![]() |
|
|
The Journal of Nutrition Vol. 129 No. 1 January 1999,
pp. 98-104
Mineral Bioavailability Laboratory, USDA Human Nutrition Research Center on Aging at Tufts University, Boston, MA 02111
| |
ABSTRACT |
|---|
|
|
|---|
The newly identified hemochromatosis gene, HFE, and a candidate iron transporter gene, Nramp2, have been proposed as key factors responsible for the regulation of intestinal iron absorption. Although the exact functions of these proteins in intestinal iron absorption are unknown, HFE may be required for the down-regulation of iron absorption that occurs with increasing iron status, and Nramp2 may up-regulate iron absorption when iron status is low. Thus, we examined whether the expression of the HFE and Nramp2 genes are regulated by iron status in the human intestinal cell line Caco-2. HFE mRNA and HFE protein were increased and Nramp2 mRNA was decreased by increasing cellular iron status in Caco-2 cells. This iron-mediated modulation of mRNA levels was specific to iron. Moreover, super-induction of HFE mRNA in the presence of cycloheximide suggests that HFE gene expression may be controlled by a short-lived repressor protein. HFE and Nramp2 mRNA levels also changed in opposite directions during cellular differentiation. This reciprocal modification of the HFE and Nramp2 gene expression during both iron treatment and cell differentiation in Caco-2 cells is consistent with an opposing role for these proteins in homeostatic regulation of human intestinal iron absorption.
KEY WORDS: HFE · Nramp2 · iron · human intestinal cell line · gene expression
Iron is a trace element that is required for numerous cellular metabolic functions, but is potentially toxic to the cell when present in excess (Skikne and Baynes 1994 Hereditary hemochromatosis is a common autosomal recessive genetic disease in humans. It is characterized by excessive accumulation of iron in the body caused by an inappropriately high intestinal iron absorption, even under conditions of high body iron burdens (Bothwell et al. 1995 In contrast to the iron overload of hereditary hemochromatosis, homozygous mk/mk mice develop microcytic, hypochromic anemia caused by defective intestinal iron absorption and erythroid iron utilization (Edwards and Hoke 1972 Given the apparent importance of these two novel genes in the regulation of intestinal iron absorption, we hypothesized that the expression of HFE and Nramp2 mRNA would be inversely regulated by the iron status of the enterocyte. To test this hypothesis we examined the regulation of HFE and Nramp2 mRNA by iron treatment in Caco-2 cells. Caco-2 cells are a human intestinal cell line that spontaneously differentiate into cells that possess many of the cardinal morphological and biochemical features of mature small intestine enterocytes after reaching confluence (Jumarie and Malo 1992 Reagents.
Tissue culture medium and Hanks' balanced salts solution were purchased from Bio Whittaker (Walkersville, MD). Fetal bovine serum (FBS) was obtained from Hyclone (Logan, UT). Phenylmethylsulfonyl fluoride (PMSF), leupeptin, and aprotinin were obtained from Sigma Chemical (St. Louis, MO). Glutamine, non-essential amino acids, pyruvate, phenicillin G, streptomycin and gentamicin were obtained from GIBCO BRL (Gaithersburg, MD). Polyclonal rabbit anti-human HFE (CT1) was a generous gift from William S. Sly and Abdul Waheed from Saint Louis University School of Medicine. Monoclonal mouse anti-human TfR and polyclonal rabbit anti-human ferritin were obtained from Zymed (San Francisco, CA) and Dako (Santa Barbara, CA), respectively. Nitrocellulose membranes, enhanced chemiluminescence (ECL) kits for Western blotting protein detection and the peroxidase-coupled sheep anti-mouse and donkey anti-rabbit antibodies were purchased from Amersham (Airlington Heights, IL). Unless otherwise noted, all other reagents were purchased from Sigma Chemical (St Louis, MO) or Fisher Scientific (Springfield, NJ).
Cells.
