Journal of Nutrition

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, S. R.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, S. R.
Right arrow Articles by Cousins, R. J.

The Journal of Nutrition Vol. 128 No. 5 May 1998, pp. 825-831

Metallothionein Knockout and Transgenic Mice Exhibit Altered Intestinal Processing of Zinc with Uniform Zinc-Dependent Zinc Transporter-1 Expression1,2

Steven R. Davis, Robert J. McMahon, and Robert J. Cousins3

Food Science and Human Nutrition Department and Center for Nutritional Sciences, University of Florida, Gainesville, FL 32611

    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

A role for metallothionein in intestinal zinc absorption has been the subject of considerable debate. If metallothionein affects zinc absorption, then those factors that induce metallothionein synthesis (e.g., heavy metals, hormones) should alter zinc absorption and homeostasis. The present studies used metallothionein transgenic mice (overexpressing) and metallothionein knockout mice (no expression of metallothionein-1 or metallothionein-2) to examine directly the effects of metallothionein on zinc absorption, independent of secondary effects that could be caused by metallothionein inducers. Zinc absorption was examined by administering a single oral zinc dose (0.5 mmol/kg) by feeding tube to metallothionein transgenic and metallothionein knockout mice and measuring the serum zinc concentration. Two hours after the dose, the serum zinc concentration was 2.3 times higher in metallothionein knockout mice than in their control strain. Conversely, the concentration was elevated only one third as much in the metallothionein transgenic mice as in their controls after the zinc dose. We found that the serum zinc concentration was inversely related to the level of metallothionein protein. The intestinal zinc content was higher in the metallothionein knockout mice, however, suggesting that metallothionein did not reduce zinc absorption by simply sequestering zinc in the mucosa. The expression of the zinc transporter ZnT-1 was directly related to the serum zinc level and was independent of the level of metallothionein. These results further support metallothionein as an important component for reducing the efficiency of zinc absorption at elevated zinc intakes.

KEY WORDS: zinc absorption · metallothionein transgenic mice · metallothionein knockout mice · zinc transporter-1 · mice

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

The mechanisms that regulate zinc metabolism are not understood. When dietary zinc intake is restricted in both experimental animals and humans, the efficiency of zinc absorption increases and endogenous zinc excretion decreases. Furthermore, zinc absorption is depressed after ingestion of zinc-rich diets. The biomolecules that mediate the regulation of zinc metabolism by the dietary zinc supply have not been fully described. The cytosolic protein metallothionein (MT)4 may be a principal participant in this regulation. Metallothioneins are low molecular weight (6-7 kDa) heavy metal-binding proteins of high cysteine content (~33%) that can bind 7 atoms of zinc per molecule of protein (Dunn et al. 1987). Metallothionein-1 and metallothionein-2 are the metallothionein isoforms that are most highly expressed in pancreas, kidney, liver and intestine. This metalloprotein is inducible by many factors (stimuli) and may act as a Zn pool or buffer that is influenced by body zinc levels. In addition, the redistribution of endogenous zinc associated with stresses such as acute infection and physical trauma may require metallothionein. The induction is believed to involve interleukin-1, interleukin-6, and glucocorticoid hormone-mediated changes, all of which can be linked to elevated expression of metallothionein in liver and other tissues (reviewed in Cousins 1989 and 1996).

Two strains of mice have been developed that allow direct examination of metallothionein's role in zinc metabolism. Transgenic mice that have ~55 additional copies of the metallothionein-1 gene in their genome (TG mice) provide a model to study the effects of metallothionein overexpression on zinc metabolism (Palmiter et al. 1993). TG mice have elevated metallothionein protein in many tissues, including liver and intestine (Iszard et al. 1995, Liu and Klaassen 1996). The greater cytosolic metallothionein pools may convey protection against zinc deficiency (Dalton et al. 1996). Conversely, mice that lack functional expression of metallothionein (KO mice) as a result of gene disruption allow examination of how zinc metabolism differs when no metallothionein is produced (Masters et al. 1994, Michalska and Choo 1993). Delayed renal development and greater sensitivity to zinc and cadmium toxicity are characteristic of these mice (Kelly et al. 1996, Masters et al. 1994). Alterations in hepatic zinc metabolism include the inability of KO mice to sequester zinc in the liver after injections of zinc or lipopolysaccharide (Coyle et al. 1995, Philcox et al. 1995). Further, hepatocytes from KO mice were incapable of accumulating zinc in response to interleukin-6 or dexamethasone treatment. Hence, significant perturbations of zinc metabolism occur in mice with altered metallothionein expression. However, nothing is known about intestinal zinc absorption in these mice.

