenous Gpx2 gene), MDA-MB-231 and HT29 cells was not significant. Also, RA did not appear to have any effect on Gpx1 mRNA levels. No induction of Gpx2 gene expression was observed in three intestinal cell lines, which did not have basal Gpx2 gene expression, i.e., HUTU80, IEC-6 and IEC-18 (Fig. 1Citation and unpublished data).



View larger version (92K):
[in this window]
[in a new window]
 
Figure 5. Analysis of Gpx2 mRNA in breast and colon cell lines 1 d after all-trans retinoic acid (RA) treatment. Total RNA (10 µg) was loaded in each lane. Lanes 1 and 2 contained MDA-MB-231 RNA with and without 1 µmol/L RA; lanes 3 and 4 contained RNA isolated from MCF-7D1 cells, which were MCF-7 transfectants expressing the human Gpx2 cDNA; lanes 5 and 6 contained MCF-7 RNA; and lanes 7 and 8 contained HT29 RNA. The blot was hybridized sequentially with Gpx2, Gpx1 and ß-actin probes. The specific signal is marked with an arrow. The Gpx2 mRNA transcribed from the pRSV-Gpx2 cDNA construct has two sizes as shown by the two arrows. The upper arrow shows the higher molecular weight Gpx2 mRNA transcribed from the cDNA construct. The lower arrow shows the lower molecular weight Gpx2 mRNA transcribed from the genomic DNA as well as from the cDNA construct. Both species of Gpx2 mRNA were quantified for RA effect as shown in Table 2Citation .

 

View this table:
[in this window]
[in a new window]
 
Table 2. Effect of all-trans retinoic acid (RA) on Gpx1 and Gpx2 mRNA level1

 
We tested several other ligands on Gpx2 gene induction, including cholecalciferol (vitamin D-3, 1 µmol/L), ß-carotene (1 µmol/L), phorbol ester (10 nmol/L) and lipopolysaccharide (10 mg/L) in MCF-7 and HT29 cells. None of these reagents affected either Gpx1 or Gpx2 gene expression (data not shown).

Kinetics of induction of Gpx2 mRNA and GPX activity in MCF-7 cells.

We analyzed the kinetics of Gpx2 induction by RA in MCF-7 cells by studying both mRNA level and GPX activity. The maximal induction of Gpx2 mRNA was reached 1 d after treatment with 1 µmol/L RA (Fig. 6Citation ). However, the increase of GPX activity appeared to lag behind the Gpx2 mRNA increase, i.e., a onefold increase of GPX activity was reached 4 d after treatment, and a threefold increase of activity was reached 8 d after treatment. No increase of mRNA level or activity could be detected in HT29 cells (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. Kinetics of induction of glutathione peroxidase (GPX) activity (upper panel) and Gpx2 mRNA levels (lower panel) by all-trans retinoic acid (RA) in MCF-7 cells. The mRNA levels were normalized with ß-actin mRNA levels. Controls cells were analyzed at the selected time point. The experiments were done twice. For RNA isolation, one experiment contained RA treatment for 6 and 12 h, and 1, 2, 3, 4 and 6 d; the other contained that for 1, 2, 4 and 6 d. For enzyme activity, one experiment had RA treatment for 1, 2, 3, 4 and 6 d; the other had that for 1, 2, 4, 6 and 8 d. Value shown is either the mean from one sample, or mean ± SD , n = 2.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We showed previously that the Gpx2 gene is highly expressed in the GI tract, in a small percentage of human breast samples and in breast cancer cell lines. It is not clear whether this gene is normally expressed in these tissues. We isolated rat intestinal epithelial cells and found a higher level of GPX-GI activity present in the crypt of rat small intestine (Esworthy et al. 1998Citation ). However, RNA analysis by Northern blot did not show a higher mRNA level in the crypt. Thus, it is not clear whether the Gpx2 gene expression is regulated post-transcriptionally. The cellular fractionation required extensive tissue manipulation, which often resulted in RNA degradation. In this study, we used in situ hybridization to show a higher level of Gpx2 mRNA expression in the crypt epithelium. This result is in complete agreement with the activity data, i.e., higher levels of both Gpx2 mRNA and protein are present in the crypt of intestinal epithelium. This suggests that Gpx2 may be differentiatedly regulated, that is, it may be highly expressed in the epithelial stem cells located in the crypt.