Caco-2 cells were obtained from American Type Culture Collection and used between passages 30 and 40. Stock cultures were maintained in DMEM containing 20% FBS, 25 mmol/L of glucose, 2 mmol/L of glutamine, 100 µmol/L of non-essentia1 amino acids, 1 mmol/L of pyruvate, 50 mg/L of gentamicin, 100 U/L of penicillin G and 100 µg/L of streptomycin at 37°C in a humidified atmosphere of 95% air and 5% CO2. For experiments, Caco-2 cells were grown and maintained on polycarbonate membrane inserts (0.4 µm pores; Corning Costar, Cambridge, MA) in six-well dishes as described above, except that the concentration of FBS in medium was decreased to 10%. For experiments investigating the effects of iron and other metals on HFE and Nramp2 mRNAs, cultures were used 13 d after reaching confluence. Cells are fully differentiated at 13 d after confluence in normal cell culture conditions (Han et al. 1995 Reverse transcriptase polymerase chain reaction.
Total RNA was isolated from Caco-2 cells using TRI Reagent (Molecular Research Center, Cincinnati, OH). The first strand of cDNA was obtained by standard reverse transcription reaction. The cDNA solution was then used as a template for polymerase chain reaction (PCR) amplification with Taq polymerase (Perkin-Elmer, Norwalk, CT) for indicated cycles (see below) at 95 °C for 15 s, 55 °C for 1 min 25 s and 72 °C for 45 s. Samples were amplified for 27 (HFE), 18 (Nramp2) or 20 (GAPDH) cycles. Primer sets are: HFE, 5' primer (5'-AAGCAGCCAATGGATGCCAAGGAG-3') and 3' primer (5'-ACGTAGTGCCCCATGGCTCCTCTT-3'), Nramp2, 5' primer (5'-AACCCAGCCAGAGCCAGGTA-3') and 3' primer (5'CCCCCTTTGTAGATGTCCAC-3'), GAPDH, 5' primer (5'-CCATGGAGAAGGCTGGGG-3') and 3' primer (5'CAAAGTTGTCATGGATGACC-3'). A PCR blank consisting of PCR reaction cocktail and water instead of the cDNA sample was included during each amplification as a negative control. The expected sizes for HFE, Nramp2 and GAPDH mRNAs are 302, 391 and 195 bp, respectively. Photographic negatives of ethidium bromide stained gels were quantified by laser densitometry (Molecular Dynamics, Sunnyvale, CA). Data for HFE and Nramp2 mRNA were normalized to the levels of GAPDH expression, whose levels were not altered by iron treatment. The analysis of reverse transcriptase polymerase chain reaction (RT-PCR) was performed within the linear range of amplification.
Western blotting.
Cells were lysed in buffer containing 25 mmol/L of Tris-HCl, pH 7.4, 150 mmol/L of NaCl, 1 mmol/L of EGTA, 1 mmol/L of PMSF, 1 µmol/L of leupeptin and aprotinin, and 0.5% Nonidet P-40 (NP-40). Cell homogenates were preliminary assayed for protein and diluted with lyses buffer to equal protein concentration. Aliquots of proteins were heated to 100°C for 5 min in Laemmli sodium dodceyle sulfate (SDS) buffer. SDS-treated samples were then separated by sodium dodceyle sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 15% resolving and 3.5% stacking gel and electroblotted to nitrocellulose membrane (Amersham, Arlington, Anaheim, CA). The blots were then incubated with 2 mg/L of CT1 HFE antibody (Feder et al. 1997 Statistical analysis.
Data are presented as mean ± sem for all experiments that were performed two to four times. Significant differences were determined by one-way ANOVA and LSD post hoc testing using SYSTAT (SPSS Inc., Chicago, IL). P < 0.05 was considered significant.
Caco-2 cells express HFE and Nramp2 but not Nramp1.
Initially, we analyzed the genetic sequence of the HFE cDNA in Caco-2 cells to determine whether this cell line carries the C282Y mutation characteristic of hereditary hemochromatosis (Feder et al. 1996 Effects of cellular differentiation on HFE and Nramp2 gene expression.
Upon reaching confluence, Caco-2 cells begin to differentiate and display morphological and functional changes that are peculiar to mature cells in the small intestine (Jumarie and Malo 1992
Effects of iron treatment on HFE and Nramp2 mRNA.
Whereas the exact regulatory function of HFE in intestinal iron absorption is unknown, HFE presumably requires interaction with
Induction of HFE mRNA by iron increases total HFE protein.
