Journal of Nutrition OpenSOurce Diets- www.ResearchDiets.com

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sullivan, V. K.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sullivan, V. K.
Right arrow Articles by Cousins, R. J.

The Journal of Nutrition Vol. 127 No. 5 May 1997, pp. 694-698
Copyright ©1997 by the American Society for Nutritional Sciences

Competitive Reverse Transcriptase-Polymerase Chain Reaction Shows That Dietary Zinc Supplementation in Humans Increases Monocyte Metallothionein mRNA Levels1,2,3

Vicki K. Sullivan and Robert J. Cousins4

Food Science and Human Nutrition Department, Center for Nutritional Sciences, University of Florida, Gainesville, FL 32611

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
LITERATURE CITED

ABSTRACT

Zinc status is difficult to evaluate in humans. Metallothionein gene expression is transcriptionally regulated by dietary zinc and thus could serve as an assessment parameter based on zinc-dependent function. We used semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) to establish that MT mRNA is increased in a human monocytic cell line by addition of zinc to the medium. To examine this response in human subjects, a dietary supplement of 50 mg zinc gluconate/d was given for 15 d. Monocytes were purified from venous blood using NycoPrepTM 1.068. Monocyte purity was determined by flow cytometry using fluorescent anti-human monocyte CD14 antibodies. Total monocyte RNA was extracted and converted to cDNA by reverse transcription. Competitive RT-PCR was used to analyze differences between cDNA levels that are proportional to MT mRNA levels in monocytes from zinc-supplemented and control subjects. RT-PCR oligonucleotide primers were designed to amplify both a 201 bp segment of the human MT cDNA and a 180 bp competitor cDNA template. The 180 bp competitor cDNA template was used for MT cDNA quantitation. The RT-PCR data show that there was a significant increase in monocyte MT mRNA in subjects within 6 d of zinc supplementation, which remained elevated at d 15 of supplementation. In contrast, plasma zinc was greater at d 6 of zinc supplementation, but by d 15 of supplementation, while still elevated, was close to control levels. These data suggest that monocyte MT mRNA levels respond to zinc supplementation and that the response could serve as a more useful assessment variable than plasma zinc for the measurement of zinc status in humans.

KEY WORDS: humans · polymerase chain reaction · monocytes · complementary DNA · metallothionein mRNA · zinc status · nutrient assessment

INTRODUCTION

Although zinc is an essential mineral with numerous physiological roles (Cousins 1996, Hambidge et al. 1986), a specific, reliable biomarker or index for zinc status in humans has not been developed (King 1990). Metallothionein (MT)5 is a ubiquitous, cysteine-rich protein of low molecular weight (~6500 Da) that binds various metal ions (Kagi and Nordberg 1979). Because MT is transcriptionally regulated by zinc, MT has the potential for serving as an index of dietary zinc status in humans. Grider et al. (1990) demonstrated that erythrocyte MT levels reflect changes in dietary zinc status using a competitive enzyme linked immunosorbent assay (ELISA) designed specifically to measure human MT. The responsiveness of erythrocyte MT to zinc has also been documented in rats (Bremner et al. 1987, Robertson et al. 1989). The relative concentration of erythrocyte MT is probably the result of differential transcription in erythroid cells of the bone marrow (Huber and Cousins 1993a, Huber and Cousins 1993b).

Molecular techniques are now available that allow detection of small amounts of specific mRNAs in various cell types. Since dietary zinc intake is directly related to cellular MT mRNA levels in tissues of rats (Cousins and Lee-Ambrose 1992), we reasoned that an assay based on MT mRNA levels would provide an additional measurement of zinc intake and perhaps body zinc status in humans. This would constitute an assessment based on a function of zinc, i.e., transcriptional regulation of a metal-responsive gene (Cousins 1994, Cousins 1996). Previously this rationale was used to relate erythrocyte MT levels to zinc status (Grider et al. 1990, Thomas et al. 1992). Because mature erythrocytes are non-nucleated, mRNA levels cannot be measured in these cells. Alternatively, monocytes are nucleated blood cells, and have the highest level of MT protein and MT mRNA of the white blood cells (Harley et al. 1989). However, monocytes are not suitable for detection of MT protein levels because when compared to red blood cells, monocytes are much less abundant in human blood (0.01% of total blood cells; 2-8% of white blood cells), and contain only trace amounts of MT protein (Harley et al. 1989).