We used an RNA probe transcribed from a partial Gpx2 cDNA lacking most of its 3' untranslated sequence. This was necessary because the full-length probes transcribed in either direction produced equally strong signals in both HT29 cells and human intestinal epithelium performed in situ (data not shown). By removing most of the 3' untranslated sequence from nucleotide 128 beyond the translation termination codon, the sense probe no longer produced as strong a signal as the antisense probe. Additionally, the smaller Gpx2 template generated a larger number of transcripts than did the full-length template. This was probably due to the removal of the stem loop structure easily formed from the putative selenocysteine-insertion sequence element present at nucleotide 221–298 at 3' of the translation termination codon (Berry et al. 1991Citation and 1993Citation ). The stem loop structure might have hindered the RNA polymerase reaction.

In addition to intestinal epithelium expression, the Gpx2 gene was also detected in a small fraction of breast tissue and breast cancer cell lines. To determine whether the Gpx2 gene was expressed in normal breast epithelial cells, we studied Gpx2 mRNA in freshly isolated human breast epithelial cells and four human mammary epithelial cell lines by Northern analysis. Because Gpx2 mRNA was detected in both freshly isolated breast epithelial cells without culturing, this suggested that Gpx2 was most likely expressed in normal breast epithelial cells. The Gpx2 mRNA was detectable in most, but not all of the RNA isolates from the cultured mammary epithelial cells. Perhaps the variation of Gpx2 gene expression was due to the fact that the expression of this gene was regulated. We plan to use in situ hybridization or immunohistochemical staining to study the regulation of Gpx2 gene expression in normal breast epithelial cells in the future.

We previously reported a high level of GPX activity (304 ± 91 mU/mg protein) in human breast tissue, similar to the levels found in human liver (352 ± 89 mU/mg protein) and kidney (191 ± 74 mU/mg protein) (Esworthy et al. 1995Citation ). Because the breast samples contained much adipose tissue, we did not know the GPX activity in breast epithelial cells specifically. In this study on isolated human breast epithelial cells and mammary epithelial cell lines, we found higher GPX activity in most of the epithelial samples than in total breast tissue. Additionally, human breast epithelial cells also expressed high levels of PHGPX and GST activities, suggesting that breast epithelial cells were as well protected against peroxides as human liver. Furthermore, we found that most of cellular GPX activity in breast epithelial cells appeared to be contributed by either Gpx1 or Gpx2. Only those cells that express low levels of both genes, such as MCF-7 and HUTU80 cells, had a low GPX activity. The apparent redundancy of these two isozymes may be understood by the differential regulation of these two genes.

To identify the potential regulatory agent for Gpx2 gene expression, we isolated and analyzed the human Gpx2 gene. Analysis of the Gpx2 gene revealed the most prominent regulatory element to be putative binding sites for CdxA, a chicken caudal-type homeobox protein. The fact that mammalian CdxA analogs, such as Cdx-1, Cdx-2, Cdx-3 and Cdx-4, also were expressed in the intestine-specific manner might explain the high level of Gpx2 gene expression in the intestine (Bonner et al. 1995Citation , Drummond et al. 1996Citation , Garner and Wright 1993Citation , James et al. 1994Citation , Jin and Drucker 1996Citation ). It is likely that the CdxA binding sites can promote Gpx2 gene expression constitutively. This may explain the high level of Gpx2 gene expression in HT29 and Caco-2 cells.

Additionally, we identified three putative RARE in the Gpx2 gene, one at the 5' untranslated region, one at the junction of exon 1 and intron, and one at the exon 2. Each site has two RARE half-sites. RA has little effect on the level of Gpx2 cDNA expression driven by the Rous sarcoma virus promoter, suggesting that the RARE in Gpx2 exon 2 might not be functional. A functional RARE present in the intron was reported in a human Pi class glutathione S-transferase, GSTP1C (Lo and Ali-Osman 1997Citation ), as well as in a human CD38 gene (Kishimoto et al. 1998Citation ). Thus, either of these two RARE in the 5' promoter or intron could be functional. We are in the process of making reporter constructs to test the function of these RARE sequences.