Caco-2 cells were exposed to 50 µmol/L of diferric transferrin in the basolateral compartment of the insert for 72 h, and HFE protein was measured by Western blotting with the CT1 antibody. As shown in Figure 3A, iron treatment increased total cellular HFE protein. Densitometric analysis demonstrates that iron treatment increased HFE protein by 70 ± 7% (n = 4, P < 0.05). To confirm changes of cellular iron status, the blot was reprobed with TfR antibody. As shown in Figure 3B, in contrast to iron-induced increases in HFE protein, iron treatment decreased the level of cellular TfR protein. In addition, HFE protein expression was higher in undifferentiated cells than in fully differentiated cells (data not shown).
Iron-mediated induction of HFE and Nramp2 gene expression was specific to iron.
To examine whether metal-mediated modulation of HFE and Nramp2 mRNA is specific to iron, Caco-2 cells were treated with either 50 µmol/L of Fe2-Tf or 200 µmol/L of Fe (NTA)2, CoCl2, CuSO4, or ZnCl2 for 24 h prior to measuring HFE and Nramp2 mRNAs. HFE mRNA was increased by Fe2-Tf and Fe treatment, but not altered (P > 0.05) by treatment with these other transition metals, demonstrating that the effect of iron is specific (Fig. 4A). Only treatment with Fe2-Tf significantly (P < 0.05) reduced Nramp2 mRNA levels (Fig. 4B).
Effects of cycloheximide on HFE and Nramp2 gene expression.
To gain insight into the regulation of HFE and Nramp2 mRNAs by iron, differentiated Caco-2 cells were incubated for 24 h with cycloheximide, a protein synthesis inhibitor, in the presence and absence of iron treatment. Treatment of Caco-2 cells with 10 mg/L of cycloheximide alone caused a 6.8-fold increase (P < 0.05) in HFE mRNA (Fig. 5A). Iron treatment had no additional effect on HFE mRNA levels in the presence of the inhibitor. In contrast to the super-induction effect of cycloheximide on HFE mRNA, Nramp2 mRNA was decreased (P < 0.05) in the presence of the inhibitor (Fig. 5B). The moderate effect of cycloheximide on Nramp2 mRNA was not different from that observed with iron treatment alone. Iron treatment caused no further decrease in Nramp2 mRNA in the presence of cycloheximide.
Our present studies have shown for the first time that HFE protein level is increased by increasing cellular iron status in human intestinal cells. The observation of HFE protein regulation by iron is consistent with the observed changes in HFE mRNA following iron treatment in Caco-2 cells (Fig. 2B) and the notion that HFE levels in the enterocyte are involved in iron homeostasis. Moreover, our current finding showing the marked effect of inhibition of protein synthesis on HFE mRNA levels is consistent with the idea that a protein with a short half-life may normally act to repress HFE gene transcription. The identity of this putative, short-lived repressor protein that regulates HFE mRNA expression is presently unknown. In addition, it is not known whether the activity of this protein is modulated by iron. However, a precedent for a repressor transcriptional control mechanism was previously reported for other MHC class I genes. Inhibition of protein synthesis results in the super-induction of MHC class I mRNA by decreasing silencer factors with a concomitant increase of enhancer factors of MHC class I transcription (Weissman and Singer 1991
![]()
INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References
). Alterations in body iron stores are associated with various human diseases, including neurodegenerative diseases (Wang et al. 1995
), microbial infection (Weinberg 1985
), diabetes mellitus (Bomford and Williams 1976
), cardiomyopathy (Salonen et al. 1992
), atherosclerosis (Smith et al. 1992
), and cancer (Nelson 1995). Mammalian iron homeostasis is maintained primarily by regulating intestinal iron absorption (i.e. high iron absorption when iron status is low; low iron absorption when iron status is high) (Skikne and Baynes 1994
). However, despite extensive studies, the molecular mechanisms responsible for regulating iron transfer across the enterocyte remain unknown.