The intestine is a major control site for zinc homeostasis and is also a major metallothionein-expressing organ (Cousins 1989). Although some data support an inverse relationship between intestinal metallothionein expression and zinc absorption (Hoadley et al. 1987 and 1988, Menard et al. 1981, Smith and Cousins 1980), other data do not (Flanagan et al. 1983, Starcher et al. 1980). To examine how metallothionein influences the intestinal processing of zinc, a zinc dose was delivered by gavage (zinc tolerance test), and the increase in the serum zinc concentration was used as a measure of absorption.

Other obvious candidates for proteins that play a role in regulating zinc metabolism would be various metal transporters. Recently, a family of mammalian zinc tranporters have been cloned, called ZnT-1, -2, and -3 (Huang and Gitschier 1997 Palmiter and Findley 1995, Palmiter et al. 1996a and 1996b); these were recently reviewed (McMahon and Cousins 1998). Among these, only ZnT-1 has a wide pattern of tissue expression, suggesting an important global role in zinc homeostasis. ZnT-1 is an integral membrane protein now known to be a member of a growing family of such transporters called CDF, specifying cation diffusion facilitation (Paulsen and Saier 1997). ZnT-1 in particular was isolated on the basis of its ability to confer to transfected cells resistance to high levels of extracellular zinc. With this and other evidence, it has been hypothesized that ZnT-1 functions as a zinc exporter. The regulation of ZnT-1 by metals has not been previously measured directly. In this report, we examine whether ZnT-1 expression, acting in concert with metallothionein or independently, is responsive to changes in zinc intake and thus could play a role in maintaining zinc homeostasis. The results of these experiments support the hypothesis that metallothionein influences zinc metabolism at elevated zinc intakes, but there is also an increase in ZnT-1 expression in response to elevated zinc intake.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Animals.  The founder mice used in this study were obtained from The Jackson Laboratory, Bar Harbor, ME. The transgenic mice (designated TG mice) were derived from the C57BL/6 strain crossed with the SJL strain (Palmiter et al. 1993). The metallothionein knockout mice (designated KO mice) were derived from the 129/SvCPJ strain crossed with C57BL/6 (Masters et al. 1994). Mice of the appropriate background strains served as controls, designated CTG and CKO, respectively. Only adult male mice were used for experiments. They were housed in plastic cages with wood shavings as bedding and with a 12-h light:dark cycle. The mice had free access to a commercial diet (Laboratory Rodent Diet No. 5001, PMI Feeds, New Albany, IN). All experiments were started between 0800 and 1000 h. Care and treatment of the mice received approval of the University of Florida Institutional Animal Care and Use Committee.

Radioisotopes.  alpha 32P-dCTP was from Du Pont NEN (Boston, MA), and 109Cd (1.35 GBq/nmol Cd) was from Isotope Product Laboratories (Burbank, CA).

RNA isolation and Northern analysis.  Total RNA was isolated from intestine and liver using TRIzol reagent (Life Technologies, Gaithersburg, MD). Briefly, 50-100 mg of the proximal duodenum and the liver were homogenized in 2 mL of TRIzol reagent. After addition of chloroform, the RNA was processed and analyzed as described previously (Blanchard and Cousins 1996). Equal quantities of RNA from mice of each group were pooled and subjected to Northern analysis (20 µg total RNA/lane). Equal loading was confirmed by ethidium bromide staining. Northern blot analyses were conducted by using a rat metallothionein-1 cDNA probe (Blanchard and Cousins 1996) or a rat ZnT-1 cDNA probe. These were radiolabeled with alpha 32P-dCTP with the use of the RTS RadPrime DNA Labeling System (Life Technologies) as described previously (Blanchard and Cousins 1996). The metallothionein cDNA probe hybridizes to both the normal metallothionein mRNA and the disrupted mRNA of the KO mice.

The ZnT-1 cDNA probe was generated by reverse transcriptase-polymerase chain reaction (RT-PCR) of rat intestinal RNA. Poly (A)+ RNA was isolated and reverse transcribed by using Superscript II reverse transcriptase (Life Technologies). Primers corresponding to nucleotides 214-235 (GCTGCTGCTGACCTTCATGTTC) and 1618-1639 (GGGACACTGCCTTCAGCTTTAG) of the kidney ZnT-1 sequence (Palmiter and Findley 1995) were used to amplify the intestinal ZnT-1 sequence. A 737-bp sequence was generated from the product by a BstXI/EcoRI digestion and used to probe Northern blots. This cDNA exhibits very low homology to the second and third members of the ZnT family previously published (McMahon and Cousins, 1998). Densitometry of the autoradiographs was performed by scanning the film and measuring the relative intensity using the NIH Image Program, version 1.6 (National Institutes of Health).