RA action is likely mediated by a retinoic acid receptor (RAR); the responsiveness of these cells to RA as measured by growth inhibition may depend on the levels of three isotypes of RAR, i.e., {alpha}, ß and {gamma} (Fitzgerald et al. 1997Citation ). The RA-sensitive MCF-7 cells expressed a higher level of RAR{alpha} than the RA-resistant MBA-MD-231 cells (Fitzgerald et al. 1997Citation , van der Leede et al. 1997Citation ). Although Gpx2 gene expression was clearly induced by RA in MCF-7 cells, it was not induced significantly in MCF-7D1 cells, which were sensitive to RA-induced growth inhibition (data not shown). The lack of induction was apparently due to the high level of constitutive Gpx2 cDNA expression. More samples must be analyzed to determine whether the less than onefold increase of Gpx2 mRNA level is significant. Also, increased Gpx2 gene expression did not result in resistance to RA-induced growth inhibition.

Although HT29 cells were responsive to 9-cis retinoic acid (9-cis RA)-induced gene activation, these cells were resistant to RA-induced gene activation as well as morphologic changes (Kane et al. 1996Citation , Louvet et al. 1994Citation , Plateroti et al. 1993Citation ). HT29 cells had low levels of RAR proteins, and this could explain their resistance to RA. The effect of 9-cis RA can be mediated by RXR, RAR analogs (Chambon 1996Citation ). Thus, activation of RXR{alpha}, RXR{gamma} and vitamin D receptor genes appeared to be regulated by RXR, whereas activation of Gpx2 might be mediated by RAR only. We did not detect Gpx2 mRNA in HUTU80, IEC-6 and IEC-18 cells with and without RA treatment. One of these cell lines, IEC-6 cells, was shown to have functional RAR proteins, and RA induces RAR{alpha}, RARß and a bone-type alkaline phosphatase (Nikawa et al. 1998Citation ). Thus, it was not clear why the Gpx2 gene could not be induced in these cells.

The increased Gpx2 mRNA level resulted in an increase of GPX activity, which was slower than the kinetics of mRNA induction. It took 6–8 d to reach maximal GPX-GI activity, whereas maximal Gpx2 mRNA was reached in 1 d. This slow induction of GPX-GI might be due to the slow degradation rate of this protein (Schimke and Doyle 1970Citation ). A slow induction of GPX-1 activity by selenium supplementation was observed in liver- and MCF-7-derived cell lines (Chu et al. 1990Citation , Knight and Sunde 1988Citation ). The GPX-1 appeared to have a half-life of 2.8–5.2 d. The similar kinetics of activity increase suggested that GPX-GI might have a rate of degradation similar to that of GPX-1.

In spite of many similarities between GPX-1 and GPX-GI, GPX-GI was different from GPX-1 in several aspects other than tissue distribution. First, GPX-GI had threefold lower specific activity than GPX-1 with H2O2 as the substrate, suggesting that it was less efficient in reducing H2O2 and possibly alkyl hydroperoxides (unpublished observations). Second, GPX-GI was much more labile than GPX-1. GPX-GI was readily inactivated in the absence of reducing reagents (Chu and Esworthy 1995Citation , Esworthy et al. 1998Citation ). This suggested that GPX-GI tended to be inactivated when oxidized and was more easily modulated. Third, unlike GPX-1, which had a dual mitochondrial and cytosolic localization, GPX-GI appeared to be a solely cytosolic enzyme on the basis of our analysis of its peptide sequence. In this study, we found that the Gpx2 gene, but not the Gpx1 gene, was inducible by retinoic acid. This provided the first evidence showing a distinct pattern of gene regulation in these two isozymes. Because the Gpx2 gene was expressed in an epithelium-specific manner and was regulated by a differentiation agent, this gene might have the important function of protecting epithelial cells from oxidative stress. In future studies, we plan to investigate the physiologic role of GPX-GI in epithelial cells.


    ACKNOWLEDGMENTS
 
We thank John Laurent for providing breast tissues, Martha Stampfer at UC Berkeley for human mammary epithelial cells as well as consultation on cell culture, and Kathy Lovelace at Clonetics for breast epithelial cells.