). Recently, a mutation in a newly identified major histocompatibility complex (MHC)7 class I-like gene, called HFE, has been identified as the cause of this hereditary iron overload disease (Feder et al. 1996
). Whereas the regulatory function of HFE in the intestine is unknown, it has been suggested that HFE is required for the homeostatic down-regulation of iron absorption that normally occurs with increasing iron status (Feder et al. 1996
, Zhou et al. 1998
). The C282Y (a change of cysteine to tyrosine at amino acid 282) mutation in HFE that is responsible for hereditary hemochromatosis was shown to cause an abnormality in protein trafficking and cell surface expression of HFE caused by an inability of the mutated HFE to bind
2-microglobulin (Feder et al. 1997
). The importance of the HFE-
2-microglobulin interaction for the regulation of iron absorption is also supported by the observation of progressive iron overload in
2-microglobulin-deficient knockout mice (Rothenberg and Voland 1996
, Santos et al. 1996
).
). Recently, a mutation in the natural resistance-associated macrophage protein-2 (Nramp2) gene has been identified as the gene responsible for the mk genetic defect (Fleming et al. 1997
). Whereas the function of the Nramp2 protein is unknown, it was suggested that Nramp2 is a membrane iron transporter responsible for specific iron transport in the intestine (Fleming et al. 1997
, Gunshin et al. 1997
). Nramp2 is presumably required for up regulation of intestinal iron absorption that occurs with depletion of iron stores (Gunshin et al. 1997
).
, Louvard et al. 1992
). Caco-2 cells were shown to be a useful in vitro model to study the regulation of iron transport and metabolism (Alvarez-Hernandez et al. 1991
, Han et al. 1995
, Han et al. 1997
). As in human intestine, iron treatment of Caco-2 cells decreases cellular iron transport and alters the expression of iron-responsive proteins, such as transferrin receptor (TfR) and ferritin (Alvarez-Hernandez et al. 1991
, Han et al. 1997
, Tapia et al. 1996
). TfR mediates transferrin-bound iron entry into cells (Klausner et al. 1983
), and its synthesis is upregulated by iron deficiency (Banerjee et al. 1986
). Ferritin is a cytosolic iron storage protein whose level is upregulated by high iron status (White and Munro 1988
).
![]()
MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References
, Jumarie and Malo 1992
, Louvard et al. 1992
). Two days before initiating experiments, the level of FBS in medium was reduced from 10 to 0% and 2% in the medium added to the apical and basolateral compartments, respectively. Preliminary studies showed that the cellular iron status was correlated to the content of serum in the maintenance medium. The level of cellular TfR protein was increased, but the cellular content of ferritin protein was decreased in Caco-2 cells incubated in the medium containing 2% FBS for 2 d. Furthermore, the cellular iron status of cultures incubated for 2 d in medium containing 2% FBS was comparable with that of cultures incubated for 1 d in medium containing 100 µmol/L of deferoxamine, an iron chelator.
, Parkkila et al. 1997b
) (or 5 mg/L of ferritin antibody). HFE (or ferritin) was detected by using the ECL chemiluminescent assay (Amersham, Arlington, Anaheim, CA) following incubation with a horseradish peroxidase-linked donkey anti-rabbit antibody and then quantitated by densitometric analysis (Molecular Dynamics, Sunnyvale, CA). To detect TfR protein, the membrane was reprobed with TfR antibody.
![]()
RESULTS
Abstract
Introduction
Methods
Results
Discussion
References
). Following production of cDNA from Caco-2 cell RNA, we amplified a 302 bp region from 948-1249 bp (GenBank #U60319), which included the specific single base mutation site in the human HFE cDNA sequence. We also amplified a region from 240-451 bp that included the second mutation site of H63D in the human HFE cDNA sequence. These polymerase chain reaction products were subcloned into the pCR3 expression vector (Invitrogen, Carlsbad, CA) and sequenced. Sequencing of these PCR products showed that Caco-2 cells possess a normal HFE gene (data not shown). In addition, using RT-PCR we found that Caco-2 cells express HFE and the putative intestinal iron transporter Nramp2, but not Nramp1, which has been reported to be highly expressed in reticuloendothelial cells (Vidal et al. 1993
). We amplified a 391 bp region from 527-917 bp (GenBank #L37347) in human Nramp2 cDNA sequence and a 394 bp region from 739-1132 bp (GenBank #D50403) in human Nramp1 cDNA sequence. The Nramp1 mRNA was not detected in either proliferating or differentiated Caco-2 cells (data not shown).