The level of human monocyte MT mRNA is so low that Northern analysis cannot be used as a method for quantitation using amounts of venous blood routinely removed for assessment purposes. However, reverse transcriptase-polymerase chain reaction (RT-PCR) is an alternative for detection of MT mRNA levels in zinc status assessment. In this procedure, mRNA is converted to cDNA which is then amplified by PCR and measured following separation of the cDNA products by electrophoresis. While semiquantitative RT-PCR is acceptable for assessing large-scale differences in mRNA levels, smaller differences such as may be encountered in nutritional assessment will likely require a more sensitive assay that is not susceptible to changes in amplification efficiency and interassay variation. These are common criticisms of the semiquantitative RT-PCR technology. Therefore, a competitive RT-PCR assay was developed to quantify MT mRNA levels in human monocytes and to examine whether these levels are responsive to changes in dietary zinc intake. The purpose of this study was to describe this method and to demonstrate the response of monocyte MT mRNA to zinc supplementation in human subjects.

MATERIALS AND METHODS

Cell culture. A human monocytic leukemic cell line, THP-1 cells, was obtained from American Type Culture Collection (Rockville, MD). The cells were grown in RPMI 1640 medium (Gibco BRL, Grand Island, NY) with 5 µmol 2-mercaptoethanol and 100 mL fetal bovine serum per L. Twenty-four hours prior to harvesting the cells, the medium was supplemented with 100 µmol zinc sulfate/L, while cells incubated in medium without zinc served as a control.

Subjects and supplementation. Twenty healthy male subjects between the ages of 19 and 35 y were randomly divided into a treatment or control group. The treatment group received a supplement of 50 mg zinc (as zinc gluconate) for 15 d, while the control group received a placebo. Compliance was verified by consumption of the supplement in the presence of a staff dietitian prior to the morning meal. This supplemental level is 3.3 times the RDA (National Research Council 1989). All subjects were non-smokers with no history of chronic illness who had normal blood chemistry profiles (SMAC 25, SmithKline Beecham, Collegeville, PA). They were advised to avoid zinc-rich foods such as oysters, to refrain from alcohol consumption, and to limit their intake of caffeine (Hambidge et al. 1986). Food frequency and 24-h recall information was collected from all participants. The study was approved by the University of Florida Institutional Review Board, and informed consent was obtained from all subjects.

Isolation of monocytes. Venous blood samples (10 mL) were withdrawn into tubes (Vacutainer No. 6457, Fisher Scientific, Pittsburgh, PA) containing EDTA, and monocytes were isolated using NycoPrepTM 1.068 (Gibco BRL) according to the manufacturer's directions. The blood was first mixed 1:10 with a solution of Dextran 500 (60 g/L) made in 154 mmol NaCl/L. The plasma was removed, layered over the NycoPrep, and centrifuged at 600 × g for 15 min. The monocytes were collected at the interface and the cells were washed twice with a solution of 154 mmol NaCl, 130 g EDTA and 10 g BSA/L. Flow cytometry was performed to verify the purity of the human monocyte population produced by this method. Briefly, 1 × 106 cells were diluted in Hank's balanced salt solution and centrifuged at 400 × g for 20 min. The cells were resuspended in DMEM (Gibco BRL) and incubated with mouse fluorescein isothiocyanate (FITC)-labeled anti-human monocyte CD14 antibody (Becton Dickinson, San Jose, CA) for 30 min prior to flow cytometry. A mouse IgG2b kappa antibody was used as a control (Sigma, St. Louis, MO).