    FOOTNOTES
 
1 Supported by National Institutes of Health grant R29 DK46921 (F.-F.C). PhosphorImager was supported by National Science Foundation grant BIR-9220534. Back

3 Abbreviations used: CDNB, 1-chloro-2,4-dinitrobenzene; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; GI, gastrointestinal; GPX, Se-dependent glutathione peroxidase; GPX-1, the classic cellular GPX; Gpx2, the gene name for GPX-GI; GPX-GI, the gastrointestinal form of GPX; GST, glutathione S-transferase; MEM, minimum essential medium; PHGPX, phospholipid hydroperoxide-reducing GPX; RA, all-trans retinoic acid; 9-cis RA, 9-cis retinoic acid; RAR, retinoic acid receptor; RARE, retinoic acid responsive element; RXR, retinoic X receptor. Back

Manuscript received May 10, 1999. Initial review completed June 10, 1999. Revision accepted July 5, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

1. Berry M. J., Banu L., Chen Y. Y., Mandel S. J., Kieffer J. D., Harney J. W., Larsen P. R. Recognition of UGA as a selenocysteine codon in type I deiodinase requires sequences in the 3' untranslated region. Nature (Lond.) 1991;353:273-276[Medline]

2. Berry M. J., Banu L., Harney J. W., Larsen P. R. Functional characterization of the eukaryotic SECIS elements which direct selenocysteine insertion at UGA codons. EMBO J 1993;12:3315-3322[Medline]

3. Bonner C. A., Loftus S. K., Wasmuth J. J. Isolation, characterization, and precise physical localization of human CDX1, a caudal-type homeobox gene. Genomics 1995;28:206-211[Medline]

4. Capdevila J. H., Morrow J. D., Belosludtsev Y. Y., Beauchamp D. R., DuBois R. N., Falck J. R. The catalytic outcomes of the constitutive and the mitogen inducible isoforms of prostaglandin H2 synthase are markedly affected by glutathione and glutathione peroxidase(s). Biochemistry 1995;34:3325-3337[Medline]

5. Chambon P. A decade of molecular biology of retinoic acid receptors. FASEB J 1996;10:940-954[Abstract]

6. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987;162:156-159[Medline]

7. Chu F.-F. The human glutathione peroxidase genes GPX2, GPX3, and GPX4 map to chromosomes 14, 5, and 19, respectively. Cytogenet. Cell Genet. 1994;66:96-98[Medline]

8. Chu F.-F., Doroshow J. H., Esworthy R. S. Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI. J. Biol. Chem. 1993;268:2571-2576[Abstract/Free Full Text]

9. Chu F.-F., Esworthy R. S. The expression of an intestinal form of glutathione peroxidase (GSHPx-GI) in rat intestinal epithelium. Arch. Biochem. Biophys. 1995;323:288-294[Medline]

10. Chu F.-F., Esworthy R. S., Akman S., Doroshow J. H. Modulation of glutathione peroxidase expression by selenium: effect on human MCF-7 breast cancer cell transfectants expressing a cellular glutathione peroxidase cDNA and doxorubicin-resistant MCF-7 cells. Nucleic Acids Res 1990;18:1531-1539[Abstract/Free Full Text]

11. Chu F.-F., Esworthy R. S., Doroshow J. H., Doan K., Liu X. F. Expression of plasma glutathione peroxidase in human liver in addition to kidney, heart, lung, and breast in humans and rodents. Blood 1992;79:3233-3238[Abstract/Free Full Text]

12. Chu F.-F., Rohan de Silva H. A., Esworthy R. S., Boteva K. K., Walters C. E., Roses A., Rao P. N., Pettenati M. J. Polymorphism and chromosomal localization of the GI-form of human glutathione peroxidase (GPX2) on 14q24.1 by in situ hybridization. Genomics 1996;32:272-276[Medline]

13. Cossarizza A., Franceschi C., Monti D., Salvioli S., Bellesia E., Rivabene R., Biondo L., Rainaldi G., Tinari A., Malorni W. Protective effect of N-acetylcysteine in tumor necrosis factor-alpha-induced apoptosis in U937 cells: the role of mitochondria [published erratum appears in Exp. Cell Res. (1996) 222: 251–253]. Exp. Cell Res. 1995;220:232-240[Medline]

14. Cowan D. B., Weisel R. D., Williams W. G., Mickle D. A. The regulation of glutathione peroxidase gene expression by oxygen tension in cultured human cardiomyocytes. J. Mol. Cell. Cardiol. 1992;24:423-433[Medline]