, Louvard et al. 1992
). HFE and human Nramp2 mRNA levels were determined during this cellular differentiation process. HFE mRNA levels gradually but linearly decreased as the cells became more differentiated (y = -3.1X + 104.7, r = 0.93, Fig. 1A). However, the changes in HFE mRNA levels were not significant (P > 0.05) until 9 d after confluence. The HFE mRNA level in fully differentiated cultures (13 d post confluence) was 40% lower (P < 0.05) than in early confluent cultures (1 d post confluence). In contrast to HFE mRNA, Nramp2 mRNA increased markedly and linearly in Caco-2 cells with time in culture (y = 43.5X + 10.1, r = 0.98, Fig. 1B). The level of Nramp2 mRNA in fully differentiated Caco-2 cells was five-fold higher (P < 0.05) than in proliferating cells. In contrast, the levels of GAPDH mRNA were not altered during cellular differentiation of Caco-2 cells. While the level of TfR protein was decreased, the level of cellular ferritin protein was not altered during cell differentiation of Caco-2 cells (Fig. 1C).

View larger version (25K):
[in a new window]
Fig 1.
Reciprocal regulation of HFE and Nramp2 mRNA levels of Caco-2 cells by cellular differentiation. Total cellular RNA was isolated during differentiation of Caco-2 cells (from 1 d post confluence to 13 d post confluence Caco-2 cultures) and analyzed for HFE mRNA (A) or Nramp2 mRNA (B) by RT-PCR. Representative blots are shown. Graphed values for HFE and Nramp2 mRNA are normalized to the GAPDH mRNA level and are reported relative to the value of the 1 d post confluent time point (Relative value = 100%). Values represent the mean ± se from 3 independent experiments, *P < 0.05 compared to control (1 d post confluent cells). The cellular iron status during cell differentiation was assessed by measuring the levels of TfR and ferritin proteins (C). The cells from either 1 d post confluence or 13 d post confluence cultures of Caco-2 were homogenized, and total proteins were resolved by the 15% SDS-PAGE and electroblotted to nitrocellulose membrane prior to Western blotting for TfR and ferritin proteins. Ft = ferritin, GAPDH = glyceraldehyde 3-phosphate dehydrogenase, RT-PCR = reverse transcriptase polymerase chain reaction, SDS-PAGE = sodium dodecyl sulfate polyacrylamide gel electrophoresis, TfR = transferrin receptor.
2-microglobulin for expression on the surface of intestinal cells (Feder et al. 1997
). Surface expression of HFE is apparently needed to prevent excessive iron absorption when body iron stores are elevated. In contrast, Nramp2, a candidate iron transporter gene, may be responsible for the upregulation of iron absorption when iron stores are low (Gunshin et al. 1997
). Therefore, we initiated a series of experiments to determine whether iron treatment modulates HFE and Nramp2 gene expression in Caco-2 cells. Fully differentiated Caco-2 cells (13 d post confluent) grown on permeable microporous membrane inserts were treated for up to 72 h with 50 µmol/L of diferric transferrin in the bottom (basolateral) compartment of the insert. Changes in cellular iron status following iron treatment of Caco-2 cells were confirmed by measuring the cellular iron-responsive proteins, TfR and ferritin (Fig. 2A). As expected, iron treatment decreased the level of cellular TfR protein but increased the level of cellular ferritin protein.

View larger version (25K):
[in a new window]
Fig 2.
Reciprocal modulation of HFE and Nramp2 mRNA levels by iron in Caco-2 cells. Fully differentiated Caco-2 cells grown on microporous membrane inserts were treated with 50 µmol/L of Fe2-Tf in the basolateral compartment for 12-72 h. The changes of cellular iron status by iron treatments were confirmed by measuring iron-responsive proteins, TfR and ferritin (A). A representative Western blot is shown from three independent experiments. Total RNA was isolated from cells after the indicated incubation time and analyzed for HFE mRNA (B) or Nramp2 mRNA (C) by RT-PCR. Representative blots are shown. Values for HFE and Nramp2 mRNA are normalized to GAPDH mRNA levels and are expressed relative to the value of the 0 h time point (Relative value = 100%). Data points represent the mean ± SE from 3 independent experiments, *P < 0.05 compared to control (time = 0).

View larger version (37K):
[in a new window]
Fig 3.