RNA isolation and RT-PCR. Total RNA was extracted from THP-1 cells and human monocytes using the acid guanidinium thiocyanate-phenol-chloroform method (Chomczynski and Sacchi 1987). The following primers modified from a previously published PCR method (Soumillion et al. 1992) were synthesized to perform RT-PCR: 5' ATGGATCCCAACTGCTCCTGCG 3' (designated as MT5'), which contains a sequence complementary to the 3' end of human MT-2 mRNA, and 5' AGGGCTGTCCCAACATCAGGC 3' (designated as MT3'), which contains a sequence complementary to the 5' end of human MT-2 mRNA. The GeneAmp RNA PCR Kit (Perkin Elmer Cetus, Foster City, CA) was used for PCR amplification according to the manufacturer's instructions. Reverse transcription was performed with 200 ng RNA and 300 U reverse transcriptase (20 µL reaction volume) for 60 min at 37°C followed by heat inactivation for 5 min at 95°C (Ausubel et al. 1995). Human MT-2 genomic DNA (hMT-IIa; American Type Culture Collection) was used as a control for PCR. The following cycle was used for PCR: denaturation for 30 sec at 95°C, annealing for 1 min at 55°C, extension for 1 min at 72°C. These steps were repeated for 25 cycles for THP-1 cell RNA (semiquantitative RT-PCR), and 30 cycles for human monocyte RNA (competitive RT-PCR).

Competitive RT-PCR. A competitor MT cDNA was constructed (Fig. 1) using as a template human MT cDNA derived from reverse transcribed monocyte RNA. A 180 bp segment of the hMT-2 cDNA was amplified using MT5' (described above) and the following specially designed composite 3' primer: 5' GGGCTGTCCCAGCATCAGGCCCCTTTGCAGATGCAGCCTTG 3' (MTC) (Celi et al. 1993). This design created a 21 bp internal deletion of the hMT-2 cDNA and yielded a 180 bp competitor cDNA template upon PCR. In practice, for this competitive RT-PCR approach, the original MT5' and MT3' primers were used to simultaneously amplify both the competitor MT cDNA and the target MT cDNA templates. For long term storage, the MT cDNA competitor template was ligated into the pCR II vector using the TA Cloning Kit (Invitrogen, San Diego, CA). The competitive RT-PCR assay is outlined in Figure 2, beginning with reverse transcription of monocyte RNA. In these experiments, twofold dilutions of the competitor MT cDNA template were made. These dilutions were added to a constant amount of the monocyte MT cDNA in a 20 µL reaction volume and co-amplified using the cycling protocol for RT-PCR described above. The RT-PCR products were separated on an 8% polyacrylamide gel at 40 mV, and stained with ethidium bromide (Ausubel et al. 1995). As diagrammed in Figure 2, the competitor MT cDNA could be distinguished from the MT cDNA by the difference in size when separated using polyacrylamide gel electrophoresis (PAGE). The gels were then photographed and analyzed by densitometric scanning of film negatives. The concentration of competitor cDNA that gave a 1:1 signal with the target cDNA was used to calculate the concentration of the latter, basically as described by Gilliland et al. (1990). A coefficient of variation of 10% was used when analyzing MT cDNA competitor and MT cDNA bands for which a 1:1 relationship in intensity was established.
Fig. 1. Overview of metallothionein (MT) cDNA competitor template construction. 1) The MT cDNA competitor was amplified using the MT cDNA template. 2) The MT 5' primer and a 41 bp composite primer (MTC), which was designed to eliminate a 21 bp region within the MT cDNA template, were used for polymerase chain reaction (PCR). 3) This resulted in a 180 bp competitor cDNA product.
[View Larger Version of this Image (18K GIF file)]

