The Journal of Nutrition Vol. 128 No. 2 February 1998, pp. 297S-299S

Antimicrobial Peptide Expression Is Developmentally Regulated in the Ovine Gastrointestinal Tract^1,2

Kenneth M. Huttner³, Donna J. Brezinski-Caliguri, Megan M. Mahoney, and Gill Diamond^*

Joint Program in Neonatology, Children's Hospital, Boston, MA 02115 and ^* Department of Anatomy, Cell Biology and Injury Sciences, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, Newark, NJ 07103

	ABSTRACT

Abstract Introduction Methods Results Discussion References

Antimicrobial peptides are abundant components of the innate immune system present in species throughout the plant and animal kingdoms. In mammals, these immune peptides have been localized to epithelial tissues of the pig, mouse, rat, cow and human gastrointestinal tracts. We have identified in sheep two members of the -defensin antimicrobial peptide gene family that are expressed in a unique pattern throughout the gastrointestinal tract. Sheep -defensin 1 mRNA is the most prevalent from tongue to colon with the exception of the distal ileum, where -defensin 2 mRNA predominates. Sheep -defensin expression varies significantly between animals and is developmentally regulated both pre- and postnatally. These changes in antimicrobial peptide expression may correlate with anatomical differentiation as well as physiologic adaptations to extra-uterine life.

	INTRODUCTION

Abstract Introduction Methods Results Discussion References

Antimicrobial peptides are an abundant and varied class of microbicidal agents isolated from species throughout the plant and animal kingdoms (Boman 1995, Boman et al. 1994). They demonstrate broad-spectrum antimicrobial activity and are expressed at epithelial surfaces and in circulating professional phagocytic cells. Some are synthesized constitutively at high levels [mouse distal ileum (Ouellette and Cordell 1988) and human granulocytes (Ganz et al. 1985)], and others are expressed at low levels but up-regulated by barrier compromise [cecropia larva (Gudmundsson et al. 1991, Steiner et al. 1981)] or inflammation [bovine trachea (Diamond et al. 1996)].

Mammalian species synthesize a number of different antimicrobial peptides, with the best studied being the cysteine-rich defensins (Ganz and Lehrer 1994). As one example, cattle express at least 15 different -defensin genes, including two found in epithelial tissues (Diamond et al. 1991, Schonwetter et al. 1995, Selsted et al. 1993). Tracheal antimicrobial peptide (TAP) and lingual antimicrobial peptide (LAP) are present in multiple tissues including the airway (TAP and LAP), the gastrointestinal tract (LAP), the conjunctiva (LAP), and the genitourinary tract (LAP). Expression of the bovine epithelial -defensins is inducible by lipopolysaccharide in cultured tracheal epithelial cells (Diamond et al. 1996, Russell et al. 1996).

Results from the bovine studies suggest that ruminants will be a useful animal model for studying the regulation of -defensin gene expression in epithelial tissues and for analyzing the effects of physiologic and pharmacologic interventions on antimicrobial peptide gene expression. We have pursued these research directions in sheep, which have the advantages of a smaller adult size and which are a frequent animal model for studies of developmental gene regulation. Here we describe the identification of two sheep -defensins and analysis of their expression patterns within tissues of the gastrointestinal tract.

	MATERIALS AND METHODS

Abstract Introduction Methods Results Discussion References

Ovine tissues.  Tissues for RNA analysis were isolated from sheep at ages ranging from gestation d 115 to adulthood and frozen in liquid nitrogen prior to processing. Fetal samples were generous gifts of several collaborators and represented animals killed immediately following premature delivery as well as those supported for several hours with assisted ventilation. All newborn through adult samples were isolated from Dorset-cross animals.

RNA isolation and hybridization.  RNA was isolated from individual sheep tissues using the Ultraspec RNA reagent according to the manufacturer's instructions (Biotecx, Houston, TX). Yield varied from 15 µg to 0.8 mg/g wet weight depending on the tissue source. Analysis of tissue-specific gene expression using Northern blot hybridization was performed using 15 µg of total RNA per lane (Schonwetter et al. 1995). Hybridization conditions were 42°C in 50% formamide, and post-hybridization washing conditions were 2× SSC, room temperature, 2 × 10 min, followed by 0.2× SSC, 50°C, 2 × 15 min. Exposure times varied from 1 to 7 d.

Ovine -defensin cDNA isolation.  Ovine -defensin sequences were identified in RNA samples using the 3 RACE technique [rapid amplification of cDNA ends (Frohman et al. 1988)]. The forward primer selected from the bovine TAP cDNA sequence (Diamond et al. 1991) was designated Sheep-1s: 5 CAGCATCAGCTGCACAGCT 3. -defensin 3 RACE products were cloned using either the pAMP cloning system (Gibco BRL, Gaithersburg, MD) or the pCR-script system (Stratagene, La Jolla, CA). -defensin inserts were identified by hybridization with a second oligonucleotide whose sequence was derived from the TAP 3 UTS, designated as Sheep-2a: 5 CTCTGTCTAAGGACGCAGTT 3. Complete cDNA inserts were sequenced in both directions using the Cyclist^TM Taq DNA Sequencing Kit (Stratagene).