Reciprocal regulation of HFE and TfR proteins by iron in Caco-2 cells. Fully differentiated Caco-2 cells were exposed to 50 µmol/L of Fe2-Tf in the basolateral compartment of insert for 72 h. Cells were homogenized, and total proteins (40 µg) were resolved by the 15% SDS-PAGE and electroblotted to nitrocellulose membrane prior to Western blotting for HFE protein using the antibody CT1. A representative Western blot is shown from 4 independent experiments. (A) Increase of HFE protein by iron treatment. In addition to 48 kDa HFE protein, some proteolytic products of HFE protein were also identified by CT 1 HFE antibody. (B) Down regulation of TfR protein by iron. To detect TfR protein, the membrane was reprobed with an antibody for human TfR.

View larger version (33K):
[in a new window]
Fig 4.
Modulation of HFE and Nramp2 mRNA levels by various divalent cations in Caco-2 cells. Fully differentiated Caco-2 cells grown on microporous membrane inserts were treated with 50 µmol/L of Fe2-Tf, or 200 µmol/L of Fe (NTA)2, CoCl2, CuSO4 or ZnCl2. Total RNA was isolated after 24 h incubation with the divalent cations and analyzed for HFE (A) or Nramp2 mRNA (B) by RT-PCR. Values for HFE or Nramp2 mRNAs are normalized to GAPDH mRNA levels and are expressed relative to the value of the non-treated control samples (Relative value = 100%). Bars represent the mean ± se from 3 independent experiments, *P < 0.05 compared to control.

View larger version (25K):
[in a new window]
Fig 5.
Effects of cycloheximide on HFE and Nramp2 mRNA levels in Caco-2 cells. Fully differentiated Caco-2 cells grown microporous membrane inserts were treated with 10 mg/L of cycloheximide in the absence and presence of 50 µmol/L of Fe2-Tf. After 24 h incubation, total RNA was isolated and HFE (A) and Nramp2 (B) mRNAs were assessed by RT-PCR. Values for HFE and Nramp2 are normalized to GAPDH mRNA levels and are expressed relative to the value of the non-treated control samples (Relative value = 100%). Bars represent the mean ± se from 3-4 independent experiments, *P < 0.05 compared to control. CHX = cycloheximide.
![]()
DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References
).
) and human placenta (Parkkila et al. 1997a
), and mutation of HFE (C282Y) eliminates the binding of HFE to TfR (Feder et al. 1998
). Lebron et al. (1998)
demonstrated that the binding ratio for HFE to TfR (1:2) is different from the binding ratio for transferrin to TfR (2:2) and that HFE and Fe-transferrin can bind simultaneously to TfR to form a ternary complex (Lebron et al. 1998
). However, the mechanism whereby a defective association of HFE with TfR (or transferrin-TfR) prevents appropriate homeostatic adjustments of intestinal iron absorption in hemochromatosis patients is unknown. Because it has been reported that the accumulation of transferrin from plasma is remarkably decreased in intestinal cells in patients with hereditary hemochromatosis, which may indicate a defective transferrin-bound iron uptake (Pietrangelo et al. 1995
, Skikne et al. 1995
, Whittaker et al. 1989
), one possible speculation is that the association of HFE with TfR (or transferrin-TfR) might be involved with normal transferrin-TfR trafficking into the cell. Gross et al. (1998)
confirmed and extended the previous findings (Feder et al. 1998
, Parkkila et al. 1997a
) that, in addition to the association of HFE with TfR, the HFE and TfR complex is also endocytosed into a transferrin-positive cellular compartment. Furthermore, the over-expression of HFE protein in HeLa cells resulted in a decrease of cellular iron status indicating that HFE levels can modulate cellular iron status.
that HFE was found in abundance in proliferating human crypt cells in the intestine.