High performance chromatography of intestinal cytosol.  In some experiments, the mucosa was homogenized with a Potter Elvehjem tissue grinder by using 2 volumes of ice-cold buffer (S-12 buffer, 154 mmol/L NaCl, 10 mmol/L TrisCl, 3 mmol/L NaN3, and 10 mmol/L MgSO4) plus protease inhibitors (0.1 mmol/L phenylmethylsulfonyl fluoride, 1.2 µmol/L leupeptin and 1.5 µmol/L pepstatin A). After centrifugation at 100,000 × g (30 min), the cytosol fraction was filtered (0.22 µm) and 200 µL was applied to two Superdex 75 chromatography columns (1 × 30 cm; Pharmacia Biotech, Piscataway, NJ) in series by using an isocratic elution of S-12 buffer (Hempe and Cousins 1989).

Zinc oral dosing.  To examine how these genotypes handle an oral load of zinc, mice that had been food deprived overnight were administered 0.5 mmol Zn/kg body weight as ZnSO4 in saline, or saline alone via a stomach tube; mice were killed 2 h later. Blood was obtained by cardiac puncture and serum was prepared for serum zinc analysis. Liver and intestinal zinc concentrations were measured to determine if the zinc dose produced a change in tissue uptake/retention.

Analytical methods and statistical analysis.  109Cd was measured by using a Packard Cobra II gamma spectrometer equipped with a 7.7-cm crystal (Packard, Downers Grove, IL). Metallothionein protein was measured by the cadmium (109Cd) binding assay (Eaton and Toal 1982). Briefly, tissue extracts were boiled, and the resulting supernatant was incubated with 109Cd. After removal of unbound 109Cd by using hemoglobin as a chelator, 109Cd bound to MT was measured by gamma -counting, and converted to moles of MT using the Cd-MT binding stoichiometry of 7:1. Total protein was measured by the method of Lowry et al. (1951). Serum zinc concentrations were measured by flame atomic absorption spectrophotometry (AAS) (Hempe and Cousins 1989). Tissue zinc was also measured by AAS, after sections of liver and intestine were digested with acid (HNO3/H2SO4, 3/1) as described previously (Dunn and Cousins 1989). Data were analyzed by ANOVA followed by the Student-Newman-Keuls multiple comparison test where appropriate (InStat, GraphPad, San Diego, CA). Logarithmic transformation of some data was used to obtain homogenous variances before analysis.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Metallothionein expression in intestine and liver after oral dosing.  Northern analysis of metallothionein mRNA in liver and intestine demonstrated both basal and zinc-induced levels of expression in these genotypes (Fig. 1). All groups expressed metallothionein mRNA, but TG mice had several-fold greater metallothionein expression than either of the control strains in both intestine and liver. Metallothionein mRNA was also expressed in KO mice, but this message contained a premature stop codon and was not translatable. Zinc treatment resulted in induction of metallothionein mRNA in intestine and liver of all mice, but again expression was greatest by far in the TG mice. These data confirmed that KO, controls (CKO and CTG) and TG mice represent groups with distinguishably different basal and zinc-induced metallothionein mRNA levels in both intestine and liver. Consequently, if metallothionein was important in regulating zinc absorption, these groups should have displayed different absorption characteristics.


View larger version (37K):
[in this window]
[in a new window]
 
Fig 1. Northern blot of metallothionein mRNA in metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice were dosed with either saline or 0.5 mmol Zn/kg body weight by gavage, then killed 2 h later. Equal amounts of total RNA were pooled from intestine and liver of 4-5 mice per group and analyzed by Northern analysis by using a metallothionein-1 cDNA probe. Equal loading was verified by ethidium bromide staining. Although some metallothionein mRNA is present in KO mice, it is not translatable and therefore does not give rise to MT protein.

The knockout mutation of KO mice was confirmed by identifying metallothionein protein in size exclusion chromatography fractions of intestinal cytosol (Fig. 2). Metallothionein protein was measured in each 0.5-mL fraction by using the 109Cd binding assay (Eaton and Toal 1982). A large metallothionein peak was seen between 32 and 35 mL in the chromatography profile from TG mice, but none was identifiable in the profile from the KO mice. No peak was seen in profiles from zinc-treated KO mice (data not shown). Therefore, although metallothionein mRNA was produced by KO mice, no protein resulted from that message.