Fig. 2. Diagram of competitive reverse transcriptase polymerase chain reaction (RT-PCR) assay. Total monocyte RNA is extracted and reverse transcribed to cDNA. For each human monocyte sample, a series of known dilutions of the competitor cDNA is added to a constant amount of the human monocyte cDNA. PCR is performed for 30 cycles, and the cDNA products are resolved on an 8% polyacrylamide gel, stained with ethidium bromide and photographed under UV light. Densitometric scanning of film negatives establishes the competitor dilution at which a 1:1 relationship occurred between the competitor cDNA and monocyte cDNA bands. The competitor concentration is used to calculate the relative mRNA abundance.
[View Larger Version of this Image (24K GIF file)]

Plasma zinc analysis. Venous blood was withdrawn into trace element-free tubes (Vacutainer No. 369735, Fisher Scientific) containing sodium heparin. Plasma was diluted 1:5 with glass-distilled, deionized water, and the zinc concentration was measured by air acetylene flame atomic absorption.

Statistics. Repeated measures ANOVA was used to test for significant differences in monocyte MT cDNA (SAS Institutes 1996, Littell et al. 1996) and plasma zinc (Instat, San Diego, CA). Significance was established at P < 0.05. 

RESULTS

PAGE separation of the target MT cDNA and the competitor cDNA is shown in Figure 3. Clearly, the two DNAs are separable using a gel of this concentration. The 180 bp and 201 bp sizes of the cDNA products are consistent with the sizes expected. They compare favorably with the DNA size markers. The effectiveness of the competitor cDNA in altering the abundance of the target cDNA product after PCR is demonstrated in Figure 4. Furthermore, this shows that a concentration of ~5 pg gave a 1:1 abundance in this example.
Fig. 3. Visualization of competitor and human monocyte cDNA following polyacrylamide gel electrophoresis (PAGE) separation. The metallothionein (MT) cDNA and competitor cDNA were resolved on an 8% polyacrylamide gel stained with ethidium bromide. The 201 bp MT cDNA is visually distinguished from the 180 bp competitor cDNA when viewed under UV light.
[View Larger Version of this Image (34K GIF file)]

Fig. 4. Competitive reverse transcriptase polymerase chain reaction (RT-PCR) assay to quantify metallothionein (MT) mRNA. As outlined in Figure 2, 200 ng of monocyte total RNA was reverse transcribed. Two-fold dilutions of the competitor cDNA and a fixed quantity of monocyte cDNA were amplified by PCR for 30 cycles. The cDNA products were resolved on an 8% polyacrylamide gel, stained with ethidium bromide, and photographed under UV light. Relative intensities of bands were determined by densitometric scanning of film negatives. The amount of MT cDNA was established as the point at which a 1:1 relationship occurred between the competitor cDNA band and the MT cDNA band (5 pg in this example).
[View Larger Version of this Image (19K GIF file)]

The hypothesis that zinc treatment up-regulates MT gene expression thereby increasing MT mRNA levels and that PCR can identify this increase was first tested in vitro using THP-1 monocytic cells. Figure 5 shows a comparison of MT cDNA products generated using semiquantitative RT-PCR on RNA from zinc-treated THP-1 cells and control cells. Clearly, zinc added to the culture medium increased mRNA levels in THP-1 cells as demonstrated by differences in the cDNA yield after 25 cycles of RT-PCR. While sufficient for the purpose of establishing metallothionein mRNA expression, semiquantitative RT-PCR is not able to discriminate between small changes in mRNA levels. Consequently, competitive RT-PCR was required for experiments that describe a response to zinc supplementation in human subjects (Fig. 2).