). Gunshin et al. (1997)
reported that DCT1, the rat Nramp2 homologue, expresses an mRNA containing a 3' iron-responsive element (IRE) stem-loop motif like that observed in TfR mRNA. The expression of TfR protein by iron is controlled by an iron regulatory protein (IRP) (Klausner et al. 1993). IRP modulates translation of TfR mRNA by binding to the 3' end of the TfR mRNA and thereby conferring increased mRNA stability (Klausner et al. 1993). Recently, Gunshin et al (1998) reported evidence that both IRP1 and IRP2 bind to a 3'UT stem-loop in the DCT1 mRNA. We also found that human Nramp2 cDNA (GenBank #L37347) contains an IRE consensus sequence (Klausner et al. 1993), which could form a stem-loop motif in its 3' untranslated region of the mRNA (AGCCAUCAGAGCCAGUGUGUUUCUAUGGUU:1552bp-1581bp). Thus, treatment with iron or inhibitors of protein synthesis could result in a reduction of IRP activity level and reduce IRP binding to the 3' stem-loop motif of Nramp2 mRNA. As a result, Nramp2 mRNA would be destabilized, and the level of mRNA would fall. Recently, Lee et al. (1998)
reported that Nramp2 has two alternate splice forms, one with IRE and the other without IRE at the 3'-untranslated region of Nramp2 mRNA. The relative amount of Nramp2 IRE form to Nramp2 non-IRE form varies in different human tissues. Whereas tissues of the brain and intestine have high ratios of the IRE to non-IRE form, spleen, thymus and pancreas have low ratio of the IRE to non-IRE form. It is not clear whether the Nramp2 non-IRE form mRNA as well as the Nramp2 IRE form mRNA is also regulated by iron at the level of mRNA stabilization. If only the Nramp2 IRE form responds to iron, the ratio of the IRE form to non-IRE form will be a very important factor determining the modulation of total Nramp2 mRNA levels by iron in various tissues.
). Moreover, the over-expression of Nramp2 was shown to stimulate iron uptake in transfected human embryonic kidney cells (HEK 293T) (Fleming et al. 1998
, Su et al. 1998
). These observations support the previous findings (Gunshin et al. 1997
) that when DCT1, the rat homologue of Nramp2, was expressed in Xenopus oocytes, iron uptake was stimulated. However, when a glycine is changed to arginine or other amino acids at amino acid 185 in mouse Nramp2, Nramp2 loses its iron transport function (Fleming et al. 1998
, Su et al. 1998
). Moreover, Belgrade (b/b) rats and mk mice both have an impaired intestinal iron transport because of the Gly185Arg mutation in Nramp2 (Fleming et al. 1998
, Fleming et al. 1997
). The b rats also have a defect in the transferrin cycle in erythroid cells as well as defective intestinal iron transport. Thus, it is likely that Nramp2 functions to mobilize iron from transferrin in endosomes as well as transfer iron across the apical brush border membrane of enterocyte (Wood and Han 1998
). Nramp2 is also involved in the transport of other divalent cations. When the rat homologue of Nramp2 is expressed in Xenopus oocytes, it transports a range of cationic metals, including cobalt, copper and zinc as well as iron (Gunshin et al. 1997
). Thus, the altered expression of Nramp2 mRNA by iron, as demonstrated here in Caco-2 cells, suggests that iron status may also influence the intestinal absorption of other divalent cations (Flanagan et al. 1980
) by modulating the level of intestinal Nramp2.
, Zhou et al. 1998
) and the proposed function of Nramp2 as an intestinal iron transporter that is up-regulated by iron deficiency (Fleming et al. 1997
, Gunshin et al. 1997
). Second, the regulation of both HFE and Nramp2 mRNAs by divalent metals appears to be specific for iron. Finally, the super-induction of HFE mRNA in the presence of cycloheximide suggests that HFE gene expression, like other MHC class I genes (Weissman and Singer 1991
), may be regulated by a short-lived repressor protein whose activity may be modulated by iron, whereas Nramp2 mRNA levels are likely modulated by IRP.
| |
FOOTNOTES |
|---|
Manuscript received 16 July 1998. Initial reviews completed 1 September 1998. Revision accepted 4 November 1998.
| |
LITERATURE CITED |
|---|
|
|
|---|
2-microglobulin interaction and cell surface expression.
J. Biol. Chem.
1997;
272:14025-14028
2 knockout mice develop parenchymal iron overload: a putative role for class I genes of the major histocompatibility complex in iron metabolism.
Proc. Natl. Acad. Sci. USA
1996;
93:1529-1534
2-microglobulin knockout mice recapitulates hereditary hemochromatosis in man.