View larger version (29K):
[in this window]
[in a new window]
 
Fig 2. Superdex 75 size exclusion chromatography of metallothionein (MT) in cytosol from intestinal mucosa of metallothionein transgenic (TG) and metallothionein knockout (KO) mice 2 h after an oral dose of saline. Mucosal cytosol was separated by two Superdex 75 columns run in series; 0.5-mL fractions were collected. The metallothionein content of fractions 18 through 40 is expressed as micrograms MT equivalents. Metallothionein elutes between 32 and 35 mL.

Although metallothionein is the predominate 109Cd binding compound in the cytosol, a small but finite amount of 109Cd binding was seen in nearly all other fractions in the profiles of TG and KO mice (Fig. 2). Others have observed the same phenomenon (Liu et al. 1996). Because no 109Cd binding activity was seen in metallothionein-containing fractions in the KO mice profiles, any 109Cd binding activity associated with KO mice cytosol should be considered background. These levels did not increase when zinc treatment was given (data not shown). To better define the metallothionein content of tissues, we deducted the average 109Cd binding value associated with the KO mice cytosol from all groups when measuring metallothionein in the intestinal mucosa (0.1 mg/g protein; 15 nmol/g protein) and liver (10 µg/g liver; 1.5 nmol/g liver). It was clear that the saline-treated controls had little metallothionein protein present in intestinal mucosa (Fig. 3). TG mice, however, had significantly elevated metallothionein levels compared with CTG mice. Zinc treatment significantly increased metallothionein in all but the KO mice group. Again, the induction was greatest in TG mice (eightfold higher than the zinc-treated CTG mice). Overall metallothionein protein was not present in KO mice, was present in CTG and CKO mice only after zinc treatment and was always greatest in TG mice.


View larger version (28K):
[in this window]
[in a new window]
 
Fig 3. Metallothionein content of intestinal mucosa of metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Metallothionein (MT) was measured (mg MT/g mucosal protein) in metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice after an oral dose of either saline or 0.5 mmol Zn/kg body weight. Data are reported as means ± SEM of 4-5 mice/group. Bars labeled with different letters within a graph are significantly different (P < 0.05); 6500 g MT = 1 mol.

Metallothionein was also measured in liver (Fig. 4). Unlike in the intestine, liver metallothionein in saline-treated controls was greater than in KO mice and similar to TG mice. Zinc treatment elevated the mean value of metallothionein fivefold in CTG and tenfold in TG mice livers (P > 0.05), but the increase was significant only in TG mice. No increase in liver metallothionein was seen in CKO mice after zinc treatment. This was not completely unexpected, however, because differences in zinc induction of liver metallothionein have been seen among mouse strains (Farr and Hunt 1989). Hence, each group had a different amount of metallothionein protein present in intestine and liver after zinc treatment. Because metallothionein may provide a zinc storage pool in these organs, the mice with the greatest metallothionein production (TG mice) have a greater capacity to deal with a zinc load than those with the least metallothionein (KO mice).


View larger version (28K):
[in this window]
[in a new window]
 
Fig 4. Metallothionein content of liver in metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Metallothionein (MT) was measured (µg MT/g liver) in metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice 2 h after an oral dose of either saline or 0.5 mmol Zn/kg body weight. Data are reported as means ± SEM of 4 mice/group. TG and CTG data was log10 transformed before statistical analysis to achieve homogeneous variances. Bars labeled with different letters within a graph are significantly different (P < 0.05); 6500 g MT = 1 mol.

Intestine, liver and serum zinc responses 2 h after the oral zinc dose.  Although metallothionein in intestine and liver differed among groups, these differences were not correlated to detectable differences in intestine and liver zinc concentrations (data not shown). When saline was given, all mice had roughly equivalent zinc concentrations in both intestine and liver (0.48-0.62 and 0.37-0.59 µmol Zn/g, respectively). No significant elevation of liver zinc was seen after zinc treatment. All groups had significantly elevated zinc concentrations in intestine after zinc treatment, but there were no significant differences among the zinc-treated groups except in the KO group. In the KO mice, zinc treatment increased the intestinal zinc concentration significantly compared with the zinc-treated CKO mice (1.37 ± 0.22 vs. 0.86 ± 0.11 µmol Zn/g, respectively; P < 0.05). In contrast, the intestinal zinc concentration in zinc-treated CTG and TG mice was similar (0.97 ± 0.18 and 1.03 ± 0.18 µmol Zn/g, respectively). Hence, the absence of metallothionein resulted in a detectable increase in zinc accumulation in intestine. However, overexpression in the TG mice did not influence intestinal zinc retention. This suggests that metallothionein does not alter zinc metabolism simply by sequestering zinc in the intestine.