Fig. 5. Zinc-stimulated increase in metallothionein mRNA levels in THP-1 cells using semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR). Total RNA was extracted from THP-1 cell cultures and reverse transcribed. PCR was then performed for 25 cycles, and cDNA products were resolved on an 8% polyacrylamide gel. Treated THP-1 cells received 100 µmol zinc/L 24 h prior to harvesting, and control cells received no zinc treatment.
[View Larger Version of this Image (39K GIF file)]

The primary purpose of this study was to examine MT mRNA in blood cells using a method that would be appropriate for nutritional surveys. However, the abundance of MT mRNA in total RNA derived from the entire leukocyte population was found to be too low for detection even by the sensitive RT-PCR method. Consequently, our approach to circumvent this problem was to use an enriched monocyte population as a source of the MT mRNA. The results of flow cytometry for human monocytes enriched by the NycoPrep method are presented in Figure 6. Monocyte purity as confirmed by FITC-labeled anti-CD14 antibodies was 80 ± 2%. The distribution of cells isolated by the NycoPrep method is shown in panel A, and panel B shows the distribution of CD14 marker across the gated monocyte population.

Fig. 6. Flow cytometry profile of human monocytes. Panel A) Monocyte (R2) and lymphocyte (R1) population profiles after enrichment using Nycoprep 1.068. Panel B) Fluorescent intensity of gated monocyte population (R2 from panel A) using fluorescein isothiocyanate (FITC)-labeled anti-CD14 antibodies. Monocyte enrichment was 80 ± 2%.
[View Larger Version of this Image (24K GIF file)]

Using total RNA isolated from monocyte-enriched samples, competitive RT-PCR showed that there was an increase in MT cDNA generated when RNA from zinc-supplemented subjects was compared to RNA from controls. Plasma zinc concentration was 80% greater (P < 0.01) at d 6 of supplementation compared to d 0 (Fig. 7A). By d 15 of supplementation, plasma zinc had markedly decreased compared to that at d 6, but was still significantly elevated (20%; P < 0.05) compared to unsupplemented controls. Monocyte MT mRNA levels (measured as metallothionein cDNA in pg cDNA/ng of total monocyte RNA) were significantly greater (P < 0.05) in zinc-supplemented subjects compared to the control group at both d 6 and d 15 of supplementation (Fig. 7B). The interassay coefficient of variation for this competitive RT-PCR method was 6%, whereas the intraassay coefficient of variation was 9%.

Fig. 7. Effects of dietary zinc supplementation on plasma zinc concentrations and human monocyte metallothionein (MT) mRNA levels. Monocytes and plasma were obtained from subjects that either received supplemental zinc (Zn Supplement, 50 mg zinc per day) or received no zinc (Control) for 15 d. Monocytes were enriched by gradient centrifugation (as described in Figure 6), total RNA was isolated and competitive reverse transcriptase polymerase chain reaction (RT-PCR) was performed (as outlined in Figure 2). Panel A: Plasma zinc concentration. Panel B: MT cDNA expressed as pg MT cDNA produced per ng monocyte RNA from zinc-treated and control subjects. Values are means ± SEM (n = 20 at d 0 of supplementation; n = 10 per group at d 6 and d 15). The difference between zinc-supplemented and control subjects is significant at (*) P < 0.01 or (**) P < 0.05.
[View Larger Version of this Image (19K GIF file)]

DISCUSSION

This study was designed to test the effectiveness of competitive RT-PCR for the measurement of human monocyte MT mRNA. The ultimate goal is to eventually apply this technique to the assessment of zinc status in humans. While previous studies have shown that tissue MT mRNA levels are regulated by zinc status in rats (Blalock et al. 1988, Cousins and Lee-Ambrose 1992), this is the first assay to demonstrate that MT mRNA levels in humans change as a function of zinc intake.

Numerous methods have been used to measure zinc status in humans. Plasma and serum zinc concentrations are the most common (Cousins 1989). Cell levels of zinc (e.g., erythrocytes) have also been used for zinc status assessment. However, these variables do not reflect total body zinc status (King 1990, Solomons 1979). Another approach to assessment of nutrient status is to evaluate a nutrient-dependent function. The transcriptional regulation of the MT gene is a function of zinc (Cousins 1994, Cousins 1996). Erythrocyte MT has shown promise as an index that reflects overall changes in zinc intake (Grider et al. 1990, Thomas et al. 1992). The results presented here suggest that monocyte MT mRNA could also serve as a useful index of zinc intake in humans.