J. Exp. Med.
1996;
184:1975-1985This article has been cited by other articles:
![]() |
E.-Y. Kim, S.-K. Ham, M. K. Shigenaga, and O. Han Bioactive Dietary Polyphenolic Compounds Reduce Nonheme Iron Transport across Human Intestinal Cell Monolayers J. Nutr., September 1, 2008; 138(9): 1647 - 1651. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Fleming and R. S. Britton Iron Imports. VI. HFE and regulation of intestinal iron absorption Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G590 - G594. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, Y. Wu, J. G. Stonehuerner, L. A. Dailey, J. D. Richards, I. Jaspers, C. A. Piantadosi, and A. J. Ghio Oxidant Generation Promotes Iron Sequestration in BEAS-2B Cells Exposed to Asbestos Am. J. Respir. Cell Mol. Biol., March 1, 2006; 34(3): 286 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
K N Millard, D M Frazer, S J Wilkins, and G J Anderson Changes in the expression of intestinal iron transport and hepatic regulatory molecules explain the enhanced iron absorption associated with pregnancy in the rat Gut, May 1, 2004; 53(5): 655 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Serfass and M. B. Reddy Breast Milk Fractions Solubilize Fe(III) and Enhance Iron Flux across Caco-2 Cells J. Nutr., February 1, 2003; 133(2): 449 - 455. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Follett, Y. A. Suzuki, and B. Lonnerdal High specific activity heme-Fe and its application for studying heme-Fe metabolism in Caco-2 cell monolayers Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1125 - G1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Ajioka, J. E. Levy, N. C. Andrews, and J. P. Kushner Regulation of iron absorption in Hfe mutant mice Blood, July 30, 2002; 100(4): 1465 - 1469. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, A. J. Ghio, F. Yang, K. G. Dolan, M. D. Garrick, and C. A. Piantadosi Iron uptake and Nramp2/DMT1/DCT1 in human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, May 1, 2002; 282(5): L987 - L995. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Thomas and P. S. Oates IEC-6 Cells Are an Appropriate Model of Intestinal Iron Absorption in Rats J. Nutr., April 1, 2002; 132(4): 680 - 687. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Martini, L. Tchack, and R. J. Wood Iron Treatment Downregulates DMT1 and IREG1 mRNA Expression in Caco-2 Cells J. Nutr., April 1, 2002; 132(4): 693 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Han and M. Wessling-Resnick Copper repletion enhances apical iron uptake and transepithelial iron transport by Caco-2 cells Am J Physiol Gastrointest Liver Physiol, March 1, 2002; 282(3): G527 - G533. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Wardrop, C. Wells, T. Ravasi, D. A. Hume, and D. R. Richardson Induction of Nramp2 in activated mouse macrophages is dissociated from regulation of the Nramp1, classical inflammatory genes, and genes involved in iron metabolism J. Leukoc. Biol., January 1, 2002; 71(1): 99 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Wood and T. Tamura Methodological Issues in Assessing Bioavailability of Nutrients and Other Bioactive Substances in Dietary Supplements: Summary of Workshop Discussion J. Nutr., April 1, 2001; 131(4): 1396S - 1398. [Full Text] |
||||
![]() |
W. Griffiths and T. Cox Haemochromatosis: novel gene discovery and the molecular pathophysiology of iron metabolism Hum. Mol. Genet., October 1, 2000; 9(16): 2377 - 2382. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Beard Iron treatment and human intestinal Caco-2 cells Am. J. Clinical Nutrition, September 1, 2000; 72(3): 677 - 678. [Full Text] [PDF] |
||||
![]() |
J. Tallkvist, C. L Bowlus, and B. Lonnerdal Functional and molecular responses of human intestinal Caco-2 cells to iron treatment Am. J. Clinical Nutrition, September 1, 2000; 72(3): 770 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.J.H. Griffiths, A.L. Kelly, S.J. Smith, and T.M. Cox Localization of iron transport and regulatory proteins in human cells QJM, September 1, 2000; 93(9): 575 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tandy, M. Williams, A. Leggett, M. Lopez-Jimenez, M. Dedes, B. Ramesh, S. K. Srai, and P. Sharp Nramp2 Expression Is Associated with pH-dependent Iron Uptake across the Apical Membrane of Human Intestinal Caco-2 Cells J. Biol. Chem., January 14, 2000; 275(2): 1023 - 1029. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||