The change in serum zinc concentration 2 h after the oral zinc dose was considered a measure of zinc absorption (Fig. 5). In contrast to tissue zinc, serum zinc was markedly affected by metallothionein expression. Although all groups had similar serum zinc concentrations when given saline (15-30 µmol/L), mice with greater metallothionein expression had lower concentrations after zinc treatment than mice with less metallothionein expression. Zinc-treated control strains had serum zinc concentrations 4-5 times higher than those of saline-treated controls. KO mice, however, had 10-fold greater serum zinc values after zinc treatment. Conversely, TG mice had only 2.3-fold greater serum zinc concentrations after zinc treatment. Thus, overexpression of metallothionein in the intestine reduced the elevation of serum zinc in response to zinc treatment by one half, whereas lack of metallothionein expression was related to a doubling of the concentration compared with controls. Serum zinc concentrations were inversely proportional to the amount of metallothionein expressed. This relationship is illustrated in Figure 6. The serum zinc concentrations (y) of individual mice from the four different groups were plotted against the corresponding intestinal metallothionein values (x). The relationship can be described as follows: y = 1.6e-0.02x (r2 = 0.85).


View larger version (28K):
[in this window]
[in a new window]
 
Fig 5. Serum zinc in metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Zinc was measured (µmol Zn/L) in metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice 2 h after an oral dose of either saline or 0.5 mmol Zn/kg body weight. Data are reported as means ± SEM of 4 mice/group. Bars labeled with different letters within a graph are significantly different (P < 0.05).


View larger version (21K):
[in this window]
[in a new window]
 
Fig 6. Serum zinc concentration as a function of intestinal metallothionein content in zinc-treated mice. Response of serum zinc, µmol Zn/L (y), vs. intestinal metallothionein content, mg MT/g mucosal protein (x), in metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice 2 h after gavage with 0.5 mmol Zn/kg body weight. The relationship can be described as y = 1.6e-0.02x (r2 = 0.85).

Zinc transporter-1 expression 2 h after the oral zinc dose.  The rat sequence for intestinal ZnT-1 was used to probe mouse liver and intestinal RNA. In response to the oral zinc dose, the level of ZnT-1 mRNA was upregulated four- to fivefold in the intestine (Fig. 7). In the liver, the oral zinc dose produced a two- to four-fold elevation in ZnT-1 mRNA (Fig. 8). Interestingly, there was not a significant difference in the magnitude of the ZnT-1 upregulation in the TG or KO strains compared with their respective control strains. This indicates that the amount of ZnT-1 upregulation was independent of the level of metallothionein protein present in each genotype.


View larger version (32K):
[in this window]
[in a new window]
 
Fig 7. Upregulation of intestinal ZnT-1 mRNA in metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice were dosed with either saline or 0.5 mmol Zn/kg body weight by gavage, then killed 2 h later. Panel A: Northern blot of ZnT-1. Equal amounts of total RNA from intestine were pooled from 4-5 mice per group and analyzed by Northern analysis by using a ZnT-1 cDNA probe. Equal loading was verified by ethidium bromide staining. Panel B: densitometry of the Northern blot. The autoradiograph was scanned and the relative intensity of the ZnT-1 bands was measured. Data are reported as means ± SD of 4-5 mice/group. Bars labeled with different letters within a graph are significantly different (P < 0.05).


View larger version (28K):
[in this window]
[in a new window]
 