Monocytes were chosen as the most appropriate source for measurement of MT mRNA levels because monocyte MT levels are the highest of the white blood cells. Harley et al. (1989) showed that human monocyte MT levels were threefold higher than those of lymphocytes using 109Cd labeling and Sephadex G-75 column chromatography. Monocytes in vivo and in culture respond to host defense mediators. For example, lipopolysaccharide may produce a transient increase in MT mRNA levels in THP-1 cells (Leibbrandt and Koropatnick 1994). This suggests that illnesses that increase monocyte MT expression could be a complicating factor in the use of monocyte MT mRNA for zinc status assessment. An assay that would be an indicator of a complicating factor, e.g., increase in an acute phase protein, could address this question in field studies. A flow cytometry analysis of the leukocyte population would also be an indicator of elevated monocyte production. Further use of this RT-PCR method may clarify the potential response of monocyte MT mRNA to disease variables.

THP-1 cells provided a useful model for initially determining the effects of zinc treatment on monocyte MT mRNA using RT-PCR. A visible difference between cDNAs produced from RNA of zinc-treated and control cells was evident on an ethidium bromide-stained polyacrylamide gel after semi-quantitative RT-PCR (Fig. 5). However, differences between zinc-supplemented human subjects and controls were not evident when semi-quantitative RT-PCR was used. The zinc concentration that the THP-1 cells were exposed to (100 µmol Zn/L) is high compared to the zinc concentrations that monocytes would be exposed to in human subjects. Consequently, the zinc-induced increase in MT mRNA in the cells would be expected to be high. There are other reasons why the semiquantitative RT-PCR is not a viable approach to assessment work where differences in expression may be small. Specifically, amplification efficiency differs between samples, and reactions must be run within the exponential phase of the reaction curve. These factors can lead to poor reproducibility, even under the most controlled experimental conditions.

Competitive RT-PCR controls for the inherent problems that occur with semiquantitative RT-PCR (Kohler et al. 1995). Because the competitor cDNA template is amplified within the same tube as the template of interest, shares the same primers and is very close in size, any variable influencing the amplification will affect both the competitor and the template of interest. Thus, the competitor cDNA template serves as an internal control. Another important advantage of competitive RT-PCR is that the reaction can be run beyond the exponential phase of the reaction curve well into the plateau phase because the ratio of target to standard remains constant during the amplification. When a 1:1 relationship is reached between the competitor cDNA and the target cDNA, the amount of target cDNA can be quantitated from the amount of competitor template that has been added to a specific reaction.

In conclusion, the results presented here have shown for the first time that cellular MT mRNA levels change in vivo in human subjects in response to dietary zinc. Two decades of data from animals and isolated cells support that zinc is the direct inducer of increased MT mRNA expression in this study with humans. The response of monocyte MT mRNA could serve as an index of zinc supplementation and be of practical value in studies where supplementation efficacy must be monitored, for example, zinc prophylaxis in treatment of persistent diarrhea (Sazawal et al. 1996). This method may also have value for assessment of zinc deficiency if the responsiveness of monocyte MT mRNA to depletion and varying zinc intake can be demonstrated in future experiments. The RT-PCR approach has wide applicability for nutrient assessment in those situations where genes are differentially expressed, either directly or indirectly through mediators, by changes in dietary intake of a specific nutrient.

FOOTNOTES

1   Presented in abstract form at the American Institute of Nutrition annual meeting in Washington, DC, April 15, 1996 [Sullivan, V. K., R. K. Blanchard & Cousins R. J. (1996) Competitive RT-PCR shows that zinc supplementation up-regulates metallothionein mRNA levels in human monocytes and THP-1 cells. FASEB J. 10: A192].
2   Supported by research grant DK31127 and Institutional National Research Service Award DK07667 from the National Institute of Diabetes and Digestive and Kidney Diseases, and Boston Family Endowment Funds.
3   The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
4   To whom correspondence should be addressed. e-mail: cousins@gnv.ifas.ufl.edu.
5   Abbreviations used: BSA, bovine serum albumin; ELISA, enzyme-linked immunosorbent assay; FITC, fluorescein isothiocyanate; hMT, human metallothionein; PAGE, polyacrylamide gel electrophoresis; MT, metallothionein; RT-PCR, reverse transcriptase-polymerase chain reaction.