15. Cowan D. B., Weisel R. D., Williams W. G., Mickle D. A. Identification of oxygen responsive elements in the 5'-flanking region of the human glutathione peroxidase gene. J. Biol. Chem. 1993;268:26904-26910[Abstract/Free Full Text]

16. Drummond F., Sowden J., Morrison K., Edwards Y. H. The caudal-type homeobox protein Cdx-2 binds to the colon promoter of the carbonic anhydrase 1 gene. Eur. J. Biochem. 1996;236:670-681[Medline]

17. Esworthy R. S., Baker M. A., Chu F.-F. Expression of selenium-dependent glutathione peroxidase in human breast tumor cell lines. Cancer Res 1995;55:957-962[Abstract/Free Full Text]

18. Esworthy R. S., Doan K., Doroshow J. H., Chu F.-F. Cloning and sequencing of the cDNA encoding a human testis phospholipid hydroperoxide glutathione peroxidase. Gene 1994;144:317-318[Medline]

19. Esworthy R. S., Swiderek K. M., Ho Y. S., Chu F.-F. Selenium-dependent glutathione peroxidase-GI is a major glutathione peroxidase activity in the mucosal epithelium of rodent intestine. Biochim. Biophys. Acta 1998;1381:213-226[Medline]

20. Fitzgerald P., Teng M., Chandraratna R. A., Heyman R. A., Allegretto E. A. Retinoic acid receptor alpha expression correlates with retinoid-induced growth inhibition of human breast cancer cells regardless of estrogen receptor status. Cancer Res 1997;57:2642-2650[Abstract/Free Full Text]

21. Frumkin A., Pillemer G., Haffner R., Tarcic N., Gruenbaum Y., Fainsod A. A role for CdxA in gut closure and intestinal epithelia differentiation. Development 1994;120:253-263[Abstract]

22. Garner L. W., Wright C. V. Murine Cdx-4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern. Mech. Dev. 1993;43:71-81[Medline]

23. Hammond S. L., Ham R. G., Stampfer M. R. Serum-free growth of human mammary epithelial cells: rapid clonal growth in defined medium and extended serial passage with pituitary extract. Proc. Natl. Acad. Sci. U.S.A. 1984;81:5435-5439[Abstract/Free Full Text]

24. Heinemeyer T., Wingender E., Reuter I., Hermjakob H., Kel A. E., Kel O. V., Ignatieva E. V., Ananko E. A., Podkolodnaya O. A., Kolpakov F. A., Podkolodny N. L., Kolchanov N. A. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 1998;26:362-367[Abstract/Free Full Text]

25. Hockenbery D. M., Oltvai Z. N., Yin X. M., Milliman C. L., Korsmeyer S. J. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 1993;75:241-251[Medline]

26. Islam K. N., Kayanoki Y., Kaneto H., Suzuki K., Asahi M., Fujii J., Taniguchi N. TGF-beta 1 triggers oxidative modifications and enhances apoptosis in HIT cells through accumulation of reactive oxygen species by suppression of catalase and glutathione peroxidase. Free Radic. Biol. Med. 1997;22:1007-1017[Medline]

27. James R., Erler T., Kazenwadel J. Structure of the murine homeobox gene cdx-2. Expression in embryonic and adult intestinal epithelium. J. Biol. Chem. 1994;269:15229-15237

28. Jin T., Drucker D. J. Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3. Mol. Cell. Biol. 1996;16:19-28[Abstract]

29. Jornot L., Junod A. F. Differential regulation of glutathione peroxidase by selenomethionine and hyperoxia in endothelial cells. Biochem. J. 1995;306:581-587

30. Jornot L., Junod A. F. Hyperoxia, unlike phorbol ester, induces glutathione peroxidase through a protein kinase C-independent mechanism. Biochem. J. 1997;326:117-123

31. Kane K. F., Langman M. J., Williams G. R. Antiproliferative responses to two human colon cancer cell lines to vitamin D3 are differently modified by 9-cis-retinoic acid. Cancer Res 1996;56:623-632[Abstract/Free Full Text]

32. Kishimoto H., Hoshino S., Ohori M., Kontani K., Nishina H., Suzawa M., Kato S., Katada T. Molecular mechanism of human CD38 gene expression by retinoic acid. Identification of retinoic acid response element in the first intron. J. Biol. Chem. 1998;273:15429-15434[Abstract/Free Full Text]