Fig 8. Upregulation of liver ZnT-1 mRNA in metallothionein transgenic and metallothionein knockout mice after an oral zinc dose. Metallothionein transgenic (TG), TG control (CTG), metallothionein knockout (KO) and KO control (CKO) mice were dosed with either saline or 0.5 mmol Zn/kg body weight by gavage, then killed 2 h later. Panel A: Northern blot of ZnT-1. Equal amounts of total RNA from liver were pooled from 4-5 mice per group and analyzed by Northern analysis using a ZnT-1 cDNA probe. Equal loading was verified by ethidium bromide staining. Panel B: densitometry of the Northern blot. The autoradiograph was scanned and the relative intensity of the ZnT-1 bands was measured. Data are reported as means ± SD of 4-5 mice/group. Bars labeled with different letters within a graph are significantly different (P < 0.05).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Our hypothesis was that intestinal metallothionein acts as a negative regulator of zinc absorption. This relationship has been examined in the past, but with conflicting results. For instance, our laboratory (Hoadley et al. 1987, Menard et al. 1981, Smith et al. 1978, Smith and Cousins 1980) found that the quantity of zinc absorbed by the isolated perfused rat intestine was inversely related to the zinc content of the diet consumed before the experiments. In addition, giving rats a large intraperitoneal zinc dose 18 h before the experiments depressed zinc absorption. Because zinc absorption was inversely proportional to intestinal metallothionein throughout those experiments, it was proposed that metallothionein serves as a damper of zinc absorption. Similarly, studies in which rats consumed diets ranging from 5 to 80 mg Zn/kg also showed that zinc absorption was inversely related to metallothionein-bound zinc (Coppen and Davies 1987). Furthermore, Hoadley et al. (1988) found that elevated metallothionein levels in intestines of food-deprived rats were associated with greater mucosa-to-lumen transfer of absorbed zinc by the isolated perfused rat intestine. They proposed that metallothionein may depress zinc absorption by providing a sink that holds zinc in the intestine, allowing more opportunity for transfer of zinc back into the lumen.

Contrary to the results cited above, other studies found no relationship or positive correlation between intestinal metallothionein and zinc absorption. For example, bacterial infection, endotoxemia and interleukin-1 administration to rats all elevated liver metallothionein and resulted in 50-100% greater zinc absorption and liver zinc accumulation from 65Zn doses (Kincaid et al. 1976, Pekarek and Evans 1975 and 1976). Intestinal metallothionein expression was not evaluated in those experiments, but endotoxin has been shown to induce both metallothionein-1 and metallothionein-2 in mouse intestine (De et al. 1990). Also, interleukin-1 is thought to be a mediator of metallothionein induction by LPS in some tissues, and thus may induce the protein in the intestine as well (reviewed in Cousins 1996). Furthermore, small intraperitoneal zinc doses (0.2 µmol/kg body weight) caused metallothionein induction in the mouse intestine and corresponded to enhanced zinc absorption 18 h later (Starcher et al. 1980). Flanagan and co-workers (1983) observed no difference in zinc uptake or absorption in relation to intestinal metallothionein in intestinal perfusion experiments with mice. They did, however, see greater zinc absorption in zinc-deficient vs. control mice when doses of zinc were delivered by gavage. They also demonstrated that differences exist in zinc absorption characteristics between rats and mice, particularly the response of increased absorption during zinc deficiency.

Although the studies cited above focused on the effect of metallothionein on zinc absorption, the methods used to alter intestinal metallothionein levels varied. Treatments used to induce the protein included intraperitoneal, intragastric and dietary doses of zinc, fasting, bacterial infection, lipopolysaccharide and interleukin-1 administration, and various forms of physical stress. Although these treatments manipulate metallothionein expression, each has effects not related to this protein that may cause physiologic changes and complicate interpretation of the results. Utilizing knockout and transgenic mice models, it is possible to focus on zinc absorption as directly related to metallothionein expression.

Giving animals a large oral dose of zinc by gavage, we were able to determine the effects of metallothionein induction on zinc absorption by measuring serum and tissue zinc concentrations. This avoids the potential for isotope dilution, which can cloud interpretation of radioisotopic tracer studies using 65Zn. We have used the oral dosing approach previously (Menard et al. 1981). It is equivalent to the zinc tolerance test used with humans (Sullivan et al. 1979). We used fasting and dosing in saline to prevent nonspecific binding of zinc to food in the gut and to allow for a maximal gastric emptying rate. The 2-h time point used was determined to be the time point of maximal serum zinc response in these mouse strains (data not shown), and agrees with data from rats (Menard et al. 1981) and humans (Sullivan et al. 1979, Valberg et al. 1985). Further, all dosing was done between 0800 and 1000 h. The 0.5 mmol/kg dose given is 2.5-3.1 times greater than the typical dietary zinc intake of these mice (0.17-0.22 mmol/kg body weight). Although greater than the typical intake, this dose is attainable through the diet and is therefore nutritionally relevant. Further, because the dose produced five- to tenfold increases in serum zinc, we anticipate that smaller doses will also result in significant, albeit smaller differences. Menard et al. (1981) showed that intestinal metallothionein synthesis in rats was increased by 3 h after an oral zinc dose was given. Furthermore, this induction of synthesis was correlated with the ability to regulate serum zinc concentrations after a second dose of zinc was introduced by the same route. In these experiments, serum zinc doubled in TG mice and increased 10-fold in KO mice when zinc was delivered by gavage. We attribute the inability of the KO mice to handle the zinc load compared with the TG mice to the difference in metallothionein expression. Specifically, the TG mice controlled serum zinc concentrations more tightly than did the KO mice. Serum zinc concentrations remain elevated for a considerable time after the oral dose. Consequently, it is unlikely that the observed differences are related to different kinetics of absorption in these genotypes.