Manuscript received 25 November 1996. Initial reviews completed 7 January 1997. Revision accepted 30 January 1997.

LITERATURE CITED

0022-3166/97 $3.00 ©1997 American Society for Nutritional Sciences



This article has been cited by other articles:


Home page
 BloodHome page
J. A. Browning, H. M. Staines, H. C. Robinson, T. Powell, J. C. Ellory, and J. S. Gibson
The effect of deoxygenation on whole-cell conductance of red blood cells from healthy individuals and patients with sickle cell disease
Blood, March 15, 2007; 109(6): 2622 - 2629.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
R A Cragg, S R Phillips, J M Piper, J S Varma, F C Campbell, J C Mathers, and D Ford
Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation
Gut, April 1, 2005; 54(4): 469 - 478.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
J. C. Fanzo, S. K. Reaves, L. Cui, L. Zhu, and K. Y. Lei
p53 protein and p21 mRNA levels and caspase-3 activity are altered by zinc status in aortic endothelial cells
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C631 - C638.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
J. C. Fanzo, S. K. Reaves, L. Cui, L. Zhu, J. Y. J. Wu, Y. R. Wang, and K. Y. Lei
Zinc status affects p53, gadd45, and c-fos expression and caspase-3 activity in human bronchial epithelial cells
Am J Physiol Cell Physiol, September 1, 2001; 281(3): C751 - C757.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Coll. Nutr.Home page
N. R. Glick, M. H. Fischer, and W. N. Adkins Jr
The Influence of Nutrition on IGF-1 in Tube-Fed Profoundly Retarded Adults
J. Am. Coll. Nutr., February 1, 2001; 20(1): 81 - 86.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
J. Cao and R. J. Cousins
Metallothionein mRNA in Monocytes and Peripheral Blood Mononuclear Cells and in Cells from Dried Blood Spots Increases after Zinc Supplementation of Men
J. Nutr., September 1, 2000; 130(9): 2180 - 2187.
[Abstract] [Full Text]

Home page
 J. Nutr.Home page
S. K. Reaves, J. C. Fanzo, K. Arima, J. Y. J. Wu, Y. R. Wang, and K. Y. Lei
Expression of the p53 Tumor Suppressor Gene Is Up-Regulated by Depletion of Intracellular Zinc in HepG2 Cells
J. Nutr., July 1, 2000; 130(7): 1688 - 1694.
[Abstract] [Full Text]

Home page
 Am. J. Physiol. Cell Physiol.Home page
J. Y. J. Wu, Y. Wu, S. K. Reaves, Y. R. Wang, P. P. Lei, and K. Y. Lei
Apolipoprotein A-I gene expression is regulated by cellular zinc status in Hep G2 cells
Am J Physiol Cell Physiol, September 1, 1999; 277(3): C537 - C544.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
L. Cui, Y. Takagi, M. Wasa, Y. Iiboshi, M. Inoue, J. Khan, K. Sando, R. Nezu, and A. Okada
Zinc Deficiency Enhances Interleukin-1alpha -Induced Metallothionein-1 Expression in Rats
J. Nutr., July 1, 1998; 128(7): 1092 - 1098.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
V. K. Sullivan, F. R. Burnett, and R. J. Cousins
Metallothionein Expression Is Increased in Monocytes and Erythrocytes of Young Men during Zinc Supplementation
J. Nutr., April 1, 1998; 128(4): 707 - 713.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sullivan, V. K.
Right arrow Articles by Cousins, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sullivan, V. K.
Right arrow Articles by Cousins, R. J.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]