Reverse transcription-PCR.  Reverse transcription and PCR amplification were performed using SuperScript II reverse transcriptase and Taq DNA polymerase according to manufacturer's suggested protocols (Gibco BRL) using primers chosen from -defensin exon 2 sequences, which were specific for either SBD1 or SBD2. The PCR products were analyzed on 2% agarose gels incorporating ethidium bromide for visualization.

	RESULTS

Abstract Introduction Methods Results Discussion References

Two distinct ovine -defensin cDNA sequences, SBD1 and SBD2, were detected in epithelial tissues. Each predicts a 64-amino acid prepropeptide, and they share 87% identity at the nucleotide level, 78% identity at the amino acid level (Fig. 1). -Defensin expression was detected either by Northern blot hybridization (Fig. 2) or by RT-PCR (see below) in samples of adult ovine trachea, parenchymal lung, tongue, esophagus, rumen, reticulum, omasum and all segments of the small and large intestine. Samples from the palate, spleen, heart and liver were negative.

View larger version (13K): [in this window] [in a new window]   Fig 1. Predicted prepropeptide sequences for sheep -defensins and homologs. GenBank accession numbers: SBD1, sheep -defensin 1, U75250; SBD2, sheep -defensin 2, U75251; bovine TAP, tracheal antimicrobial peptide, M63023; bovine LAP, lingual antimicrobial peptide, S76279, chicken Gal-1, gallinacin-1 (Harwig et al. 1994). (.) amino acid identity; () deletion; underlined sequences represent isolated mature peptides.

View larger version (31K): [in this window] [in a new window]   Fig 2. Northern blot hybridization of SBD1 cDNA to total RNA from adult sheep tissues. Approximate RNA size of 450 nucleotides. Ru, rumen; Re, reticulum, Om, omasum; Ab, abomasum; Il, distal ileum; PC, proximal colon; Sp, mid-spiral; DC, distal colon; To, tongue.

The level of SBD RNA varied both among tissues from a single animal and for a single tissue analyzed from several animals (Fig. 3). In some animals, the forestomach signal was strongest, whereas in others the small or large intestine signal dominated. Postnatal regulation of -defensin expression was demonstrated in the case of the rumen, with peak signal at 6-8 wk of age (Fig. 4).

View larger version (27K): [in this window] [in a new window]   Fig 3. Northern blot hybridization of SBD1 cDNA to rumen (R), distal ileum (I), and colon (C) total RNA from 4- to 7-d-old lambs.

View larger version (29K): [in this window] [in a new window]   Fig 4. Northern blot hybridization of SBD1 cDNA to rumen total RNA isolated from animals between 1 and 84 d of life.

Prenatal -defensin expression was analyzed in fetuses between 115 d of gestation and term (approximately 145 d). Prenatal expression was detected by Northern blot (data not shown) and/or RT-PCR (see below) in the early rumen outpouching as well as in the tongue, small bowel and large bowel. Again, we detected significant variation in the level of expression among tissues of a single animal and among animals at a given gestation, with a trend towards higher levels during the third trimester.

The tissue distribution of each isoform was determined in two assays with differing sensitivities. In our initial analysis we cloned and sequenced 3 RACE products from multiple adult tissues. We found that that SBD1-encoding cDNAs predominated in all tissues tested excepting the ileum (Table 1). There were several 3 RACE sequences characterized that differed from the modal SBD1 or SBD2 isolates by a single nucleotide substitution and may represent alleles or PCR artifacts. By gene-specific RT-PCR on the same adult tissue RNA, SBD1 sequences could be detected in the ileum and SBD2 sequences in the tongue (Fig. 5). In contrast, fetal tissues expressed both the SBD1 and SBD2 isoforms.

View this table: [in this window] [in a new window]   Table 1. Tissue distribution of -defensin isoforms1

View larger version (48K): [in this window] [in a new window]   Fig 5. RT-PCR analysis of sheep -defensin isoform expression during gestation and adulthood. Primer pairs specific for exon 2 of SBD1 and SBD2 produced 96-bp products visualized by ethidium bromide fluorescence.

	DISCUSSION

Abstract Introduction Methods Results Discussion References

We have described the isolation of cDNA sequences representing two sheep -defensins expressed extensively in epithelial tissues. Their pattern of expression is unique in comparison with results for bovines (Diamond et al. 1991 and 1993, Schonwetter et al. 1995) and humans (Zhao et al. 1996). Although we expected to detect peptides with antimicrobial properties within epithelial tissues of the bacteria-laden gastrointestinal tract, the defensins are known to have additional activities, including epidermal growth stimulation (Murphy et al. 1993) and epithelial cell volume regulation (MacLeod et al. 1991), which may be of equal or greater importance in these tissues in vivo.

Our analysis demonstrates marked inter-animal variability for -defensin expression, with developmental regulation of isoform specificity. These results will provide the framework for future research involving both dietary manipulations and pharmacologic interventions in an attempt to enhance the expression of host immune peptides.