A drawback of this approach is that the role of other tissues in the clearance of zinc from the circulation cannot be accounted for. Because the gene addition in TG mice and gene deletion in KO mice are not tissue specific, we cannot rule out the possibility that MT expression in some other tissue affected zinc clearance from the serum. However, we did measure the zinc content of the liver, the main zinc storage organ and the key organ in the regulation of zinc metabolism (Cousins 1996, Coyle et al. 1995). In this study, no change in liver zinc was detected between saline- or zinc-treated mice, and no difference was seen among groups of zinc-treated mice. This is in agreement with data collected in rats, where hepatic accumulation of gavaged zinc was not observed until 9 h after dosing (McCormick et al. 1981). Because the liver can act rapidly to regulate zinc metabolism, yet did not show an elevation in zinc concentration, it is unlikely that an organ with less influence on zinc metabolism caused the differences seen in serum zinc.

Absorption of zinc requires the involvement of various transporters (Reyes 1996) to facilitate uptake by and efflux from enterocytes; interaction with specific intracellular ligands and perhaps vesicular compartments may be important in this process. We demonstrate for the first time direct regulation of the ZnT-1 gene by zinc in mouse intestine and liver. This suggests that, in intact animals, ZnT-1 might play an important role in the homeostasis of intracellular zinc. The marked upregulation of ZnT-1 mRNA in response to the oral zinc dose was similar in magnitude and direction to metallothionein. Interestingly, however, we also observed that the magnitude of the upregulation of ZnT-1 mRNA was similar despite the widely different levels of metallothionein present in these genotypes. This suggests that, although it appears that both metallothionein and ZnT-1 play a role in zinc homeostasis under a high zinc load, they are not directly linked and may be parts of a larger regulatory mechanism.

Within intestinal cells, higher intakes of zinc may be processed via a mechanism that involves metallothionein. Because elevated intestinal metallothionein levels were not associated with greater intestinal zinc accumulation, metallothionein does not seem to act simply as a zinc sequestrant. ZnT-1 may contribute to maintaining constant tissue zinc levels despite marked differences in luminal zinc concentrations by a mechanism sensitive to zinc intake. Metallothionein may act as a zinc pool from which zinc is highly available for transport back to the lumen, as suggested by Hoadley et al. (1988). Without metallothionein, the KO mice may be unable to maintain a satisfactory mucosa-to-lumen zinc flux. This might explain why KO mice have elevated zinc levels in serum and intestine. Because zinc supplementation upregulates metallothionein mRNA levels in humans (Sullivan and Cousins 1997), we expect that this metalloprotein would have an effect on zinc absorption by the human intestine.

    FOOTNOTES
1   Supported by research grant DK31127 (R.J.C.), individual NRSA DK09628 (R.J.M.), and institutional NRSA DK07667 (S.R.D.) from the National Institute of Diabetes and Digestive and Kidney Diseases, and Boston Family Endowment Funds of the University of Florida.
2   The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
3   To whom correspondence should be addressed.
4   Abbreviations used: AAS, atomic absorption spectrophotometry; CKO, KO controls; CTG, TG controls; KO mice, metallothionein knockout mice; MT, metallothionein; TG mice, metallothionein transgenic mice; ZnT-1, zinc transporter-1.