33. Knight S.A.B., Sunde R. A. Effect of selenium repletion on glutathione peroxidase protein level in rat liver. J. Nutr. 1988;118:853-858

34. Kretz-Remy C., Mehlen P., Mirault M. E., Arrigo A. P. Inhibition of I kappa B-alpha phosphorylation and degradation and subsequent NF-kappa B activation by glutathione peroxidase overexpression. J. Cell Biol. 1996;133:1083-1093[Abstract/Free Full Text]

35. Lafon C., Mathieu C., Guerrin M., Pierre O., Vidal S., Valette A. Transforming growth factor beta 1-induced apoptosis in human ovarian carcinoma cells: protection by the antioxidant N-acetylcysteine and bcl-2. Cell Growth Differ 1996;7:1095-1104[Abstract]

36. Lo H. W., Ali-Osman F. Genomic cloning of hGSTP1*C, an allelic human Pi class glutathione S-transferase gene variant and functional characterization of its retinoic acid response elements. J. Biol. Chem. 1997;272:32743-32749[Abstract/Free Full Text]

37. Louvet C., Empereur S., Fagot D., Forgue-Lafitte E., Chastre E., Zimber A., Mester J., Gespach C. The arotinoid Ro 40–8757 has antiproliferative effects in drug-resistant human colon and breast cancer cell lines in vitro. Cancer Lett 1994;85:83-86[Medline]

38. Mirault M. E., Tremblay A., Beaudoin N., Tremblay M. Overexpression of seleno-glutathione peroxidase by gene transfer enhances the resistance of T47D human breast cells to clastogenic oxidants. J. Biol. Chem. 1991;266:20752-20760[Abstract/Free Full Text]

39. Mlodzik M., Gehring W. J. Expression of the caudal gene in the germ line of Drosophila: formation of an RNA and protein gradient during early embryogenesis. Cell 1987;48:465-478[Medline]

40. Nikawa T., Rokutan K., Nanba K., Tokuoka K., Teshima S., Engle M. J., Alpers D. H., Kishi K. Vitamin A up-regulates expression of bone-type alkaline phosphatase in a rat small intestinal crypt cell line and fetal rat small intestine. J Nutr 1998;128:1869-1877[Abstract/Free Full Text]

41. Nishio E., Watanabe Y. Transforming growth factor beta is a modulator of platelet-derived growth factor action in vascular smooth muscle cells: a possible role for catalase activity and glutathione peroxidase activity. Biochem. Biophys. Res. Commun. 1997;232:1-4[Medline]

42. Oft M., Bohm S., Wilczynski S. P., Iftner T. Expression of the different viral mRNAs of human papilloma virus 6 in a squamous-cell carcinoma of the bladder and the cervix. Int. J. Cancer 1993;53:924-931[Medline]

43. Plateroti M., Sambuy Y., Nobili F., Bises G., Perozzi G. Expression of epithelial markers and retinoid-binding proteins in retinol- or retinoic acid-treated intestinal cells in vitro. Exp. Cell Res. 1993;208:137-147[Medline]

44. Schimke R. T., Doyle D. Control of enzyme levels in animal tissues. Annu. Rev. Biochem. 1970;39:929-976[Medline]

45. Simizu S., Takada M., Umezawa K., Imoto M. Requirement of caspase-3(-like) protease-mediated hydrogen peroxide production for apoptosis induced by various anticancer drugs. J. Biol. Chem. 1998;273:26900-26907[Abstract/Free Full Text]

46. Simizu S., Umezawa K., Takada M., Arber N., Imoto M. Induction of hydrogen peroxide production and Bax expression by caspase-3(-like) proteases in tyrosine kinase inhibitor-induced apoptosis in human small cell lung carcinoma cells. Exp. Cell Res. 1998;238:197-203[Medline]

47. Smith R. F., Wiese B. A., Wojzynski M. K., Davison D. B., Worley K. C. BCM Search Launcher—an integrated interface to molecular biology data base search and analysis services available on the World Wide Web. Genome Res 1996;6:454-462[Abstract/Free Full Text]

48. Stampfer M. R. Isolation and growth of human mammary epithelial cells. J. Tissue Cult. Methods 1985;9:107-115

49. Townsend A. J., Morrow C. S., Sinha B. K., Cowan K. H. Selenium-dependent glutathione peroxidase expression is inversely related to estrogen receptor content of human breast cancer cells. Cancer Commun 1991;3:265-270[Medline]