	ACKNOWLEDGMENTS

We would like to thank the laboratories of Barry Jesse, Machiko Ikegami, Alan Jobe, Barbara Stonestreet, Steven Abman and Peter Nathanielsz, as well as the cardiology research team at Children's Hospital, Boston, MA, for valuable tissue samples.

	FOOTNOTES

	LITERATURE CITED

Abstract Introduction Methods Results Discussion References

• Boman H. G. Peptide antibiotics and their role in innate immunity. Annu. Rev. Immunol. 1995; 13:61-92 [Medline] [Medline]
• Boman, H. G., Marsh, J. & Goode, J. A., eds. (1994) Symposium on Antimicrobial Peptides. Ciba Foundation Symposium. John Wiley & Sons, London, U.K.
• Diamond G., Jones D. E., Bevins C. L. Airway epithelial cells are the site of expression of a mammalian antimicrobial peptide gene. Proc. Natl. Acad. Sci. U.S.A. 1993; 90:4596-4600 [Medline] [Abstract/Free Full Text]
• Diamond G., Russell J. P., Bevins C. L. Inducible expression of an antibiotic peptide gene in lipopolysaccharide-challenged tracheal epithelial cells. Proc. Natl. Acad. Sci. U.S.A. 1996; 93:5156-5160 [Medline] [Abstract/Free Full Text]
• Diamond G., Zasloff M., Eck H., Brasseur M., Maloy W. L., Bevins C. L. Tracheal antimicrobial peptide, a cysteine-rich peptide from mammalian tracheal mucosa: peptide isolation and cloning of a cDNA. Proc. Natl. Acad. Sci. U.S.A. 1991; 88:3952-3956 [Medline] [Abstract/Free Full Text]
• Frohman M. A., Dush M. K., Martin G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. U.S.A. 1988; 85:8998-9002 [Medline] [Abstract/Free Full Text]
• Ganz T., Lehrer R. I. Defensins. Curr. Opin. Immunol. 1994; 6:584-589 [Medline] [Medline]
• Ganz T., Selsted M. E., Szklarek D., Harwig S.S.L., Daher K., Bainton D. F., Lehrer R. I. Defensins: natural peptide antibiotics of human neutrophils. J. Clin. Invest. 1985; 76:1427-1435 [Medline]
• Gudmundsson G. H., Lidholm D. A., Asling B., Gan R., Boman H. G. The cecropin locus. Cloning and expression of a gene cluster encoding three antibacterial peptides in Hyalophora cecropia. J. Biol. Chem. 1991; 266:11510-11517 [Medline] [Abstract/Free Full Text]
• Harwig S.S.L., Swiderek K. M., Kokryakov V. N., Tan L., Lee T. D., Panyutich E. A., Aleshina G. M., Shamova O. V., Lehrer R. I. Gallinacins: cysteine-rich antimicrobial peptides of chicken leukocytes. FEBS Lett. 1994; 342:281-285 [Medline]
• MacLeod R. J., Hamilton J. R., Bateman A., Belcourt D., Hu J., Bennett H.P.J., Solomon S. Corticostatic peptides cause nifedipine-sensitive volume reduction in jejunal villus enterocytes. Proc. Natl. Acad. Sci. U.S.A. 1991; 88:552-556 [Medline] [Abstract/Free Full Text]
• Murphy C. J., Foster B. A., Mannis M. J., Selsted M. E., Reid T. W. Defensins are mitogenic for epithelial cells and fibroblasts. J. Cell Physiol. 1993; 155:408-413 [Medline] [Medline]
• Ouellette A. J., Cordell B. Accumulation of abundant messenger ribonucleic acids during postnatal development of mouse small intestine. Gastroenterology 1988; 94:114-121 [Medline]
• Russell J. P., Diamond G., Tarver A. P., Scanlin T. F., Bevins C. L. Coordinate induction of two antibiotic genes in tracheal epithelial cells exposed to the inflammatory mediators lipopolysaccharide and tumor necrosis factor alpha. Infect. Immun. 1996; 64:1565-1568 [Medline] [Abstract]
• Schonwetter B. S., Stolzenberg E. D., Zasloff M. A. Epithelial antibiotics induced at sites of inflammation. Science 1995; 267:1645-1648 [Medline] [Abstract/Free Full Text]
• Selsted, M. E., Tang, Y., Morris, W. L., McGuire, P. A., Novotny, M. J., Smith, W., Henschen, A. H. & Cullor, J. S. (1993) Purification, primary structures, and antibacterial activities of -defensins, a new family of antimicrobial peptides from bovine neutrophils. J. Biol. Chem. 268, 6641-6648.
• Steiner H., Hultmark D., Engstrom A., Bennich H., Boman H. G. Sequence and specificity of two antibacterial proteins involved in insect immunity. Nature (Lond.) 1981; 292:246-248 [Medline] [Medline]
• Zhao C., Wang I., Lehrer R. I. Widespread expression of beta-defensin hBD-1 in human secretory glands and epithelial cells. FEBS Lett. 1996; 396:319-322 [Medline]

0022-3166/98 $3.00 ©1998 American Society for Nutritional Sciences