Manuscript received 21 October 1997. Initial reviews completed 2 December 1997. Revision accepted 8 January 1998.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

0022-3166/98 $3.00 ©1998 American Society for Nutritional Sciences



This article has been cited by other articles:


Home page
Poult. Sci.Home page
Y. Yu, L. Lu, X. G. Luo, and B. Liu
Kinetics of Zinc Absorption by In Situ Ligated Intestinal Loops of Broilers Involved in Zinc Transporters
Poult. Sci., June 1, 2008; 87(6): 1146 - 1155.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Cousins, J. P. Liuzzi, and L. A. Lichten
Mammalian Zinc Transport, Trafficking, and Signals
J. Biol. Chem., August 25, 2006; 281(34): 24085 - 24089.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. P. Liuzzi, J. A. Bobo, L. A. Lichten, D. A. Samuelson, and R. J. Cousins
Responsive transporter genes within the murine intestinal-pancreatic axis form a basis of zinc homeostasis
PNAS, October 5, 2004; 101(40): 14355 - 14360.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Chimienti, S. Devergnas, A. Favier, and M. Seve
Identification and Cloning of a {beta}-Cell-Specific Zinc Transporter, ZnT-8, Localized Into Insulin Secretory Granules
Diabetes, September 1, 2004; 53(9): 2330 - 2337.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. J. Cousins, R. K. Blanchard, J. B. Moore, L. Cui, C. L. Green, J. P. Liuzzi, J. Cao, and J. A. Bobo
Regulation of Zinc Metabolism and Genomic Outcomes
J. Nutr., May 1, 2003; 133(5): 1521S - 1526.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
D. K. Lee, J. Geiser, J. Dufner-Beattie, and G. K. Andrews
Pancreatic Metallothionein-I May Play a Role in Zinc Homeostasis during Maternal Dietary Zinc Deficiency in Mice
J. Nutr., January 1, 2003; 133(1): 45 - 50.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Z. Zhou, X. Sun, J. C. Lambert, J. T. Saari, and Y. J. Kang
Metallothionein-Independent Zinc Protection from Alcoholic Liver Injury
Am. J. Pathol., June 1, 2002; 160(6): 2267 - 2274.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. B. Moore, R. K. Blanchard, W. T. McCormack, and R. J. Cousins
cDNA Array Analysis Identifies Thymic LCK as Upregulated in Moderate Murine Zinc Deficiency before T-Lymphocyte Population Changes
J. Nutr., December 1, 2001; 131(12): 3189 - 3196.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. R. Davis, D. A. Samuelson, and R. J. Cousins
Metallothionein Expression Protects against Carbon Tetrachloride-Induced Hepatotoxicity, but Overexpression and Dietary Zinc Supplementation Provide No Further Protection in Metallothionein Transgenic and Knockout Mice
J. Nutr., February 1, 2001; 131(2): 215 - 222.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
S. R. Davis and R. J. Cousins
Metallothionein Expression in Animals: A Physiological Perspective on Function
J. Nutr., May 1, 2000; 130(5): 1085 - 1088.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
N. F. Krebs
Overview of Zinc Absorption and Excretion in the Human Gastrointestinal Tract
J. Nutr., May 1, 2000; 130(5): 1374S - 1377.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
R. J. Cousins and R. J. McMahon
Integrative Aspects of Zinc Transporters
J. Nutr., May 1, 2000; 130(5): 1384S - 1387.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
P. Coyle, J. C. Philcox, and A. M. Rofe
Zn-Depleted Mice Absorb More of an Intragastric Zn Solution by a Metallothionein-Enhanced Process Than Do Zn-Replete Mice
J. Nutr., April 1, 2000; 130(4): 835 - 842.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
G. K. Andrews and J. Geiser
Expression of the Mouse Metallothionein-I and -II Genes Provides a Reproductive Advantage during Maternal Dietary Zinc Deficiency
J. Nutr., September 1, 1999; 129(9): 1643 - 1648.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
P. Coyle, J. C. Philcox, and A. M. Rofe
Metallothionein-Null Mice Absorb Less Zn from an Egg-White Diet, but a Similar Amount from Solutions, although with Altered Intertissue Zn Distribution
J. Nutr., February 1, 1999; 129(2): 372 - 379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Moltedo, C. Verde, A. Capasso, E. Parisi, P. Remondelli, S. Bonatti, X. Alvarez-Hernandez, J. Glass, C. G. Alvino, and A. Leone
Zinc Transport and Metallothionein Secretion in the Intestinal Human Cell Line Caco-2
J. Biol. Chem., October 6, 2000; 275(41): 31819 - 31825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Langmade, R. Ravindra, P. J. Daniels, and G. K. Andrews
The Transcription Factor MTF-1 Mediates Metal Regulation of the Mouse ZnT1 Gene
J. Biol. Chem., October 27, 2000; 275(44): 34803 - 34809.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, S. R.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, S. R.
Right arrow Articles by Cousins, R. J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 1998 by American Society for Nutrition