50. van der Leede B. M., van den Brink C. E., Pijnappel W. W., Sonneveld E., van der Saag P. T., van der Burg B. Autoinduction of retinoic acid metabolism to polar derivatives with decreased biological activity in retinoic acid-sensitive, but not in retinoic acid-resistant human breast cancer cells. J. Biol. Chem. 1997;272:17921-17928[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cancer Res.Home page
A. Naiki-Ito, M. Asamoto, N. Hokaiwado, S. Takahashi, H. Yamashita, H. Tsuda, K. Ogawa, and T. Shirai
Gpx2 Is an Overexpressed Gene in Rat Breast Cancers Induced by Three Different Chemical Carcinogens
Cancer Res., December 1, 2007; 67(23): 11353 - 11358.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Singh, T. Rangasamy, R. K. Thimmulappa, H. Lee, W. O. Osburn, R. Brigelius-Flohe, T. W. Kensler, M. Yamamoto, and S. Biswal
Glutathione Peroxidase 2, the Major Cigarette Smoke-Inducible Isoform of GPX in Lungs, Is Regulated by Nrf2
Am. J. Respir. Cell Mol. Biol., December 1, 2006; 35(6): 639 - 650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Yan and X. Chen
GPX2, a Direct Target of p63, Inhibits Oxidative Stress-induced Apoptosis in a p53-dependent Manner
J. Biol. Chem., March 24, 2006; 281(12): 7856 - 7862.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Banning, S. Deubel, D. Kluth, Z. Zhou, and R. Brigelius-Flohe
The GI-GPx Gene Is a Target for Nrf2
Mol. Cell. Biol., June 15, 2005; 25(12): 4914 - 4923.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. S. Esworthy, L. Yang, P. H. Frankel, and F.-F. Chu
Epithelium-Specific Glutathione Peroxidase, Gpx2, Is Involved in the Prevention of Intestinal Inflammation in Selenium-Deficient Mice
J. Nutr., April 1, 2005; 135(4): 740 - 745.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Morbitzer and T. Herget
Expression of Gastrointestinal Glutathione Peroxidase Is Inversely Correlated to the Presence of Hepatitis C Virus Subgenomic RNA in Human Liver Cells
J. Biol. Chem., March 11, 2005; 280(10): 8831 - 8841.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S.-T. Chiu, F.-J. Hsieh, S.-W. Chen, C.-L. Chen, H.-F. Shu, and H. Li
Clinicopathologic Correlation of Up-regulated Genes Identified Using cDNA Microarray and Real-time Reverse Transcription-PCR in Human Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., February 1, 2005; 14(2): 437 - 443.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. S. Esworthy, R. Aranda, M. G. Martin, J. H. Doroshow, S. W. Binder, and F.-F. Chu
Mice with combined disruption of Gpx1 and Gpx2 genes have colitis
Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G848 - G855.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. Rodriguez-Melendez, S. Cano, S. T. Mendez, and A. Velazquez
Biotin Regulates the Genetic Expression of Holocarboxylase Synthetase and Mitochondrial Carboxylases in Rats
J. Nutr., July 1, 2001; 131(7): 1909 - 1913.
[Abstract] [Full Text] [PDF]


Home page
JPEN J Parenter Enteral NutrHome page
A. Lespine, Y. Fernandez, B. Periquet, A. Galinier, J. Garcia, F. Anglade, J. Ghisolfi, and J.-P. Thouvenot
Total Parenteral Nutrition Decreases Liver Oxidative Metabolism and Antioxidant Defenses in Healthy Rats: Comparative Effect of Dietary Olive and Soybean Oil
JPEN J Parenter Enteral Nutr, March 1, 2001; 25(2): 52 - 59.
[Abstract] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. S. Esworthy, J. R. Mann, M. Sam, and F.-F. Chu
Low glutathione peroxidase activity in Gpx1 knockout mice protects jejunum crypts from gamma -irradiation damage
Am J Physiol Gastrointest Liver Physiol, August 1, 2000; 279(2): G426 - G436.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chu, F.-F.
Right arrow Articles by Wilczynski, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chu, F.-F.
Right arrow Articles by Wilczynski, S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 1999 by American Society for Nutrition